Deficiency in riboflavin biosynthesis affects tetrapyrrole ... - Springer Link

Plant Mol Biol (2012) 78:77–93 DOI 10.1007/s11103-011-9846-1

Deficiency in riboflavin biosynthesis affects tetrapyrrole biosynthesis in etiolated Arabidopsis tissue Boris Hedtke • Ali Alawady • Alfonso Albacete • Koichi Kobayashi • Michael Melzer • Thomas Roitsch Tatsuru Masuda • Bernhard Grimm

•

Received: 24 August 2011 / Accepted: 29 October 2011 / Published online: 13 November 2011 Ó Springer Science+Business Media B.V. 2011

Abstract Tetrapyrrole biosynthesis is controlled by multiple environmental and endogenous cues. Etiolated T-DNA insertion mutants were screened for red fluorescence as result of elevated levels of protochlorophyllide and four red fluorescent in the dark (rfd) mutants were isolated and identified. rfd3 and rfd4 belong to the group of photomorphogenic cop/det/fus mutants. rfd1 and rfd2 had genetic lesions in RIBA1 and FLU encoding the dual-functional protein GTP cyclohydrolase II/3,4-dihydroxy-2-butanone-4phosphate synthase and a negative regulator of tetrapyrrole biosynthesis, respectively. RIBA1 catalyses the initial reaction of the metabolic pathway of riboflavin biosynthesis and rfd1 contains reduced contents of riboflavin and the flavo-

Electronic supplementary material The online version of this article (doi:10.1007/s11103-011-9846-1) contains supplementary material, which is available to authorized users. B. Hedtke A. Alawady B. Grimm (&) Institute of Biology/Plant Physiology, Humboldt University Berlin, Philippstraße 13, Building 12, 10115 Berlin, Germany e-mail: [email protected] A. Albacete T. Roitsch Institut fu¨r Pflanzenwissenschaften, Bereich Physiologie, Karl-Franzens-Universita¨t, Schubertstr. 51, 8010 Graz, Austria K. Kobayashi RIKEN Plant Science Center, 1-7-22 Suehiro-cho, Tsurumi-ku, Yokohama 230-0045, Japan M. Melzer Leibniz-Institute of Plant Genetics and Crop Plant Research, Corrensstr. 3, 06466 Gatersleben, Germany T. Masuda Graduate School of Arts and Sciences, Department of General Systems Studies, The University of Tokyo, Komaba 3-8-1, Meguro, Tokyo 153-8902, Japan

coenzymes FMN and FAD. Transcriptome analysis of rfd1 revealed up-regulated genes encoding nucleus-localized factors involved in cytokinin signalling and numerous downregulated LEA genes as well as an auxin-inducible GH3 gene. Alteration of cytokinin metabolism of rfd1was confirmed by elevated contents of active forms of cytokinin and stimulated expression of an ARR6::GUS reporter construct. An etiolated quadruple ckx (cytokinin oxidase) mutant with impaired cytokinin degradation as well as different knockout mutants for the negative AUX/IAA regulators shy2-101 (iaa3), axr2-1 (iaa7) and slr-1 (iaa14) showed also excessive protochlorophyllide accumulation. The transcript levels of CHLH and HEMA1 encoding Mg chelatase and glutamyltRNA reductase were increased in rfd1 and the AUX/IAA loss-of-function mutants. It is proposed that reduced riboflavin synthesis impairs the activity of the flavin-containing cytokinin oxidase, increases cytokinin contents and derepresses synthesis of 5-aminolevulinic acid of tetrapyrrole metabolism in darkness. As result of the mutant analyses, the antagonistic cytokinin and auxin signalling is required for a balanced tetrapyrrole biosynthesis in the dark. Keywords Tetrapyrrole biosynthesis Chlorophyll ALA biosynthesis Protochlorophyllide Riboflavin biosynthesis Phytohormone Cytokinin Auxin T-DNA insertion mutagenesis Abbreviations DBPS 3,4-dihydroxy-2-butanone-4-phosphate synthase GCHII GTP cyclohydrolase II GluTR Glutamyl-tRNA reductase GSAT Glutamate-1-semialdehyde aminotransferase MgProto Magnesium protoporphyrin Pchlide Protochlorophyllide

123

78

POR Proto

Plant Mol Biol (2012) 78:77–93

Protochlorophyllide oxidoreductase Protoporphyrin IX

Introduction Endogenous and environmental stimuli control the pathway of tetrapyrrole biosynthesis with the major endproducts chlorophyll and heme. Eight molecules of 5-aminolevulinic acid (ALA), the ultimate precursor for all tetrapyrroles, form the macrocycle of porphyrins, in which Mg2? or Fe2? ions are inserted for chlorophyll and heme formation, respectively (Beck and Grimm 2006; Masuda and Fujita 2008; Vavilin and Vermaas 2002). It is generally accepted that synthesis of ALA is the ratelimiting step of the pathway and its control occurs transcriptionally and posttranslationally by various endogenous and external factors (Tanaka and Tanaka 2007). Light and darkness exert a specific strong impact on seedling development. Growth of light-exposed seedlings results in photomorphogenic development, which includes also a strong stimulation of 5-aminolevulinic acid (ALA) and chlorophyll biosynthesis. Thereby, far red light modulation of gene expression for tetrapyrrole biosynthesis interferes with the block of light-dependent protochlorophyllide oxidoreductase (POR) activity (Barnes et al. 1996; Sperling et al. 1997). In darkness, the COP9 signalosome degrades nuclear proteins like the transcriptions factors HY5, LAF1, HFR and HYH that control light-induced genes, e.g. HEMA1 encoding glutamyl-tRNA reductase (GluTR) (McCormac and Terry 2002; Yi and Deng 2005). Transcriptional activation of these genes is ensured by cryptochrome-dependent inhibition of the COP9-mediated protein degradation (Wang et al. 2001). Inactivation and deficiency of single components of the COP9 signalosome cause the photomorphogenic phenotype of etiolated mutants (Wei and Deng 2003). Similar to other metabolic pathways, feed-forward and feedback control mechanisms (Paul and Pellny 2003) facilitate adjustment between early and late steps of tetrapyrrole biosynthesis to ensure the balanced metabolic flux in the pathway by posttranslational modification of participating enzymes and plastid-derived signals controlling nuclear genes (Beck and Grimm 2006; Mochizuki et al. 2001; Nott et al. 2006). For example, transgenic plants with inducible silencing of HEMA1 show reduced activities of Mg chelatase and ferrochelatase, two enzymes at the branchpoint towards chlorophyll and heme biosynthesis (Hedtke et al. 2007). Transgenic tobacco plants with silenced genes for early steps of Mg porphyrin synthesis are characterized by transcriptional changes of genes involved in ALA synthesis (Alawady and Grimm 2005; Papenbrock et al. 2000a, b).

123

Posttranslational control of ALA synthesis is performed by the negative regulator FLU, which binds to GluTR. Lack of FLU is responsible for derepression of ALA biosynthesis and excessive accumulation of protochlorophyllide (Pchlide) in etiolated seedlings resulting in a photobleached phenotype upon light exposure (Meskauskiene et al. 2001). The GUN4 protein interacts with Mg chelatase and stimulates its activity (Davison et al. 2005; Larkin et al. 2003). Under photoperiodic growth GUN4 deficiency entirely blocks chlorophyll biosynthesis at the posttranslational level, which is not compensated upon ALA supply (Peter and Grimm 2009). Chlorophyll biosynthesis is also controlled by phytohormones. Cytokinin feeding of etiolated seedlings triggers a photomorphogenesis-like response with shorter hypocotyls, open cotyledons and conversion of plastidial prolamellar bodies into primary thylakoid membranes (Chory et al. 1994). Cytokinin stimulates ALA synthesis and the gene expression for contributing enzymes (Masuda et al. 1994; Yaronskaya et al. 2006). Cytokinin and auxin interact antagonistically on plant growth and development (Coenen and Lomax 1997; Moubayidin et al. 2009; Rashotte et al. 2005; Werner and Schmu¨lling 2009; Zhao 2008) and affect physiological and genetic processes for organ differentiation, root development, root growth and shoot branching. Such hormonal interplay is executed at different levels of transcriptional activation and posttranslational modifications. The two phytohormones mutually control synthesis, transport and degradation of the hormonal counterpart (Mu¨ller and Sheen 2008). Auxin is proposed to mediate repression of biosynthetic genes for cytokinin and stimulates expression of CKX genes encoding the cytokinin degrading cytokinin oxidases. These metabolic alterations modulate the contribution of active cytokinin to the antagonistic hormonal action (Tanaka et al. 2006; Werner et al. 2003). Furthermore, cytokinin treatment can modulate auxin-regulated genes, in particular negative regulators and auxin-conjugating enzymes (Moubayidin et al. 2009). Similarly, ethylene functioning primarily in plant development and stress response is also involved in the modulation of greening of etiolated seedlings (Zhong et al. 2009) by protecting deetiolating seedlings against photodynamic stress caused by Pchlide accumulation. More recently, it was reported that DELLA, a gibberellin-controlled regulator also contributes to balanced accumulation of Pchlide and expression of POR in etiolated seedlings (Cheminant et al. 2011). The complexity of the tetrapyrrole biosynthetic pathway coincides with the pivotal functions and properties of its metabolic endproducts as well as the need for advanced regulatory mechanisms to adjust the metabolic flow in the pathway. We are interested in elucidating such mechanisms acting on ALA biosynthesis by taking advantage of the


dark-dependent suppression of ALA synthesis in angiosperms. A screen of etiolated T-DNA insertion mutants revealed new factors contributing to the control of ALA biosynthesis independently from the dominant light stimulus. Impaired repression of ALA synthesis leads to excessive accumulation of Pchlide in the dark, which is detectable by increased red fluorescence of the etiolated seedlings. Among several red fluorescent in the dark (rfd) mutants we found one mutant line with a block in riboflavin biosynthesis. This mutation had an impact on cytokinin content and hence, on hormonal control of tetrapyrrole synthesis in etiolated seedlings.

