Deletions into the 5' Noncoding Sequence of the Genome - Europe PMC

JOURNAL OF VIROLOGY, Dec. 1989, p. 5354-5363 0022-538X/89/125354-10$02.00/0 Copyright C 1989, American Society for Microbiology

Vol. 63, No. 12

Construction of Less Neurovirulent Polioviruses by Introducing Deletions into the 5' Noncoding Sequence of the Genome NARUSHI IIZUKA,l MICHINORI KOHARA,2 KIMIKO HAGINO-YAMAGISHI,l SHINOBU ABE,2 TOSHIHIKO KOMATSU,3 KATSUHIKO TAGO,2 MINEO ARITA,3 AND AKIO NOMOTO1* Department of Microbiology, Tokyo Metropolitan Institute of Medical Science, Honkomagome, Bunkyo-ku, Tokyo 113, Japan Poliomyelitis Research Institute, Higashimurayama, Tokyo 189,2 and Department of Enteroviruses, National Institute of Health, Musashimurayama, Tokyo 190-2,3 Japan Received 11 May 1989/Accepted 7 August 1989

Viral attenuation may be due to lowered efficiency of certain steps essential for viral multiplication. For the construction of less neurovirulent strains of poliovirus in vitro, we introduced deletions into the 5' noncoding sequence (742 nucleotides long) of the genomes of the Mahoney and Sabin 1 strains of poliovirus type 1 by using infectious cDNA clones of the virus strains. Plaque sizes shown by deletion mutants were used as a marker for rate of viral proliferation. Deletion mutants of both the strains thus constructed lacked a genome region of nucleotide positions 564 to 726. The sizes of plaques displayed by these deletion mutants were smaller than those by the respective parental viruses, although a phenotype referring to reproductive capacity at different temperatures (rct) of viruses was not affected by introduction of the deletion. Monkey neurovirulence tests were performed on the deletion mutants. The results clearly indicated that the deletion mutants had much less neurovirulence than with the corresponding parent viruses. Production of infectious particles and virus-specific protein synthesis in cells infected with the deletion mutants started later than in those infected with the parental viruses. The rate at which cytopathic effect progressed was also slower in cells infected with the mutants. Phenotypic stability of the deletion mutant for small-plaque phenotype and temperature sensitivity was investigated after passaging the mutant at an elevated temperature of 37.5°C. Our data strongly suggested that the less neurovirulent phenotype introduced by the deletion is very stable during passaging of the virus.

Poliovirus, the causative agent of poliomyelitis, is a human enterovirus that belongs to the family Picornaviridae. The virus is a nonenveloped particle containing a singlestranded RNA genome of plus-strand polarity. The viral RNA has a single long open reading frame for the synthesis of a viral polyprotein. The polyprotein is cotranslationally cleaved by proteinases to form viral structural and nonstructural proteins. Studies on the sequences of RNA and of amino acids in viral polypeptides have provided a precise viral protein map (13). The studies have also revealed a fairly long untranslated region (742 nucleotides long for type 1 poliovirus) at the 5' terminus of the genome. Comparative sequence studies on the genomes of polioviruses of all three serotypes (36) revealed that the 5' noncoding region carried a more conserved nucleotide sequence compared with the sequence in the translated region, although it also carried a highly variable sequence (nucleotide positions 640 to 742) in the region next to the VP4-coding sequence. This long 5' noncoding sequence is thought to have essential roles in viral replication such as in virus-specific RNA synthesis, virusspecific protein synthesis, and packaging. However, structures with a function in any of these steps in viral replication have not yet been identified. By using infectious cDNA clones of poliovirus (15, 25, 28, 31), a number of in vitro mutants with mutations of the 5' noncoding sequence (17, 18, 29, 37) have been constructed and successfully used for molecular genetic studies on viral replication. Racaniello and Meriam (29) have isolated a virus carrying a single nucleotide deletion in a predicted hairpin structure in the 5' noncoding region. A number of viable mutants with deletion and insertion mutations in the 5' noncoding sequence were constructed in vitro by Kuge and *

Nomoto (18). Analysis of the replication process of the mutants and identification of the second-site mutations in the genomes of the variants that partially restored phenotypes of the parental viruses suggested that highly ordered structures formed in the 5' noncoding sequence are involved in the expression of the biological function of the genome region. Furthermore, Trono et al. (37) showed by a similar experimental approach that a fairly long nucleotide sequence in the 5' noncoding sequence is involved in allowing viral protein synthesis. It has also been demonstrated (26, 37) that the first 630 nucleotides of the 5' noncoding region of the poliovirus genome are sufficient for the cap-independent initiation of translation. Infectious cDNA clones of polioviruses have also been utilized to investigate the pathogenesis of poliovirus on a molecular level. Many recombinants between the virulent Mahoney and the attenuated Sabin strains of type 1 poliovirus were constructed by using infectious cDNA clones of the two strains (12, 14, 16, 24). Biological tests including monkey neurovirulence tests on these recombinants suggested that the 5' noncoding region harbors a relatively strong determinant(s) influencing the neurovirulence or attenuation phenotype, although determinants weakly influencing the phenotype were spread over several areas of the entire viral genome. As to a strong determinant(s) in the 5' noncoding region of the genome of type 1 poliovirus, Kawamura et al. (12) strongly suggested that the expression of the attenuation phenotype depends on the highly ordered structure formed in the 5' noncoding sequence and that the formation of such a structure is possibly influenced by the nucleotide at position 480. A single base change at position 472 in the 5'-untranslated region of type 3 poliovirus was also correlated with the attenuation phenotype of this strain (7). Considering potential functions encoded by the 5' noncoding

Corresponding author. 5354

VOL. 63, 1989

CONSTRUCTION OF LESS NEUROVIRULENT POLIOVIRUSES

region, these mutations may reduce the efficiency of certain viral replication step(s), leading to a low rate of viral multiplication in the central nervous system. Indeed, Svitkin et al. (34, 35) demonstrated by using a cell-free translation system that RNA of virulent poliovirus strains functions as mRNA more efficiently than RNA of attenuated strains. It is therefore possible to construct less neurovirulent polioviruses by a modification of the 5' noncoding sequence of the genome that causes a reduction in the efficiency of certain viral replication steps. Here we report the construction of deletion mutants of the Mahoney and Sabin strains of type 1 poliovirus that lack an RNA sequence in the 5' noncoding region. These mutants showed a less neurovirulent phenotype compared with the corresponding parental strains. Further characterization of these strains revealed that the deletion results in a lowered rate of viral protein synthesis. Our method may provide one of the general strategies for the introduction of a stable, less neurovirulent phenotype in picornaviruses. (Preliminary results were presented at the 1987 Nobel Symposium [22].) MATERIALS AND METHODS DNA procedure. Restriction endonucleases, exonuclease Bal 31, Escherichia coli DNA polymerase I (Klenow fragment), T4 DNA ligase, and Sall linker nucleotide (GGTCGACC) were purchased from Takara Shuzo Co. (Kyoto, Japan); calf intestinal alkaline phosphatase was from Boehringer GmbH (Mannheim, Federal Republic of Germany); avian myelobastosis virus reverse transcriptase and human placenta RNase inhibitor were from Seikagaku Kogyo Co. (Osaka, Japan). Labeled compounds were purchased from Amersham Corp. (Arlington Heights, Ill.). These enzymes and compounds were used according to the instructions of the manufacturers. The modified calcium phosphate method of DNA transfection was performed as described previously (15). RNA transfection was done by a DEAE-dextran method reported by van der Werf et al. (38). Construction of cDNA mutants with deletion sequences. Infectious cDNA clones of the virulent Mahoney and attenuated Sabin strains of type 1 poliovirus used in this study are plasmids pVM(1)pDS306(T) (12, 14, 24) and pVS(1)IC-0(T) (15), respectively; the vector plasmid, pSVA14, is a derivative of pSVA13 (15), and it contains the replication origin, a promoter, and a coding sequence for the large T antigen of simian virus 40 but not BanII cleavage sites. Three cDNA mutants, pVS(1)IC-DH(T), pVS(1)IC-DA23(T), and pVS(1) IC-DA21(T), were constructed from pVS(1)IC-0(T) and lack the corresponding genome regions of nucleotide positions 600 to 726, 570 to 726, and 564 to 726, respectively (18) (see Fig. 2). To construct pVM(1)IC-DA21 lacking the corresponding genome region of positions 564 to 726 of the virulent Mahoney genome, the cDNA segments of the corresponding nucleotide positions from 1 to 1813 of pVM(1)pDS306(T) and pVS(1)IC-DA21(T) were subcloned into vector plasmid pML2 and designated pEP(M) and pEP(Sab)DA21, respectively (Fig. 1) (12, 18). Using these subclones, a restriction enzyme HhaI DNA fragment from positions 521 to 776 of pEP(M) was replaced by the corresponding DNA fragment of pEP(Sab)DA21, and the resulting plasmid was designated pEP(M)DA21. Plasmid pVM(1)IC-DA21(T) was then constructed by replacement of the shorter AatII fragment of pVM(l)pDS306(T) by the shorter AatII fragment of pEP (M)DA21 (Fig. 1).