Materials and methods Plant material, microscopy Screening of Arabidopsis mutants containing plasmid pWA5 and identification of insertion sites were described by Hedtke and Grimm (2009). Light microscopy and extraction of Pchlide were performed as indicated there. The detected Pchlide fluorescence was divided by the number of seedlings (Fig. 2). Transmission electron microscopy was carried out as described by Tognetti et al. (2006), except that a FEI Tecnai G2 Sphera transmission electron microscope (FEI, http://www.fei.com) was used for ultrastructural analysis at 120 kV. For expression analysis in Fig. 7c, Arabidopsis seedlings were grown on liquid Murashige and Skoog (MS) medium containing 1% (w/v) sucrose in darkness for 4 days. Seedlings were collected in liquid nitrogen under dim light and used for RNA extraction. For Pchlide quantification in Fig. 8d, seedlings were germinated and grown on 0.8% (w/ v) agar-solidified MS medium containing 1% (w/v) sucrose in darkness for 4 days. Then five seedlings were collected directly in 80% (v/v) acetone under dim light to extract Pchlide. Calibration was performed using Pchlide extracted from etiolated cucumber seedlings. The mutants ahk2-2, ahk3-3 (Higuchi et al. 2004), axr2-1 (Nagpal et al. 2000; Timpte et al. 1994) and slr-1 (Fukaki et al. 2002) were previously described. shy2-101 is a gain-of-function mutant of IAA3 in the Col-0 background (Fukaki et al., unpublished). Arabidopsis thaliana reporter line ARR6::GUS (To et al. 2004) was obtained from the Arabidopsis Biological Resource Centre (Columbus, Ohio).

79

products were cloned into pZERO-1 (Invitrogen). Inserts were released by Ecl136II and PvuII (4-1), Ecl136II and BsrBI (11-6) or Eco72I (10-2) digestion. The binary vector pBinAR was modified to remove the 35S promoter by restriction with EcoRI and Acc65I followed by filling in with Klenow enzyme and re-ligation. The resulting plasmid was linearized with SmaI and ligated to to above described blunt-ended fragments obtained from cloned PCR products. Microarray analyses Five-day-old etiolated homozygous rfd1 and wild-type seedlings for two independent biological replicates were identified under short-time blue light excitation using a Leica MZ FLIII equipped with filter set GFP1 (425 ± 30 nm; 480 nm) and homogenized in liquid nitrogen using a Retsch mill MM200 (Haan, Germany). RNA was extracted, treated with DNA-free (Ambion, Austin) and purified using Plant-RNA-Mini-Kit columns (Invitek, Berlin). Microarray analysis was accomplished at the Deutsches Ressourcenzentrum fu¨r Genomforschung GmbH, Berlin on an Affymetrix ATH1 chip according to standard procedures with 3 lg purified RNA. Data of the obtained cell files were analyzed using the BioConductor (http://www.bioconductor.org) affy package with the RMA normalization method. Differentially expressed genes were identified following the LIMMA model. The resulting logged expression coefficients of mutant versus wild type were filtered using a P value of 0.01 as limit. RNA quantification Semi-quantitative RT-PCRs were performed as described in Hedtke and Grimm (2009). PCR products were quantified using AlphaImager with AlphaEase FC software of Biozym (Hessisch Oldendorf, Germany). For quantitative RT-PCR, total RNA was reversely transcribed by the RTPCR kit (Ver. 3.0, TaKaRa Bio) and cDNA amplified using the SYBR PreMix Ex TaqTM (Takara) and 100 nM primers. Thermal cycling consisted of 95°C for 10 s, 40 cycles of 5 s at 95°C and 30 s at 62°C. Signal detection and quantification was performed in duplicate using MiniOpticon (BioRad). The relative abundance of amplified transcripts was normalized to the expression level of ACTIN 8. Primers used in quantification experiments are listed in supplemental table S4. For each gene three biologically independent experiments were performed.

Cloning procedures Extraction and quantification of riboflavin Genomic fragments for complementation of rfd1 were amplified using oligonucleotides ccggagagatctcgatcaatg/ ggagtgtttttgctttgttg (plasmids 4-1 and 11-6) and acacgtgacc ataaaacgaaattaccaa/acacgtgtgattcggtgtggagga (10-2). PCR

Plant material (0.1 g) was harvested from rosette leaves of 3 to 5-week-old plants grown under short day conditions at 120 lmole photons m-2 s-1. Leaves were ground in

123

80

liquid nitrogen, resuspended in 0.5 ml of methanol/ methylen chloride (9:10), centrifuged and neutralized with 0.1 M ammonium hydrogen carbonate to pH 7. The supernatant was filtered through a 45 lm filter and flavins were immediately quantified by HPLC (system 1100, Agilent, Bo¨blingen). Samples were separated on a X-Terra MS C18 reversed phase column (150 mm; 4.6 mm diameter; 3.5 lm particle size) and eluted with a linear gradient of solvent B (50 mM ammonium acetate, pH 6) and solvent A (methanol) from 100 to 30% over 30 min at a flow rate of 0.8 ml/min. Riboflavin, FMN and FAD were detected by fluorescence (kex 450 nm, kem 530 nm) and confirmed using authentical standards (Sigma–Aldrich, Taufkirchen). GUS activity assays Heterozygous individuals of rfd1 were crossed with lines carrying ARR6::GUS (To et al. 2004). F1 individuals carrying the T-DNA-insertion upstream of RIBA1 as well as the GUS reporter construct were selected. F2 individuals were harvested from sucrose-containing MS plates after 10 d (light-grown seedlings) and MS plates without sugar after 6d (etiolated seedlings). Homozygous F2-rfd1 seedlings were identified according to their phenotype. About 40 seedlings for each sample were ground in liquid nitrogen and solved in extraction buffer following the protocol of Cervera (2005). Determination of cytokinin contents Homozygous individual 6-days-old etiolated rfd1 and control seedlings were identified on MS agar plates and ground in liquid nitrogen. Different forms of CKs were extracted, purified and used as standards (Albacete et al. 2008). Samples were resuspended in 80% (v/v) methanol including a internal standard mix (5 lg ml-1) composed of deuteriumlabelled cytokinins ([2H5]zeatin, [2H5]zeatin-riboside, [2H5]zeatin-O-glucoside, [2H5] zeatin-O-glucoside riboside, [2H6]isopentenyl adenine, [2H5]dihydro-zeatin, [2H5]dihydro-zeatin riboside), incubated for 30 min at 4°C, and centrifuged. Supernatants were purified using Chromafix C18 columns (Macherey–Nagel, Du¨ren, Germany), collected, and concentrated to dryness, before they were re-dissolved in 20% (v/v) methanol, sonicated, and filtrated through 0.22 lm syringe filters. Analyses were carried out on a UPCL-MS/MS system consisting of a Thermo ACCELA UPLC (Thermo Scientific, Waltham, Massachusetts, USA) coupled to a Thermo TSQ Quantum Access Max Mass Spectrometer (Thermo Scientific, Waltham, Massachusetts, USA) with a heated electrospray ionization (HESI) interface. Samples were injected onto a Thermo Hypersil Gold column (1.9 lm, 50 9 2.1 mm, see above) and eluted at a flow rate of 250 ll min-1 with a linear gradient from 5 to

123


100% B in 8 min (mobile phase A: water/methanol/acetic acid (89.5/10/0.5, v/v/v) and mobile phase B: methanol/ acetic acid (99.5/0.5, v/v)). The mass spectrometer was operated in the positive mode and the chromatograms were analysed using the Thermo XCalibur software version 2.1.0.