pVS(l) IC-DA21(T)

A

"

5355

pVM(l) pDS306(T)

A

EA pVM(1)IC-DA21(T) FIG. 1. Strategy for constructing a deletion cDNA clone of the Mahoney strain. A deletion cDNA clone, pVM(1)IC-DA21(T), was constructed by assembling segments of cDNA from the Mahoney (_) and Sabin 1 (Oii) strains. Sequences derived from plasmid vectors including pML2 and pSVA14 are indicated by lines. P, A, S, E, H, N, and B represent cleavage sites of the restriction enzymes PstI, AatII, SalI, EcoRI, HhaI, NcoI, and BanII, respectively. Ampr, Ampicillin resistance.

To make the deletion sequence in pVM(1)IC-DA21(T) longer, pEP(M)DA21 that had been linearized by digestion with SalI was treated with exonuclease Bal 31 and ligated with Sall linker nucleotides. After treatment with Sall, the DNAs were circularized with T4 DNA ligase. After determination of the nucleotide sequences of the deleted cDNAs, segments upstream of the Sail cleavage sites were isolated by digestion of these clones with EcoRI and Sall, and the DNA fragments were inserted into the adequate site of plasmid pEP(M)DA21 that had been digested with EcoRI and SalI. The shorter AatII fragments were exchanged between these subclones with deleted sequence and pVM(1)pDS306(T). As a result, pVM(1)A561(T), pVM(1) A559(T), and pVM(1)A558(T) lacking the corresponding nucleotides from positions 561 to 726, 559 to 726, and 558 to 726, respectively, were obtained (see Fig. 7). Construction of plasmids containing poliovirus cDNA under control of a promoter for T7 RNA polymerase. A cDNA fragment containing the proximal 1,125-nucleotide sequence of the Mahoney genome was prepared from pVM(l) pDS306(T) by digestion with EcoRI and SphI and subcloned

5356

IIZUKA ET AL.

into pUC19 that had been digested with EcoRI and SphI. This subclone was called pESp(M). Then an AluI-BamHI DNA fragment corresponding to nucleotide positions 10 to 220 was isolated and ligated with the synthetic DNA fragment containing the 410 promoter for T7 RNA polymerase, whose structure is as follows: 5'-AATTCTCGAGTAATACGACTCACTATAGGTTAAAACAG-3' 3'-GAGCTCATTATGCTGAGTGATATCCAATTTTGTC-3'

After treatment with EcoRI and BamHI, the ligated products were isolated by 5% polyacrylamide gel electrophoresis and inserted into the EcoRI-BamHI site of plasmid pUC19. The resulting plasmid was designated pEB(M)T7. The shorter EcoRI-KpnI DNA fragment of pESp(M) was replaced by the shorter EcoRI-KpnI fragment of pEB(M)T7. Thus, a subclone containing the 410 promoter for T7 RNA polymerase was constructed and designated pESp(M)T7. To construct plasmids containing the entire cDNA of the Mahoney genome under control of the promoter, the AatII fragmentexchange experiment was performed between pVM(1) pDS306 and pESp(M)T7. Similarly, the 410 promoter was inserted into a position just before other poliovirus cDNA sequences cloned into pSVA14. Plasmids containing the promoter sequence that were derived from pVS(1)IC-O(T), pVM(l)pDS306(T), pVM(1)IC-DA21(T), pVM(1)A561(T), pVM(1)A559(T), and pVM(1)A558(T) were designated pVST7 (1)0(T), pVMT7(1)DS(T), pVMT7(1)DA21(T), pVMT7(1) A561 (T), pVMT7(1)A559(T), and pVMT7(1)A558(T), respectively. In vitro transcription. T7 RNA polymerase was prepared from E. coli BL21 containing plasmid pAR1219 (3) kindly supplied by William Studier and John Dunn. Briefly, after induction of T7 RNA polymerase by treatment of BL21 (pAR1219) with isopropyl-,3-D-thiogalactopyranoside, the cell lysate was fractionated with Polymin P and ammonium sulfate and then purified by chromatography on S-Sepharose (Pharmacia, Uppsala, Sweden) and CM-Toyopearl 650M and DEAE-Toyopearl 650M (Seikagaku Kogyo Co.) columns. A complete description of this procedure was personally communicated by J. J. Dunn. In vitro transcription was performed by a method described by van der Werf et al. (38). Plasmid DNAs containing the 410 promoter for T7 RNA polymerase were linearized by cleavage with restriction enzyme ClaI and used as templates. Cells and viruses. African green monkey kidney (AGMK) cells, HEp2c monolayer cells, and HeLa S3 monolayer cells were maintained in Dulbecco modified Eagle medium supplemented with 5% newborn calf serum. AGMK cells were transfected with 10 ,ug of the closed circular forms of the recombinant cDNA clones per 60-mm plastic dish by the modified calcium phosphate method (15), and the viruses were recovered from the cells as described previously (12, 14, 15). In some cases, HeLa S3 cells were transfected with 1 to 5 ,ug of RNAs transcribed in vitro per 60-mm plastic dish by the DEAE-dextran method reported by van der Werf et al. (38). The transfected cells were incubated at 33.5°C. The viruses recovered from the cells transfected with plasmids pVS(1)IC-O(T), pVS(1)IC-DH(T), pVS(1)IC-DA23(T), pVS(1)IC-DA21(T), pVM(l)pDS306(T), and pVM(1)ICDA21(T) were designated PV1(Sab)IC-0, PV1(Sab)IC-DH, PV1(Sab)IC-DA23, PV1(Sab)IC-DA21, PV1(M)pDS306, and PV1(M)IC-DA21, respectively. Virus infection and growth. To prepare virus solutions for monkey neurovirulence tests and in vitro marker tests,

J. VIROL.

approximately 4 x 107 AGMK cells were infected with each recombinant virus stock at a multiplicity of infection of approximately 1 x 10' and incubated at 33.5°C for about 2 days until all the cells showed cytopathic effects (CPE). The virus stock solutions were prepared by freeze-thawing three times followed by low-speed centrifugation to remove cell debris and then used for the biological tests after the titers were measured. The titers of viruses were measured with AGMK cells (12). Monolayers of AGMK cells in 60-mm plastic dishes were infected with 0.5 ml of a virus solution (a dilution of a virus stock). After 3 to 4 days of incubation at 35.5°C under agar overlay, plaques were visualized by staining cells with crystal violet and virus titers were calculated on the basis of the numbers of plaques (12). To determine the extent of virus production in AGMK cells, approximately 5 x 106 cells in a 60-mm plastic dish were infected with viruses at 10 PFU per cell and incubated at 35.5°C as previously described (18). The infected cells were frozen at appropriate times, and the titers of viruses produced in the infected cells were measured as described above. For pulse-labeling experiments, AGMK, HeLa S3, or HEp2c monolayer cells (5 x 106 cells) were infected with viruses at about 30 PFU per cell and incubated at 35.5°C. The cells were labeled with 10 RCi of [35S]methionine in 1 ml of methionine-free medium for 1 h beginning at the indicated times after the infection. After the labeling period, cells were harvested with rubber policeman and washed twice in icecold phosphate-buffered saline. The cells were lysed, and the labeled products were analyzed by gel electrophoresis as described below. Biological characterization of viruses. To estimate the neurovirulence of viruses, two injection methods were employed, intrathalamic (intracerebral) and intraspinal injections. Each seronegative cynomolgus monkey received a total dose of 107 50% tissue culture infective doses of virus for intrathalamic injections and 106 50% tissue culture infective doses of virus for intraspinal injections (14). Monkeys were sacrificed 17 days after the inoculation, and the intensity of spread of histological lesions in the central nervous system was estimated by established procedures (6). All in vitro phenotypic marker tests were performed with primary cultured cynomolgus monkey kidney cells. The reproductive capacity at different temperatures (rct marker) of viruses was investigated by measuring the virus titers on cells at a sodium bicarbonate concentration of 0.225% and temperatures of 36, 39, 39.5, and 40°C on day 7 after inoculation as described previously (12, 14, 16, 24). To determine the sizes of plaques produced by the different viruses, cells were infected and cultured under agar overlays at a sodium bicarbonate concentration of 0.225% at 36°C. The diameters of approximately 100 plaques observed on day 5 postinfection were determined as described previously (12, 14, 16, 24). Delayed growth (d marker) of viruses was investigated by measuring the virus titers on the cells at 36°C and sodium bicarbonate concentrations of 0.225, 0.08, and 0.03% after incubation for 4 days as described previously (12, 14, 16, 24). Dot-blot hybridization. Semiconfluent HeLa S3 cells (5 x 105 cells per well of a six-well microplate) were transfected with 2 ,ug of RNA transcribed in vitro. At the indicated times, cells were washed twice in ice-cold phosphatebuffered saline and lysed with 2 ml of a sodium dodecyl sulfate (SDS) solution containing 0.1 M NaCl, 1 mM EDTA, 10 mM Tris hydrochloride (pH 7.4), and 0.2% SDS. The cell