Results Mutant screen for enhanced red fluorescence and Pchlide accumulation A collection of 30,000 6-days-old etiolated T-DNA insertion mutants was screened under blue light for excessive red fluorescence. The screen resulted in isolation of four mutant lines designated red fluorescent in the dark (rfd) 1-4 (Fig. 1). The T-DNA-insertion sites were identified by adapter ligation PCR and flanking genomic regions were sequenced. Homozygosity of the T-DNA insertion sites coincided with the etiolated rfd phenotype in all four mutants. We phenotypically distinguished two types of etiolated mutants. While the first group (rfd1 and rfd2, see Fig. 1) maintained normal growth properties, the second group (rfd3, rfd4) displayed a photomorphogenic phenotype with short hypocotyls and opened cotyledons and phenotypically resembled the cop/det/fus mutant genotype (Hardtke and Deng 2000). In agreement with these observations genotyping of rfd3 and rfd4 identified T-DNA-insertion sites in the coding region of COP8 (At5g42970) and in close proximity to COP12 (At2g31160) coding for subunit 4 and a further component of the COP9 signalosome, respectively (Wei et al. 1994). The first group of mutants exhibited normal skotomorphogenic growth with a long hypocotyl, the typical apical hook and small and closed cotyledons. rfd2 was shown to possess a T-DNA insertion 87 bp upstream of the start codon of FLU (At3g14110) (Meskauskiene et al. 2001). The mild flu phenotype was characterized by the ability of rfd2 to grow in day-night cycles without necrotic lesions and growth arrest. However, when grown under etiolating conditions for 5 days, homozygous rfd2 did not survive subsequent illumination. Analysis of genomic DNA of rfd1 revealed a single T-DNA insertion 307 bp upstream of the coding region of the RIBA1 gene (At5g64300, Hedtke and Grimm 2009). RIBA1 encodes a dual-functional enzyme of riboflavin biosynthesis, which functions as GTP cyclohydrolase II (GCHII)/3,4-dihydroxy-2-butanone-4-phosphate-synthase (DBPS, Herz et al. 2000). GCHII catalyses the hydrolytic release of formate and pyrophosphate from GTP and forms the product 2,5-diamino-6-ribosylamino-4(3,4) pyrimidione-50 phosphate. The second catalytic function


81

Fig. 1 Fluorescence of etiolated mutants under blue light excitation. Four mutant lines designated rfd1–rfd4 were identified; homozygous individuals of the segregating F3 offspring are characterized by strongly enhanced fluorescence

Fig. 2 Metabolic pathway of riboflavin biosynthesis and flavocoenzymes. Starting from GTP and ribulose-5-phosphate, riboflavin and, subsequently, FMN and FAD are synthesized by GCHII: GTP cyclohydrolase II, DBPS: 3,4-dihydroxy-2-butanone 4-phosphate synthase, PD: 2,5-diamino-6-ribosylamino-4(3H)-pyrimidinone 50 -phosphate

deaminase; PR: 5-amino-6-ribosylamino-2,4(1H,3H)-pyrimidinedione 50-phosphate reductase; PPase: phosphatase; LS: 6,7-dimethyl8-ribityllumazine synthase; RFS riboflavin synthase, RFK riboflavin kinase, FADS FAD synthetase

synthesises 3,4-dihydroxy-2-butanone-4-phosphate from ribulose-5-phosphate (Fig. 2). Riboflavin, also designated vitamin B2, is synthesized in plants, yeast and bacteria in seven distinct enzymatic reactions and is the precursor of the vital prosthetic molecules flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD). Flavocoenzymes are essential cofactors for redox reactions, such as photosynthesis, light sensing, mitochondrial electron transport, fatty acid oxidation and DNA repair (Bacher et al. 2000). The red-fluorescing pigment from etiolated seedlings shows a blue light excitation maximum at 437 nm and an emission peak at 633 nm (Fig. 3a–c), agreeing with the spectrum of Pchlide. A minor 672 nm emission peak of pigment extracts indicates conversion of Pchlide to

chlorophyll(ide) which occurred during the selection for homozygous seedlings under blue light (Fig. 3b, c). The fluorescence emission of etiolated rfd1 was more than tenfold stronger than that from wild-type and heterozygous rfd1 seedlings (Fig. 3d). Initial characterization and complementation of rfd1 Red-fluorescing etiolated rfd1 was demonstrated to be homozygous for the T-DNA insertion in the RIBA1 promoter region using single seedling PCR (Hedtke and Grimm 2009). Among light-grown rfd1seedlings 24% white individuals were detected without a RIBA1 wild-type allele. When grown on sucrose-supplemented media in dim light (5 lM photons m-2 s-1), homozygous rfd1 formed

123

82 Fig. 3 Excitation (a) and emission (b, c) spectra of pigments extracted from etiolated Arabidopsis seedlings. a Excitation spectrum of rfd1 using 635 nm emission. b Fluorescence emission of rfd mutants upon excitation at 435 nm. c Emission spectrum of wild-type seedlings (Col-0). d Amounts of Pchlide per seedling, given as fluorescence intensity at 633 nm. Red fluorescing rfd1 mutants (rfd1 R) were analyzed as well as non-fluorescing seedlings (rfd1 NR) from the same heterozygous rfd1 population. Pchlide accumulation in homozygous rfd2 and wild-type cultivars Col-0 and C24 are given for comparison

Plant Mol Biol (2012) 78:77–93 6

6

(A)

(B)

rfd1 5

5

4

4

3

3

2

2

1

1

0

rfd1 rfd2 rfd3 rfd4

0 360

380 400

420 440

460 480

500

580 600 620 640 660 680 700 720

wavelength in nm

wavelength in nm 6

(C)

6

wild type 5

5

4

4

3

3

(D)

2

2

1 1

660

680

pale green cotyledons and true leaves (Fig. 5b), developed inflorescences and set flowers, but produced no viable seeds. Plants heterozygous for the rfd1 T-DNA insertion did not develop a visible phenotype neither in light nor under etiolating conditions. The screened mutant population harbours a T-DNA construct enabling the isolation of loss-of-function mutants resulting from insertion events as well as activation tagging due to the presence of a tetrameric enhancer at the right border sequence of pWA5. In rfd1, however, the excessive production of a 5.5 kb polycistronic transcript was observed which is initiated within the T-DNA sequence. Using 50 -RACE experiments the rfd1 specific transcript

123

700

720

C24

640

wavelength in nm

Col.

620

rfd2

600

rfd1 NR

580

rfd1 R

0

was demonstrated to silence transcript initiation at the downstream-situated native RIBA1 promoter in homozygous rfd1individuals (Hedtke and Grimm 2009). The RIBA1 coding region resides in the 30 region of the new 5.5 kb transcript identified in rfd1 and was predicted to be not translatable due to the presence of numerous upstream open reading frames (Hedtke and Grimm 2009). The description of rfd1 provided the first example for the regulation by transcriptional interference (Martens et al. 2004) in a plant species (Hedtke and Grimm 2009). The depletion of AtRIBA1 and the resulting lack of flavo-coenzymes in rfd1 were confirmed with two sets of experiments. Firstly, supplementing riboflavin, FAD and


83

(A)

+ 5µM Rib

+ 5µM FAD

+ 5µM FMN

+ 5µM Rib

+ 5µM FAD

+ 5µM FMN

(B)

(D)

(C)

+ 5µM Rib

+ ALA

+ ALA + 5µM Rib

Fig. 4 Complementation of the etiolated rfd1 phenotype by flavins. a: Left: Segregating population of rfd1 seedlings. Right Etiolated rfd1 seedlings supplied with 5 lM riboflavin (Rib), FAD and FMN, respectively. b Etiolated flu seedlings without (left) and with

supplementing flavin compounds. c Untreated wild-type seedlings (left) and upon addition 5 lM riboflavin (right). d Wild type fed with 5-aminolevulinic acid (ALA, left) and ALA plus riboflavin (right)

FMN abolished the Pchlide-accumulating phenotype in homozygous rfd1 seedlings in darkness (Fig. 4a). In contrast the red fluorescence observed in etiolated flu and ALA-fed wild-type seedlings was not compensated by addition of flavins (Fig. 4b, d). The fluorescent properties of wild-type seedlings were not affected by supply of 5 lM riboflavin (Fig. 4c). In addition, germination of homozygous rfd1 on flavin-containing media in dim light suppressed the bleached phenotype and the mutant greened indistinguishable from control seedlings (not shown). Secondly, heterozygous individuals of the mutant line rfd1 were transformed with Arabidopsis genomic DNA fragments encoding AtRIBA1 (plasmid 4-1) and control fragments (plasmids 11-6 and 10-2), respectively (Fig. 5d). Only fragment 4-1 complemented rfd1 yielding transgenic T2 individuals that were homozygous for the rfd1 T-DNA insertion upstream of RIBA1 (Fig. 5e), but did not display the rfd1 phenotype (Fig. 5c). Transmission electron microscopic images of plastids from etiolated and illuminated wild-type and rfd1 seedlings revealed morphological and structural changes resulting

from RIBA1 deficiency (Fig. 5f–i). Instead of wild-type prolamellar bodies (Fig. 5f) etiolated rfd1 plastids contain already extended primary thylakoid membranes indicating photomorphogenic alterations (Fig. 5g). In contrast, lightgrown rfd1 contains barely structured and less electrondense plastids, is unable to complete the formation of substantial thylakoid membranes and lacks grana stacks (Fig. 5i). Deregulation of AtRIBA1 and consequences for the synthesis of flavins AtRIBA1 is a member of a small gene family consisting of three homologous genes At5g64300, At2g22450 (RIBA2) and At5g59750 (RIBA3). The sequence similarity of RIBA1 to the other two proteins is 68.5% (RIBA2) and 67.1% (RIBA3), respectively. Transcript analysis of all three RIBA genes in etiolated wild-type and rfd1 seedlings revealed a strongly over-accumulated RIBA1 transcript in rfd1 (Fig. 6a). This RNA was previously shown to be part of a 50 -prolonged 5.5 kb RNA that originates within the

123

84


(B)

(A)

(C)

(E)

(D)

1 2 3 4 5 6 RibA1 T-DNA 4-1 At5g54290

(F)

(G)

(H)

(I)

Fig. 5 Complementation by AtRIBA1 and ultrastructure. a–c: Phenotype of 21-day-old light-grown wild type (a) and homozygous rfd1 (b). Transformation of rfd1 with genomic DNA fragment 4-1 rescues the homozygous rfd1 phenotype (c). Plants were grown on sucrosesupplemented MS medium; scale bars represent 2 mm. d Scheme depicting the genomic fragments (grey) used for genetic complementation of rfd1. Coding regions are indicated in orange. e PCR analysis of T2 individuals from rfd1 mutants transformed with plasmid 4-1. The primer pairs used enabled the specific detection of the endogenous wild-type allele of RibA1 (RibA1), the rfd1-specific

123

AtRibA1

T-DNA insertion upstream of RibA1 (T-DNA) and the presence of the complementing plasmid 4-1 (4-1). All analysed individuals greened indistinguishable from wild-type plants. Selected samples in lanes 1–6 demonstrate the occurrence of plants heterozygous (lanes 1, 2) or wild-type (lane 3) as well as homozygous (lanes 4–6) for the rfd1 T-DNA insertion. f–i Plastid ultrastructure of wild type (f, h) and rfd1 (g, i). Seedlings were grown either in the dark for 5d (f, g) or on sucrose-supplemented medium in the light for 3 weeks (h, i). Scale bars = 500 nm


85 Wt

per cent of Wt expression

(A)

rfd1

600

400

200

0

RIBA1

RIBA2

(B)

RIBA3

SAND

(C)

relative fluorescence

Wt

rfd1

fmole / mg f.w.

200

100

0 3

4

5

6

7

FAD

time (min.)

(D)

15 16 18 19 20 Wt

FMN

riboflavin

total flavins

(E) Wt

OE 16

OE 19

fmole / mg f.w.

400

200

0 FAD

FMN

riboflavin

total flavins

Fig. 6 Expression of RIBA genes and accumulation of flavins. a Semiquantitative RT-PCR analysis of the Arabidopsis RIBA gene family in etiolated wild-type and rfd1 seedlings. Products were quantified following 32 (RIBA1, RIBA2, SAND) and 34 PCR cycles (RIBA3), respectively. The transcription factor SAND (Czechowski et al. 2004) is included as reference. b Representative elution profiles of HPLC analyses of flavin standards, wild type (WT) and mutant (rfd1) extracts. c Quantification of flavin compounds in rfd1. Wild-type and white rfd1 seedlings were grown on sucrose-supplemented agar at 50 lmol photons

m-2 s-1. Plantlets were harvested after 2 weeks (wild type) and 3 weeks (rfd1) to compensate for the delayed growth of the mutant. The sum of the individually detected flavins is given as total flavins. d RNA blot of transgenic lines (nrs. 15–20) overexpressing AtRIBA1 under control of an inducible promoter. Filters were hybridized with a RIBA1 cDNA fragment (upper panel). Six-week-old plants were induced for 2d; loading was visualized using ethidium bromide (lower panel). Migration of rRNAs is indicated by arrowheads. e Flavin content of leaves of AtRIBA1-overexpressing lines 16 and 19 after 5d ethanol induction

inserted T-DNA region (Hedtke and Grimm 2009). Transcripts of RIBA2 and RIBA3 are equally expressed in rfd1 and wild type. Thus, the altered RIBA1 expression causing a loss of translatable RIBA1 mRNA is not compensated by changes in RIBA2 and RIBA3 transcript levels (Fig. 6a). The impact of rfd1 on riboflavin biosynthesis was analysed by quantification of riboflavin, FMN and FAD in

3-weeks-old dim light-exposed rfd1 plantlets grown on sugar containing media. Limited availability of etiolated homozygous rfd1 precluded quantification of flavins at the cotyledon stage (Fig. 1). Light-exposed rfd1 contains 38% of wild-type total flavin content. FAD and FMN content was reduced by 65 and 63%, respectively (Fig. 6c). Sixweek-old ethanol-inducible RIBA1 overexpressors of

123

86


Arabidopsis thaliana strongly accumulate RIBA1 mRNA upon induction (Fig. 6d). Although they contain more than 2.5-fold increased contents of riboflavin and its derivatives compared to wild type (total flavin in Fig. 6e), they do not display a visible phenotype. Due to multiple unfavourable phenotypes as result of reduced riboflavin biosynthesis in light-grown rfd1 (Figs. 5b, 6b) we considered illuminated rfd1 inappropriate to elucidate the impact of riboflavin synthesis on the regulation of the tetrapyrrole metabolism. Thus, our further analyses focussed on etiolated, 5-day-old rfd1 seedlings.

Transcriptome analysis of rfd1 versus wild-type seedlings To comprehend the influence of riboflavin biosynthesis on the control of ALA synthesis microarray analyses on Affymetrix GeneChipÒ compared the transcriptome of 5-dayold etiolated rfd1 and wild-type seedlings. Table 1 presents up-regulated genes of the rfd1transcriptome with an at least twofold increase in transcript abundance in comparison to the wild-type RNA profile using a probability value (P value) of 0.01 as an evaluation threshold. Only 18 genes were found to be up-regulated in rfd1. These minor changes point to a rather specific effect of RIBA1 deficiency in etiolated seedlings. Applying the same evaluation criteria 97 genes showed a significant reduction of their expression in etiolated rfd1 (Supplemental Table S1). Since the red fluorescent phenotype of etiolated rfd1 as result of accumulating Pchlide hints at a stimulated tetrapyrrole metabolism, we highlighted the transcript profile of Table 1 Differentially expressed genes accumulating more than twofold in etiolated rfd1 mutants compared to wildtype seedlings

All candidate genes show a logged expression coefficient (coef.) greater than 1 and a probability value (P value) smaller than 0.01. Gene numbers (AGI ID) and a short description based on TAIR annotation is given

123

genes involved in tetrapyrrole biosynthesis (Supplemental Table S2). The levels of transcripts encoding key enzymes of ALA synthesis and the Mg branch, like HEMA, FLU, CHLI1, CHLH and Gun4 were enhanced. In parallel, less abundant transcripts of tetrapyrrole biosynthesis genes encode PORA, PORB and ferrochelatase I in rfd1. Among these genes PORA is known to represent a group of genes associated with skotomorphogenesis. Accumulation of HEMA1 and CHLH transcripts was confirmed by semiquantitative RT-PCR using RNA samples harvested under identical conditions (Fig. 7b), while changes of FLU and GUN4 transcripts in rfd1 could not be corroborated. Among the up-regulated genes RIBA1 has the highest alteration relative to wild type (Table 1), which is due to the excessively produced 5.5 kb non-translatable transcript initiating upstream of RIBA1 in the T-DNA region (Hedtke and Grimm 2009). Apart from co-regulated genes encoding stress and regulatory proteins as well as proteins with unknown function we found ARR7 and ARR 16, which are involved in cytokinin signalling, and two ERF genes (Table 1). CGA1 encoding the cytokinin responsive GATA factor 1 (At4g26150; logged expression coefficient of 1.35, P value 0.11, Brenner et al. 2005) and ARR4 (At1g10470; coef. 0.81, P value 0.14) belong to the up-regulated genes, when less stringent criteria were applied. The ARR genes encode members of the A-type Arabidopsis response regulator (ARR) family. Transcript abundance of ARR7 and ARR16 increases rapidly in response to cytokinin (D’Agostino et al. 2000; Rashotte et al. 2003). ARR7 acts as transcriptional repressor for cytokinin-responsive genes and controls cytokinin signalling with functional specificity (Lee et al. 2007).

Coef.

P value

AGI ID

Description

3.15

0.000

At5g64300

RIBA1

2.18

0.001

At5g51190

ERF/AP2 transcription factor

1.82

0.000

At4g27280

Calcium-binding EF hand family protein

1.72

0.001

At1g19050

ARR7

1.62

0.004

At2g19310

Unknown protein

1.56

0.003

At3g61190

BAP1

1.40

0.002

At5g51440

Mitochondrial small heat shock protein

1.39 1.37

0.001 0.005

At3g44260 At4g27657

CCR4-NOT transcription complex protein, putative Unknown protein

1.33

0.000

At2g40670

ARR16

1.26

0.005

At1g73540

Atnudt21

1.20

0.002

At4g09350

DNAJ heat shock domain-containing protein

1.18

0.003

At5g37670

Small heat shock protein-like (HSP15.7-CI)

1.15

0.007

At4g17490

ATERF6

1.03

0.001

At1g64490

Unknown protein

1.03

0.003

At4g26520

Fructose-bisphosphate aldolase, cytoplasmic

1.02

0.001

At5g22390

Unknown protein


(A)

87

Phytohormone dependent genes

400

(B)

Tetrapyrrole biosynthetic genes

250

rfd1 Wt

300

rfd1

200

Wt

150 200 100 100

50 0

0 ERF

(C)