VOL. 63, 1989

CONSTRUCTION OF LESS NEUROVIRULENT POLIOVIRUSES

lysate was then treated twice with phenol-chloroform (1:1, vol/vol). The aqueous phase, after addition of sodium acetate at a final concentration of 0.3 M, was added to 2 volumes of ethanol. DNAs of high molecular weights were wound up with glass rods, and the remaining nucleic acids were precipitated with ethanol by centrifugation. The precipitates were dissolved in a small volume of TE solution containing 10 mM Tris hydrochloride (pH 7.4) and 1 mM EDTA, 20 volumes of a 20 x SSC solution (1 x SSC is 0.15 M NaCl plus 0.015 M sodium citrate, pH 7.4) were added, and then the mixture was used for blotting experiments. After being blotted with a blotting apparatus (Ikeda Rika Co., Tokyo, Japan), nylon membrane filters (Amersham Corp.) were UV irradiated. Hybridization was performed at 42°C in a solution containing 50% formamide, 5x SSC, 50 mM sodium phosphate (pH 6.5), lOx Denhardt solution, and 250 ,ug of salmon sperm DNA per ml with a probe of pVMT7(1)DS(T) labeled with 32P by the random primer labeling method. The filters were washed at room temperature three times for 5 min each in a 2x SSC solution and then washed at 42°C twice for 30 min each in a solution containing 0.2x SSC and 0.1% SDS. Radioactive materials on filters were visualized by autoradiography. Gel electrophoresis. Cells labeled with [35S]methionine in a 60-mm plastic dish were lysed in 0.5 ml of sample buffer containing 62.5 mM Tris hydrochloride (pH 6.8), 2% SDS, 0.1 M dithiothreitol, 17% glycerol, and 0.025% bromphenol blue. After the sample was heated at 90°C for 5 min, a 10-,ul portion per well was applied to an SDS-12.5% polyacrylamide gel. The Laemmli (19) buffer system was employed for gel electrophoresis. 35S-labeled protein bands were visualized by autoradiography with Amplify (Amersham) as a fluorographic reagent. Nucleotide sequence analysis. A modified dideoxy method (18) was employed for sequencing viral RNAs that were prepared by the method described previously (18). The dideoxy method with synthetic DNA primers (30) was used to confirm the modified nucleotide sequences of all recombinant DNAs. RESULTS Construction of viable deletion mutants with a small-plaque phenotype. The attenuation phenotype of the Sabin strain of type 1 poliovirus is considered to be at least partly due to lowered efficiency of a certain viral replication step(s) in infected animals that is regulated by the highly ordered structure formed in the 5' noncoding sequence of the genome (12, 14, 24). Furthermore, a recent study (20) with a mouse model has suggested that attenuation caused by the 5' noncoding sequence of the genome of the Sabin strain of type 3 poliovirus probably results in part from a mouse brain-specific reduction in viral replication. Therefore, it is possible to construct less neurovirulent polioviruses by introducing mutations into the 5' noncoding sequences of the corresponding virus genomes. It is known that the rate at which spontaneous mutations occur is especially high in single-stranded RNA genome replication compared with double-stranded DNA replication (9), and the single-stranded RNA genome of poliovirus is no exception. Mutations occurring on the poliovirus genomes appear mainly to be point mutations and only partly to be short deletion or insertion mutations (23, 36), although fairly long deletions have been observed in the genomes of variants generated from in vitro poliovirus mutants with deleterious insertion sequences (4, 17). These led to a strategy for