ARR7

TUA

GH3

HEMA1

ChlH

FLU

GUN4

Transcripts in auxin mutants

400

300

Col axr2 shy2

200

100

0 LHCA4

HEMA1

CHLH

Fig. 7 RT-PCR quantification of transcripts. a ERF, ARR7 and GH3 were selected for semiquantitative RT-PCR quantification of phytohormone-dependent genes. Constitutively expressed alpha tubulin (At5g19780, TUA) is included as reference. Amplifications were performed over 33 (ERF), 35 (ARR7), 30 (TUA) and 37 (GH3) cycles and quantified as described. b Tetrapyrrole biosynthesis genes (Table

S2) were re-tested by semiquantitative RT-PCR for accumulation of transcripts. PCR reactions were performed for 30 (HEMA1) and 33 (CHLH; FLU, GUN4) cycles. c Real-time-PCR quantification of selected transcripts in axr2-1 and shy2-101. Expression is given in per cent relative to wild type to facilitate comparison of different transcript levels

With a high score among the up-regulated genes in rfd1 the two ERF genes, AtERF#105(At5g51190) and AtERF#103 (At4g17490), show also co-regulation and encode members of the ERF (ethylene response factor) subfamily J Group IX of the ERF/AP2 transcription factor family (Nakano et al. 2006). Cytokinin signalling was reported to activate transcription of AtERF genes. The encoded ERF/AP2 proteins are proposed to mediate the balance of cytokinin-induced transcriptional response (Rashotte et al. 2003, 2006). Interestingly, among the genes up-regulated in rfd1 (coef. [ 1) 13 plastid-encoded genes were found (Supplemental Table S3), but none of the 72 plastid-encoded genes on the Affymetrix ATH1 array was downregulated. This is consistent with a positive effect of cytokinin-feeding on plastid gene expression in barley (Zubo et al. 2008). Mitochondrial gene expression, in contrast, was hardly affected in rfd1. None of the comprised 40 mitochondrial genes was up-regulated using the criteria of Table 1 (P [ 0.01, coef. [ 1). Among the down-regulated genes in rfd1 in the dark (Supplemental Table S1) we found 17 genes encoding late embryogenesis abundant proteins (LEA) and one gene

member (GH3-19, At1g48660) of the auxin-responsive GH3 family. It was suggested that LEA genes and ABAresponsive genes are commonly down-regulated in response to stimulated cytokinin signalling, which acts antagonistically on ABA, osmotic and salt stress (Tran et al. 2010). The GH3 gene family encodes polypeptides involved in the adenylation of IAA (Staswick et al. 2005). Microarray results for selected candidate genes were corroborated with transcript analysis for ERF#105, ARR7 and GH3-19 by semiquantitative RT-PCR (Fig. 7a).

Elevated impact of cytokinin signalling in rfd1 The reported transcript analyses hinted at a riboflavindependent modulation of cytokinin metabolism or signalling. To support the hypothesis that Pchlide accumulation in etiolated rfd1 is causally associated with altered cytokinin effects, we examined whether cytokinin supplied to etiolated wild-type seedlings simulates the changes in tetrapyrrole metabolism observed in rfd1. After a 5-daysgrowth in darkness Pchlide levels were increased up to 2.6fold compared to untreated seedlings (Fig. 8a).

123

80

633nm emission/ seedling

(A)

60 40 20 0 0µM

0.1µM

10µM

120 90 60 30 0 WT

CKX mutant

(C)

Levels of active cytokinin are controlled by biosynthesis, transport, conjugation to carbohydrates, deposit in vacuoles and oxidative degradation (Ferreira and Kieber 2005). The FAD-dependent cytokinin oxidase/dehydrogenase (CKX) catalyses oxidative breakdown of cytokinin (Hare and van Staden 1994) and is encoded in Arabidopsis by a family of 8 CKX genes (Schmu¨lling et al. 2003). The functions of cytokinin in the root and shoot tissue are ensured by a balanced and tissue-specific metabolism of cytokinin synthesis and degradation as demonstrated in individual CKX-overexpressing plants (Werner et al. 2003). For an endogenous modification of the cytokinin content, we used a quadruple ckx mutant and assayed the Pchlide content in dark-grown 6-day-old seedlings. The Pchlide content of the quadruple ckx mutant was 2.1-fold higher than in etiolated wild-type seedlings (Fig. 8b). Involvement of endogenous cytokinin signalling was further confirmed with etiolated ahk2-2/ahk3-2 double mutant (Higuchi et al. 2004). Its Pchlide content was reduced to less than half of the wild-type content (Fig. 8d). These findings support a riboflavin-dependent modulation of cytokinin metabolism or signalling to cause the observed changes in tetrapyrrole accumulation in rfd1. We assayed cytokinin-inducible gene expression in rfd1 by introducing ARR6::GUS constructs. When light-grown F2 progenies homozygous for rfd1 were assayed for GUS activity, the expression of ARR6::GUS was increased in comparison to seedlings not showing the rfd1-specific

123

3µM

(D) 2.5 pmole Pchlide/ seedling

Fig. 8 Cytokinin and auxin contribute to enhanced Pchlide accumulation in dark-grown seedlings. a Supply of cytokinin (kinetin) to etiolated wild-type seedlings and b inactivation of cytokinin breakdown in a quadruple ckx mutant resulted in enhanced Pchlide levels in Arabidopsis seedlings. c rfd1 displays a short root phenotype. In 2-week-old light-grown seedlings a pronounced inhibition of root elongation and root hair development is visible (upper seedling). d Pchlide accumulation was determined in axr2-1, shy2-101 and slr-1. As a control ahk2-2/ahk3-3


633nm emission/ seedling

88

2.0 1.5 1.0 0.5 0.0

WT

axr2

shy2

slr ahk2/ahk3

phenotype (Fig. 9a). The same effect could be demonstrated for etiolated rfd1 mutants containing the ARR6::GUS reporter (Fig. 9b). Control experiments using the parental line ARR6::GUS confirmed the cytokinin dependency of GUS expression in light (Fig. 9c). Finally, quantification of cytokinins in etiolated rfd1 revealed increased contents of active cytokinins, including trans- as well as cis-zeatin compared to heterozygous rfd1 or wild type (Fig. 10a–c). In contrast, the inactive storage forms zeatin-O-glucoside and zeatin-O-glucoside riboside were not significantly altered in etiolated rfd1 individuals (Fig. 10d). Since the inactive derivatives display the most abundant forms of the hormone, the total amount of cytokinin does not reflect an increase of active cytokinins observed in rfd1. Interestingly, the amounts of cis-zeatin parallel the ratios observed for active cytokinins, supporting recent results of My´tinova´ et al. (2010) and on drought and salt stress tolerance (Albacete and Roitsch, unpublished) that suggest a physiological role also for cis-zeatin. Both lines of evidence, the enhanced expression of the ARR6:: GUS promoter-reporter construct in the rfd 1 background and the increased content of active cytokinin in rfd1, agree with the correlation of riboflavin depletion and cytokinin. Auxin effects on Pchlide accumulation Besides the fluorescence of accumulating Pchlide in etiolated rfd1, very short roots characterized light-exposed


89

(B) pmol MU/min/mg protein

pmol MU/min/mg protein

1,000 800 600 400 200

(C)

250

12

pmol MU/min/µg protein

(A)

200 150 100 50 0

0

white

red

green

Fig. 9 GUS activity in the F2 progeny of crosses of a line expressing ARR6::GUS with rfd1. a 10d-old light-grown F2 seedlings were divided according to their rfd1-genotype into white (i.e. homozygous) and green individuals. b 6d-old etiolated F2 seedlings were divided into red fluorescent (i.e. homozygous for rfd1) and not fluorescent Fig. 10 Cytokinin contents of etiolated rfd1seedlings. Darkgrown rfd1 offspring was subdivided following fluorescence evaluation into red (i.e. homozygous) and not red individuals. Cytokinin (CK) contents of both harvests were analyzed in comparison with wild type (Wt) Trans-zeatin (a), zeatin riboside, dihydro-zeatin and isopentenyl adenine are added up as active cytokinins (b). cis-zeatin is enriched in red fluorescent rfd1 seedlings (c), while the storage forms zeatinO-glucoside and zeatin-Oglucoside riboside (added up in d) did not significantly increase

(A)

10 8 6 4 2 0

0

not red

1 µM Kinetin

10

seedlings. c To demonstrate cytokinin dependent GUS activity, the parental reporter line was exposed to different amounts of kinetin in the light. GUS activity was determined fluorimetrically and is expressed as methylumbelliferone (MU) formed per time and total soluble protein of the extract

(B)

trans-zeatin

active CKs

0.8 0.4 0.6

0.3

0.4

0.2

0.2

0.1

0.0

red

not red

Wt.

cis-zeatin

(C)

0.0

(D)

red

not red

Wt.

CK storage forms

25.0 0.4 20.0 0.3 15.0 0.2 10.0 0.1

0.0

5.0

red

not red

mutant seedlings (Fig. 8c). This is consistent with inhibitory effects of cytokinin on root growth by reduced size of root apical meristem (Kuderova et al. 2008; Medford et al. 1989). To test a possible impairment of the balanced action of cytokinin and auxin, we assayed Pchlide contents in etiolated shy2-101 (iaa3), axr2-1 (iaa7) and slr-1 (iaa14) in comparison to wild type and ahk2-2/ahk3-3 (Fig. 8d).

Wt.

0.0

red

not red

Wt.

The nuclear Aux/IAA factors control auxin-responsive transcription, thereby regulating many growth and developmental processes. The Arabidopsis genome encodes 29 Aux/IAA family members (Hagen and Guilfoyle 2002). shy2-101 was originally isolated as dominant photomorphogenic mutant (Fukaki et al., unpublished), which suppresses the hy2 mutation (Kim et al. 1996). shy2-101

123

90

showed more than two-fold accumulation of Pchlide in comparison to wild type, while the Pchlide content of axr21 and slr-1 was moderately enhanced. The increased Pchlide accumulation in the auxin mutants coincides with an up-regulation of tetrapyrrole biosynthetic genes. HEMA1 and CHLH transcript levels increase in etiolated seedlings axr2-1 and shy2-101 (Fig. 7c). Consistent with enhanced Pchlide accumulation, shy2-101 showed more pronounced up-regulation of these genes than axr2-1.

Discussion Depletion of riboflavin biosynthesis in rfd1 modulates tetrapyrrole biosynthesis in etiolated seedlings The red fluorescence phenotype of dark-grown rfd1 seedlings (Fig. 1) is caused by enhanced Pchlide accumulation (Fig. 3). After transfer from dark to light, rfd1 was irreversibly damaged due to photosensitization and generation of excess amounts of reactive oxygen species. Exploring various growth conditions, it was demonstrated that rfd1 survives in dim light and on sugar, but was not able to form viable seeds. Thus, we failed to propagate homozygous rfd1 seedlings. In rfd1, the T-DNA insertion in the RIBA1 promoter region inhibited synthesis of the encoded GTP cyclohydrolase II/3,4-dihydroxy-2-butanone-4-phosphate synthase. As result rfd1 contained reduced amounts of riboflavin, FMN and FAD (Fig. 6b). Two independent complementation experiments evidenced that impaired RIBA1 expression and, consequently, impaired riboflavin biosynthesis correlate with Pchlide accumulation in etiolated seedlings and bleaching leaves of light-grown plantlets. Firstly, the red fluorescence phenotype was complemented by supply of riboflavin, FAD and FMN in etiolated rfd1 (Fig. 4a). Secondly, dark-grown rfd1 was complemented by expression of additional AtRIBA1 copies resulting in Pchlide accumulation and greening in the light that was indistinguishable from wild type (Fig. 5c). It is concluded that lack of RIBA1 and impairment of riboflavin biosynthesis causally correlate with de-repressed ALA formation in etiolated seedlings. Although the two other members of the RIBA gene family are expressed in etiolated seedlings (RIBA2 and RIBA3, Fig. 6a), they did not compensate the RIBA1 deficiency in rfd1. Riboflavin biosynthesis is proposed to be located in plastids (Fischer et al. 2004) and mass spectrometry analysis identified all three RIBA isoforms in these organelles (Sun et al. 2009). At present, it remains to be clarified why the other two isoforms are not able to substitute a loss of RIBA1 function. While plant RIBA genes are in general predicted to encode dual-function enzymes, sequence alignments reveal that Arabidopsis RIBA2 and RIBA3 lack amino acid

123


residues important for the enzymatic activities of GCHII and DHBPS, respectively (see for further explanations Supplemental Figure S1). Although enzymatic activities of these two isoenzymes have not been demonstrated, yet, it is proposed that compensation of a ribA1 knock-out would require at least the synchronous expression of RIBA2 and RIBA3. Substantial information about the entire biosynthetic pathway of riboflavin and the flavin nucleotides is available only from bacteria and yeast (Fig. 2). Recent studies have gained insights into the plant specific pathway and first genes have been identified (Fischer et al. 2004, 2005; Giancaspero et al. 2009; Herz et al. 2000; Jordan et al. 1999; Sandoval and Roje 2005; Sandoval et al. 2008). Future work will elucidate the tissue-specific and developmental expression of riboflavin biosynthesis genes and the potential division of labour between isoforms in this metabolic pathway. Impaired riboflavin biosynthesis coincides with increased content of active cytokinin leading to stimulation of tetrapyrrole biosynthesis in darkness Our studies revealed that a defect in riboflavin biosynthesis correlates with increased contents of active cytokinins (Fig. 10). A cytokinin-inducible promoter shows a stronger expression in etiolated and light-exposed rfd1 compared to control (Fig. 9). A comparison of rfd1 and wild-type transcriptomes yields the cytokinin-inducible ARR7 among the up-regulated genes (Table 1) hinting at a stimulatory cytokinin action in etiolated rfd1. A cytokinin-mediated phenotype is supported by the ultrastructural changes in rfd1 plastids, elevated transcription of plastome-encoded genes and the restriction in root development (Fig. 8c, Supplemental Table S3). Impaired riboflavin synthesis and elevated cytokinin content result in enhanced Pchlide accumulation in etiolated rfd1 (Fig. 3), which is consistent with elevated Pchlide levels upon feeding of cytokinin to etiolated seedlings (Fig. 8a) and compromised cytokinin degradation of the quadruple ckx mutant (Fig. 8b). In contrast, ahk2/ahk3 mutants with impaired cytokinin signalling show a reduced Pchlide level in comparison to wild-type seedlings (Fig. 8d). These findings are consistent with an observed photomorphogenic phenotype upon supply of cytokinin (Chory et al. 1994; Rashotte et al. 2003). The proposed cytokinin-stimulated impact on tetrapyrrole biosynthesis in etiolated rfd1 resembles previously reported effects: Cytokinin-induced increase of aminoacyl-tRNA synthesis in cucumber and enhanced HEMA expression in barley contribute to elevated ALA synthesis (Bougri and Grimm 1996; Masuda et al. 1994; Yaronskaya et al. 2006). Thus, transcriptional activation of key genes involved in tetrapyrrole biosynthesis (Supplemental Table S2, Fig. 7b) results in de-repressed ALA synthesis and enhanced


continuous flow of metabolites up to the light-dependent Pchlide reduction in etiolated seedlings. Pchlide overaccumulation in the photomorphogenic cop1 and det1 mutants correlates with an increased HEMA1 transcript abundance (McCormac and Terry 2002). Also HEMA1 overexpression results in enhanced Pchlide accumulation in prolonged dark periods (Schmied et al. 2011). Thus, overaccumulation of Pchlide in dark-grown seedlings of our newly identified four mutants rfd1–rfd4 is explained by either increased GluTR expression (caused by elevated cytokinin content in rfd1, deficient signalosomes and protein degradation in photomorphogenic rfd3 and rfd4 or HEMA1-overexpression) or lack of the negative regulator FLU (flu, rfd2). Deregulation of chlorophyll biosynthesis in cop1 and pif3 mutants is compensated by overexpression of EIN3/EIL1, a transcription factor involved in ethylene signalling that enables greening of etiolated mutant seedlings (Zhong et al. 2009). The global transcriptome analysis revealed also downregulation of GH3 in etiolated rfd1 (Supplemental Table S1) suggesting a reduced auxin signalling. The antagonistic interplay of auxin and cytokinin is realized by regulating synthesis and break-down of both phytohormones. Known auxin signalling mutants, which were previously described as mutants with altered root morphologies, showed an increase of Pchlide accumulation in etiolated seedlings (Fig. 8d). The modulated Pchlide content of the auxin and cytokinin mutants (Fig. 8b/d) could be explained with imbalanced action of the two antagonistic hormones due to impaired flavin-dependent enzymatic steps of the hormone metabolisms. Taking into account that impaired riboflavin biosynthesis in rfd1 misregulates the balance of cytokinin versus auxin we propose the following mechanism which leads to Pchlide accumulation: RIBA1 inactivation compromises riboflavin biosynthesis. The deficiency of flavin derivatives impairs cytokinin oxidase, a FAD-dependent enzyme (Hare and van Staden 1994) and compromises cytokinin degradation. As consequence elevated active cytokinin levels stimulate slightly transcription of tetrapyrrole biosynthesis genes. We do not exclude a reduction of auxin biosynthesis. One of the tryptophan-dependent pathways for auxin synthesis includes the flavin-dependent YUC monooxygenase, which catalyzes the hydroxylation of tryptamine (Zhao 2008). Therefore, diminished content of flavins in certain tissues of rfd1 could locally modulate endogenous levels of both phytohormones by restriction of CKX and, possibly, flavin monooxygenase activity. Both effects lead to enhanced cytokinin–to-auxin ratios. It is the future aim to identify those transcriptional regulators involved in cytokinin and auxin signalling, which control a limited number of tetrapyrrole biosynthesis genes to avoid accumulation of Pchlide and balance ALA biosynthesis in etiolated seedlings.