5357

the in vitro construction of polioviruses with a stable, less neurovirulent phenotype upon repeated passages by introducing long deletions rather than point mutations or short deletions into the 5' noncoding sequence of the genomes of the corresponding virus strains. Recently, a number of viable deletion mutants of the Sabin strain of type 1 poliovirus were constructed (18). These viruses lack parts of nucleotide sequences in the 5' noncoding region of the genome. Of these deletion mutants, the viruses PV1(Sab)IC-DA23 and PV1(Sab)IC-DA21, which lack genome regions of nucleotide positions 570 to 726 and 564 to 726 (Fig. 2), respectively, showed a small-plaque phenotype in AGMK cells (16), although the virus PVl(Sab)IC-DH, which lacks positions 600 to 726 (Fig. 2), displayed plaques almost similar in size to those of the parent Sabin 1 virus, PV1(Sab)IC-0, in AGMK cells (18). Similar phenomena were observed when primary cultured cynomolgus monkey kidney cells (Table 1, experiment 1), HeLa S3 cells, or HEp2c cells were used. the small-plaque phenotype introduced by modulations of nucleotide sequences in the 5' noncoding region must be an indication of a lowered rate of viral multiplication. Thus, the small-plaque mutants PV1(Sab)IC-DA23 and PVl(Sab)IC-DA21 may have less neurovirulence compared with the parent Sabin 1 strain. To determine whether a similar phenomenon is observed in the virulent strains of poliovirus, we deleted nucleotide positions 564 to 726 from the genome of the virulent Mahoney strain as described in Materials and Methods. Strategy for the construction of the deletion cDNA mutant of the Mahoney strain is shown in Fig. 1. The deletion mutant recovered from cells transfected with pVM(1)IC-DA21(T) was designated PV1(M)IC-DA21. The genome structure of virus PV1(M)IC-DA21 is shown in Fig. 2. The deletion mutant thus constructed was tested for plaque size with primary cultured cynomolgus monkey kidney cells (Table 1, experiment 2). The plaque size of this mutant was smaller than that of the parent Mahoney virus, PV1(M)pDS306, although the size was still larger than that of the attenuated Sabin 1 virus, PV1(Sab)IC-0. Essentially the same results were obtained with other cultured cell lines, that is, AGMK cells, HeLa S3 cells, and HEp2c cells (data not shown). In the nucleotide sequence of positions 564 to 599, two interesting nucleotide sequences are observed. One is the nucleotide sequence of positions 564 to 577, which is rich in uridine residues (18) (see Fig. 7). The other is the nucleotide sequence consisting of eight bases at positions 583 to 590 (18) (see Fig. 7). These nucleotide sequences were suggested to be essential for active ribosome binding and translation of poliovirus uncapped RNA in an in vitro translation system (1). In any event, the nucleotide sequence of positions 564 to 599 appears to harbor a signal(s) to enhance the efficiency of poliovirus replication. Neurovirulence tests on PV1(Sab)IC-DA21 and PV1(M)ICDA21. Deletion mutant PV1(Sab)IC-DA21 and the parent Sabin 1 strain were tested for their monkey neurovirulence by intraspinal injection into cynomolgus monkeys as described in Materials and Methods. The results are shown in Fig. 3A. No monkey injected with virus PV1(Sab)IC-DA21 showed paralysis, whereas three of eight monkeys injected with the Sabin 1 virus showed paralysis. Furthermore, virus PV1(Sab)IC-DA21 had a much lower average lesion score than the parent Sabin 1 virus. Thus, both lesion score and incidence of paralysis clearly indicated that the small-plaque mutant PVl(Sab)IC-DA21 had a less neurovirulent phenotype compared with the parent Sabin 1 virus. Reproductive

5358

J. VIROL.

IIZUKA ET AL. 7369 - I poly(A) , {-

743 polyprotein coding region VPg 1 5' ,,y,,{t,s,,,,z,,,,,,,,,,,,,,,,z,,,,,,,,,r,,,,t,Z,,,, --r--K I

[Z.3

0

viral RNA

I

I

I

I

1-

II

- -

-

-

-

-

--- - - -

I

PVlSabIO480 C

649 674 806 A G = link S i ' ~~~~59 ker 727 :G9 9 727 S alaIlinler,-; PV1(Sab)IC-DA23 1 0 0

PV1(Sab) IC-O (Saibini1) PVI(Sab) IC-DH

I

==

PV1(Sab)IC-DA21

563 r-1, lin:

50 ?