91

The substantial role of balanced hormone metabolism and antagonistic interaction of cytokinin and auxin signalling adds an additional layer of regulatory complexity to plant tetrapyrrole biosynthesis. Thus, the levels of the two antagonistically acting phytohormones normally contribute to the control of tetrapyrrole biosynthesis and dark repression of ALA synthesis in etiolated seedlings. This fine-tuned control of tetrapyrrole biosynthesis is in line with previous reports on deregulated Pchlide accumulation in etiolated seedlings and photodynamic damage after transition from dark to light (Barnes et al. 1996; Cheminant et al. 2011; McCormac and Terry 2002; Sperling et al. 1997; Stephenson et al. 2009; Zhong et al. 2009). As shown previously, at least two transcription factors, PIF1 and EIN3/EIL1, work cooperatively to balance chlorophyll biosynthesis to prevent Pchlide accumulation and photooxidation upon light exposure. Additional levels of control were described for light-induced expression by the negative regulator PIF and combined action of the COP9 signalosome for the posttranslational control. Thus, redundant regulatory circuits enable fine-tuned responses to different sources of information derived from environmental or endogenous stimuli. It is tempting to identify the target genes and proteins for these balanced metabolic activities in the crucial developmental stage of de-etiolation. Future work will further improve understanding of the mutually dependent transcriptional and posttranslational regulatory mechanisms which involve antagonistic and synergistic actions of phytohormones and photoreceptors for chlorophyll biosynthesis. Acknowledgments This work was supported by grants from the Collaborative Research Unit SFB 429 to BG. We are grateful to Thomas Altmann, Leibniz-Institute of Plant Genetics and Crop Plant Research, Gatersleben, for providing the T-DNA-mutagenized seed collection. We are thankful to Hidehiro Fukaki, Kobe University, Kobe, Thomas Schmu¨lling, Free University, Berlin, and Klaus Apel, Rutgers University, Ithaca, for the shy2-101 mutant, the quadruple ckx mutant and the flu mutant, respectively. We thank Markus Fischer, Institute of Food Chemistry, University Hamburg, for fruitful discussion on riboflavin biosynthesis.

References Alawady A, Grimm B (2005) Tobacco Mg protoporphyrin IX Methyltransferase is involved in inverse activation of Mg porphyrin and protoheme synthesis. Plant J 41:282–290 Albacete A, Ghanem ME, Martinez-Andujar C, Acosta M, SanchezBravo J, Martinez V, Lutts E, Dodd IC, Perez-Alfocea F (2008) Hormonal changes in relation to biomass partitioning and shoot growth impairment in salinized tomato (Solanum lycopersicum L.) plants. J Exp Bot 59:4119–4131 Bacher A, Eberhardt S, Fischer M, Kis K, Richter G (2000) Biosynthesis of vitamin b2 (riboflavin). Annu Rev Nutr 20: 153–167

123

92 Barnes SA, Quaggio RB, Whitelam GC, Chua NH (1996) fhy1 defines a branch point in phytochrome A signal transduction pathways for gene expression. Plant J 10:1155–1161 Beck C, Grimm B (2006) Involvement of tetrapyrroles in cellular regulation. In: Grimm B, Porra R, Ru¨diger W, Scheer H (eds) Chlorophylls and bacteriochlorophylls: biochemistry, biophysics, functions and applications. Advances in photosynthesis and respiration, vol 25. Springer, Dordrech, pp 223–235 Bougri O, Grimm B (1996) Members of a low-copy number gene family encoding glutamyl-tRNA reductase are differentially expressed in barley. Plant J 9:867–878 Brenner WG, Romanov GA, Ko¨llmer I, Bu¨rkle L, Schmu¨lling T (2005) Immediate-early and delayed cytokinin response genes of Arabidopsis thaliana identified by genome-wide expression profiling reveal novel cytokinin-sensitive processes and suggest cytokinin action through transcriptional cascades. Plant J 44:314–333 Cervera M (2005) Histochemical and fluorometric assays for uidA (GUS) gene detection. In: Pena L (ed) Methods in molecular biology, vol 286. Humana Press, Totowa, N.J., pp 203–213 Cheminant S, Wild M, Bouvier F, Pelletier S, Renou JP, Erhardt M, Hayes S, Terry MJ, Genschik P, Achard P (2011) DELLAs regulate chlorophyll and carotenoid biosynthesis to prevent photooxidative damage during seedling Deetiolation in arabidopsis. Plant Cell 23:1849–1860 Chory J, Reinecke D, Sim S, Washburn T, Brenner M (1994) A role for cytokinins in De-etiolation in arabidopsis (det Mutants Have an altered response to cytokinins). Plant Physiol 104:339–347 Coenen C, Lomax TL (1997) Auxin-cytokinin interactions in higher plants: old problems and new tools. Trends Plant Sci 2:351–356 Czechowski T, Bari RP, Stitt M, Scheible WR, Udvardi MK (2004) Real-time RT-PCR profiling of over 1400 Arabidopsis transcription factors: unprecedented sensitivity reveals novel rootand shoot-specific genes. Plant J 38:366–379 D’Agostino IB, Deruere J, Kieber JJ (2000) Characterization of the response of the Arabidopsis response regulator gene family to cytokinin. Plant Physiol 124:1706–1717 Davison PA, Schubert HL, Reid JD, Iorg CD, Heroux A, Hill CP, Hunter CN (2005) Structural and biochemical characterization of Gun4 suggests a mechanism for its role in chlorophyll biosynthesis. Biochemistry 44:7603–7612 Ferreira FJ, Kieber JJ (2005) Cytokinin signaling. Curr Opin Plant Bio 8:518–525 Fischer M, Romisch W, Saller S, Illarionov B, Richter G, Rohdich F, Eisenreich W, Bacher A (2004) Evolution of vitamin B2 biosynthesis: structural and functional similarity between pyrimidine deaminases of eubacterial and plant origin. J Biol Chem 279:36299–36308 Fischer M, Haase I, Feicht R, Schramek N, Ko¨hler P, Schieberle P, Bacher A (2005) Evolution of vitamin B2 biosynthesis: riboflavin synthase of Arabidopsis thaliana and its inhibition by riboflavin. Biol Chem 386:417–428 Fukaki H, Tameda S, Masuda H, Tasaka M (2002) Lateral root formation is blocked by a gain-of-function mutation in the SOLITARY-ROOT/IAA14 gene of Arabidopsis. Plant J 29:153–168 Giancaspero TA, Locato V, de Pinto MC, De Gara L, Barile M (2009) The occurrence of riboflavin kinase and FAD synthetase ensures FAD synthesis in tobacco mitochondria and maintenance of cellular redox status. FEBS J 276:219–231 Hagen G, Guilfoyle T (2002) Auxin-responsive gene expression: genes, promoters and regulatory factors. Plant Mol Biol 49:373–385 Hardtke CS, Deng XW (2000) The cell biology of the COP/DET/FUS proteins. Regulating proteolysis in photomorphogenesis and beyond? Plant Physiol 124:1548–1557

123

Plant Mol Biol (2012) 78:77–93 Hare PD, van Staden J (1994) Cytokinin oxidase–biochemical features and physiological significance. Physiol Plant 91:128–136 Hedtke B, Grimm B (2009) Silencing of a plant gene by transcriptional interference. Nucleic Acids Res 37:3739–3746 Hedtke B, Alawady A, Chen S, Bo¨rnke F, Grimm B (2007) Silencing of glutamyl-tRNA reductase by HEMA RNAi represses activity of Mg Chelatase and ferrochelatase in nicotiana tabacum. Plant Mol Biol 64:733–742 Herz S, Eberhardt S, Bacher A (2000) Biosynthesis of riboflavin in plants. The ribA gene of Arabidopsis thaliana specifies a bifunctional GTP cyclohydrolase II/3, 4-dihydroxy-2-butanone 4-phosphate synthase. Phytochemistry 53:723–731 Higuchi M, Pischke MS, Ma¨ho¨nen AP, Miyawaki K, Hashimoto Y, Seki M, Kobayashi M, Shinozaki K, Kato T, Tabata S, Helariutta Y, Sussman MR, Kakimoto T (2004) In planta functions of the Arabidopsis cytokinin receptor family. Proc Natl Acad Sci USA 101:8821–8826 Jordan DB, Bacot KO, Carlson TJ, Kessel M, Viitanen PV (1999) Plant riboflavin biosynthesis. Cloning, chloroplast localization, expression, purification, and partial characterization of spinach lumazine synthase. J Biol Chem 274:22114–22121 Kim BC, Soh MC, Kang BJ, Furuya M, Nam HG (1996) Two dominant photomorphogenic mutations of Arabidopsis thaliana identified as suppressor mutations of hy2. Plant J 9:441–456 Kuderova A, Urbankova I, Valkova M, Malbeck J, Brzobohaty B, Nemethova D, Hejatko J (2008) Effects of conditional IPTdependent cytokinin overproduction on root architecture of Arabidopsis seedlings. Plant Cell Physiol 49:570–582 Larkin RM, Alonso JM, Ecker JR, Chory J (2003) GUN4, a regulator of chlorophyll synthesis and intracellular signalling. Science 299:902–906 Lee DJ, Park JY, Ku SJ, Ha YM, Kim S, Kim MD, Oh MH, Kim J (2007) Genome-wide expression profiling of ARABIDOPSIS RESPONSE REGULATOR 7 (ARR7) overexpression in cytokinin response. Mol Genet Genomics 277:15–37 Martens JA, Laprade L, Winston F (2004) Intergenic transcription is required to repress the Saccharomyces cerevisiae SER3 gene. Nature 429:571–574 Masuda T, Fujita Y (2008) Regulation and evolution of chlorophyll metabolism. Photochem Photobiol Sci 7:1131–1149 Masuda T, Tanaka R, Shio Y, Takamiya K, Kannangara CG, Tsuji H (1994) Mechanism of benzyladenine-induced stimulation of the synthesis of 5-aminolevulinic acid in greening Cucumber cotyledons- Benzyladenine increases levels of plastids transfer RNA(Glu). Plant Cell Physiol 35:183–188 McCormac AC, Terry MJ (2002) Light-signalling pathways leading to the co-ordinated expression of HEMA1 and Lhcb during chloroplast development in Arabidopsis thaliana. Plant J 32:549–559 Medford JI, Horgan R, El-Sawi Z, Klee HJ (1989) Alterations of endogenous cytokinins in transgenic plants using a chimeric isopentenyl transferase gene. Plant Cell 1:403–413 Meskauskiene R, Nata M, Goslings D, Kessler F, op den Camp R, Apel K (2001) FLU: a negative regulator of chlorophyll biosynthesis in Arabidopsis thaliana. Proc Natl Acad Sci USA 98:12826–12831 Mochizuki N, Brusslan JA, Larkin R, Nagatani A, Chory J (2001) Arabidopsis genomes uncoupled 5 (GUN5) mutant reveals the involvement of Mg-chelatase H subunit in plastid-to-nucleus signal transduction. Proc Natl Acad Sci USA 98:2053–2058 Moubayidin L, Di Mambro R, Sabatini S (2009) Cytokinin-auxin crosstalk. Trends Plant Sci 14:557–562 Mu¨ller B, Sheen J (2008) Cytokinin and auxin interaction in root stem-cell specification during early embryogenesis. Nature 453:1094–1097