G

AA .. A+ CC

PVI(M)pDS306

+A

(Mahoney)

NcoI

Hhal

(388/389) (520/521)

HhaI

4

BanIl

(776/777) (909/910) FIG. 2. Genome structures of deletion mutants of type 1 poliovirus. The genome of type 1 poliovirus is shown at the top of the figure. VPg

is a genome-linked protein attached at the 5' terminus. Nucleotide sequences derived from the Mahoney (_) and Sabin 1 (E) strains between nucleotide positions 300 and 1000 are shown under the type 1 poliovirus genome. The nomenclature of viruses is shown on the left side of the figure. Numbers indicated over the genomes or in parentheses are nucleotide positions from the 5' end of the genomes of the Mahoney or Sabin 1 strain (23). Nucleotides differing between the Mahoney and Sabin 1 genomes are indicated under the genomes. The restriction cleavage sites on the corresponding cDNAs are indicated at the bottom of the figure. The positions of initiation of viral polyprotein synthesis are indicated by solid triangles. A Sall linker was inserted into each deletion site as described in Materials and Methods.

capacity at different temperatures (rct marker) was not affected by the deletion mutation (see Fig. 6). Since the plaque size displayed by the deletion mutant PV1(M)IC-DA21 was smaller than that of the parent Mahoney virus, PV1(M)pDS306 (Table 1, experiment 2), monkey neurovirulence tests via the intrathalamic (intracerebral) route were performed with this deletion mutant (Fig. 3B). The lesion score and incidence of paralysis caused by PV1(M)IC-DA21 were much lower than those caused by the parent Mahoney virus, although PV1(M)IC-DA21 showed a higher lesion score compared with the attenuated Sabin 1 virus, PV1(Sab)IC-0 (Fig. 3B). Thus, it was proved that the deletion of positions 564 to 726 provided a less neurovirulent phenotype to both the Sabin 1 and Mahoney viruses. Since U-rich and eight-base consensus sequences exist in this site of the 5' noncoding region of every enterovirus (10, 11, 21, 36) and rhinovirus (2, 32, 33) genome, it is possible that introduction of similar deletions into the 5' noncoding sequence of these picornavirus genomes would result in reduction of virulence of the corresponding picomaviruses. TABLE 1. Plaque size of deletion mutants and their parental viruses Plaque size (mm) on following Expt

1

PV1(Sab)IC-0 PV1(Sab)IC-DH PV1(Sab)IC-DA23

PV1(Sab)IC-DA21 2

day after inoculation':

Virus

PV1(Sab)IC-0 PV1(M)pDS306 PV1(M)IC-DA21

aMean of approximately 100 plaques.

3

5

7

1.6 1.3 0.7 0.7

6.5 5.4 3.0 2.6

15.8 12.5 5.0 3.8

1.7 5.9 3.6

8.0 14.8 12.0

16.0 27.5 21.5

Replication efficiency of deletion mutants. The small-plaque and less neurovirulent phenotypes shown by deletion mutants compared with the phenotypes shown by the parent viruses might reflect a reduced rate of viral production in the infected cells. To test this possibility, we measured the titers of viruses produced in the infected AGMK cells in a single cycle of infection at a temperature of 35.5°C (Fig. 4). Virion assembly of virus PV1(Sab)IC-DA21 started at about 6 h postinfection, whereas that of the parent Sabin 1 virus started before 4 h postinfection (Fig. 4A). The final yield of plaque-forming particles in cells infected with PV1(Sab)ICDA21 was more than 10-fold fewer than that in cells infected with the parent Sabin 1 virus. Similarly, we measured titers of viruses produced in the AGMK cells infected with PV1(M)IC-DA21 in a single cycle of infection at 35.5°C (Fig. 4B). The results indicated that virion assembly of PV1(M)ICDA21 is approximately 1 h slower than that of the parent Mahoney virus. The CPE induced by viruses was also examined (Fig. 4). Almost all cells infected with the Sabin 1 virus were rounded and detached before 8 h postinfection (Fig. 4A). At the same time, however, only 10 to 30% of cells infected with PV1(Sab)IC-DA21 showed apparent CPE. Thus, the smallplaque phenotype of deletion mutant PV1(Sab)IC-DA21 can be explained by the prolongation of each cycle of infection and the reduced final yield of infectious particles. Similar delay was observed in the appearance of CPE in cells infected with the deletion mutant of the Mahoney virus compared with that in cells infected with the parent Mahoney virus, although final yields of infectious particles were almost the same in both the infected cells (Fig. 4B). To examine what might be the primary defect in the deletion mutants, we analyzed the pattern of viral and cellular proteins synthesized in infected cells (Fig. 5). HEp2c cells infected with PV1(Sab)IC-DA21 or the parent Sabin 1 virus were pulse-labeled with [35S]methionine at times after