Plant Mol Biol (2012) 78:77–93 My´tinova´ Z, Motyka V, Haisel D, Gaudinova´ A, Lubovska´ Z, Wilhelmova´ N (2010) Effect of abiotic stresses on the activity of antioxidative enzymes and contents of phytohormones in wild type and AtCKX2 transgenic tobacco plants. Biologia Plantarum 58:461–470 Nagpal P, Walker LM, Young JC, Sonawala A, Timpte C, Estelle M, Reed JW (2000) AXR2 encodes a member of the Aux/IAA protein family. Plant Physiol 123:563–574 Nakano T, Suzuki K, Fujimura T, Shinshi H (2006) Genome-wide analysis of the ERF gene family in Arabidopsis and rice. Plant Physiol 140:411–432 Nott A, Jung HS, Koussevitzky S, Chory J (2006) Plastid-to-nucleus retrograde signalling. Annu Rev Plant Biol 57:739–759 Papenbrock J, Mock HP, Tanaka R, Kruse E, Grimm B (2000a) Role of Mg-chelatase activity for the early steps of the tetrapyrrole biosynthetic pathway. Plant Physiol 122:1161–1169 Papenbrock J, Pfu¨ndel E, Mock HP, Grimm B (2000b) Decreased and increased expression of the subunit CHL I diminishes Mgchelatase activity and rescues chlorophyll synthesis in transgenic plants. Plant J 22:155–164 Paul MJ, Pellny TK (2003) Carbon metabolite feedback regulation of leaf photosynthesis and development. J Exp Bot 54:539–547 Peter E, Grimm B (2009) GUN4 is required for posttranslational control of plant tetrapyrrole biosynthesis. Mol Plant 2:1198–1210 Rashotte AM, Carson SD, To JP, Kieber JJ (2003) Expression profiling of cytokinin action in Arabidopsis. Plant Physiol 132: 1998–2011 Rashotte AM, Chae HS, Maxwell BB, Kieber JJ (2005) The interaction of cytokinin with other signals Physiol Plant 123:184–194 Rashotte AM, Mason MG, Hutchison CE, Ferreira FJ, Schaller GE, Kieber JJ (2006) A subset of Arabidopsis AP2 transcription factors mediates cytokinin responses in concert with a twocomponent pathway. Proc Natl Acad Sci USA 103:11081–11085 Sandoval FJ, Roje S (2005) An FMN hydrolase is fused to a riboflavin kinase homolog in plants. J Biol Chem 280:38337–38345 Sandoval FJ, Zhang Y, Roje S (2008) Flavin nucleotide metabolism in plants: monofunctional enzymes synthesize fad in plastids. J Biol Chem 283:30890–30900 Schmied J, Hedtke B, Grimm B (2011) Overexpression of HEMA1 encoding glutamyl-tRNA reductase. J Plant Physiol 168:1372– 1379 Schmu¨lling T, Werner T, Riefler M, Krupkova´ E, Bartrina Y, Manns I (2003) Structure and function of cytokinin oxidase/dehydrogenase genes of maize, rice, Arabidopsis and other species. J Plant Res 116:241–252 Sperling U, van Cleve B, Frick G, Apel K, Armstrong GA (1997) Overexpression of light-dependent PORA or PORB in plants depleted of endogenous POR by far-red light enhances seedling survival in white light and protects against photooxidative damage. Plant J 12:649–658 Staswick PE, Serban B, Rowe M, Tiryaki I, Maldonado MT, Maldonado MC, Suza W (2005) Characterization of an Arabidopsis enzyme family that conjugates amino acids to indole-3acetic acid. Plant Cell 17:616–627 Stephenson PG, Fankhauser C, Terry MJ (2009) PIF3 is a repressor of chloroplast development. Proc Natl Acad Sci USA 106:7654– 7659

93 Sun Q, Zybailov B, Majeran W, Friso G, Olinares PD and van Wijk KJ (2009) PPDB, the Plant Proteomics Database at Cornell. Nucleic Acids Res 37 (Database issue) D969-74 Tanaka R, Tanaka A (2007) Tetrapyrrole biosynthesis in higher plants. Annu Rev Plant Biol 58:321–346 Tanaka M, Takei K, Kojima M, Sakakibara H, Mori H (2006) Auxin controls local cytokinin biosynthesis in the nodal stem in apical dominance. Plant J 45:1028–1036 Timpte C, Wilson AK, Estelle M (1994) The axr2–1 mutation of Arabidopsis thaliana is a gain-of-function mutation that disrupts an early step in auxin response. Genetics 138:1239–1249 To JPC, Haberer G, Ferreira FJ, Deruere J, Mason MG, Schaller GE, Alonso JM, Ecker JR, Kieber JJ (2004) Type-A arabidopsis response regulators are partially redundant negative regulators of cytokinin signaling. Plant Cell 16:658–671 Tognetti VB, Palatnik JF, Fillat MF, Melzer M, Hajirezaei MR, Valle EM, Carrillo N (2006) Functional replacement of ferredoxin by a cyanobacterial flavodoxin in tobacco confers broad-range stress tolerance. Plant Cell 18:2035–2050 Tran LS, Shinozaki K, Yamaguchi-Shinozaki K (2010) Role of cytokinin responsive two-component system in ABA and osmotic stress signalings. Plant Signal Behav 5:148–150 Vavilin DV, Vermaas WF (2002) Regulation of the tetrapyrrole biosynthetic pathway leading to heme and chlorophyll in plants and cyanobacteria. Physiol Plant 115:9–24 Wang H, Ma LG, Li JM, Zhao HY, Deng XW (2001) Direct interaction of Arabidopsis cryptochromes with COP1 in light control development. Science 294:154–158 Wei N, Deng XW (2003) The COP9 signalosome. Annu Rev Cell Dev Biol 19:261–286 Wei N, Kwok SF, von Arnim AG, Lee A, McNellis TW, Piekos B, Deng XW (1994) Arabidopsis COP8, COP10, and COP11 genes are involved in repression of photomorphogenic development in darkness. Plant Cell 6:629–643 Werner T, Schmu¨lling T (2009) Cytokinin action in plant development. Curr Opin Plant Biol 12:527–538 Werner T, Motyka V, Laucou V, Smets R, Van Onckelen H, Schmu¨lling T (2003) Cytokinin-deficient transgenic Arabidopsis plants show multiple developmental alterations indicating opposite functions of cytokinins in the regulation of shoot and root meristem activity. Plant Cell 15:2532–2550 Yaronskaya E, Vershilovskaya I, Poers Y, Alawady AE, Averina N, Grimm B (2006) Cytokinin effects on tetrapyrrole biosynthesis and photosynthetic activity in barley seedlings. Planta 224:700–709 Yi C, Deng XW (2005) COP1—from plant photomorphogenesis to mammalian tumorigenesis. Trends Cell Biol 15:618–625 Zhao Y (2008) The role of local biosynthesis of auxin and cytokinin in plant development. Curr Opin Plant Biol 11:16–22 Zhong S, Zhao M, Shi T, Shi H, An F, Zhao Q, Guo H (2009) EIN3/ EIL1 cooperate with PIF1 to prevent photo-oxidation and to promote greening of Arabidopsis seedlings. Proc Natl Acad Sci USA 106:21431–21436 Zubo YO, Yamburenko MV, Selivankina SY, Shakirova FM, Avalbaev AM, Kudryakova NV, Zubkova NK, Liere K, Kulaeva ON, Kusnetsov VV, Bo¨rner T (2008) Cytokinin stimulates chloroplast transcription in detached barley leaves. Plant Physiol 148:1082–1093

123