VOL. 63, 1989

CONSTRUCTION OF LESS NEUROVIRULENT POLIOVIRUSES

5359

A PV1 (Sab)IC-0

8 0.92

PV1(Sab)IC-DA21 C0-
i. 0

0)

4

0

Virus

o

PV1(M)pDS306 0

1

2

3 4 5 6 7 8 Passage number

9 10

FIG. 6. Change of rct phenotype upon serial passage at an elevated temperature. Viruses PV1(Sab)IC-DA21 (0), PV1(Sab)ICDH (A), and PV1(Sab)IC-0 (A) were passaged up to 10 times at 37.5°C as previously described (14, 15). At the indicated passage numbers, titers of passaged isolates were measured at 36 and 39.5°C as described in Materials and Methods. Logarithmic differences of virus titers obtained at the two temperatures are shown.

PVl(Sab)IC-0

PVl(Sab)IC-DA21 DA21-L1 DA21-L2 DA21-L3 DA21-L4

da__________________ 0.225/0.03 0.225/0.08

0.12 4.27 4.62

0.00 2.20 2.50 0.48 0.20 0.28 0.32

Plaque size (mm)

(mean ± SD)b

8.5 ± 4.3 ± 2.4 ± 6.5 ± 6.3 ± 6.3 5.3 ±

2.6 1.9 1.5 1.7 1.9 2.1 2.1

a d marker values are the logarithmic differences of virus titers obtained at two different sodium bicarbonate concentrations of 0.225 and 0.03% or 0.225 and 0.08%. b Diameters of plaques displayed on day 4 of growth.

VOL. 63, 1989

CONSTRUCTION OF LESS NEUROVIRULENT POLIOVIRUSES

540

550

560 5

580

GGCU ACUACUUUGGGUGUCCGUGUUUCC (l I I m ma

Traqnuslated bJ4UCAGACAAUUGUAUCAUAAUGGGUGCU-*. 730

740

I

I I

I

:561 mm

5361

726: I linker,

PVIa(M)IC-559

'558

726' (SalI linker,)P1(M)IC-A558 FIG. 7. Sequences of deletion mutant genomes. The genome structure of PV1(M)IC-DA21 and the expected genome structures of other deletion mutants are shown. The nucleotide sequence indicated at the top of the figure is the RNA sequence of the Sabin 1 genome. Nucleotide positions are indicated over the genome. U and 8b in boxes represent the uridine-rich sequence and eight-base consensus sequence reported by Kuge and Nomoto (18), respectively. A line above the nucleotide sequence indicates that the sequence is perfectly conserved in the genomes of polioviruses, coxsackieviruses, and human rhinoviruses. Deleted sequences are indicated by lines with arrowheads on both ends. A Sall linker was inserted into each deletion site of the corresponding cDNAs as described in the legend to Fig. 2. Nomenclature of viruses is shown on the right side of the figure. Viruses PV1(M)IC-A561, PV1(M)IC-A559, and PV1(M)IC-A558 were not produced in cells transfected with the corresponding cDNAs or their RNA transcripts. I

Introduction of longer deletions into the genome of PV1(M)IC-DA21. Although the deletion mutant PV1(M)ICDA21 showed less neurovirulence than the parent Mahoney virus, the size of plaques (Table 1, experiment 2) and the lesion score (Fig. 3B) induced by the deletion mutant indicated that the virus is still fairly viable. Indeed, the final yield of infectious virus particles produced in cells infected with the deletion mutant was essentially the same as that produced with the parent Mahoney virus (Fig. 4). To construct less neurovirulent viruses than PV1(M)IC-DA21, we introduced deletions into the sequence upstream of position 564 in addition to deleting the sequence between positions 564 and 726 as described in Materials and Methods (Fig. 7). However, the deleted cDNA clones, pVM(1)A561(T), pVM(1)A559(T), and pVM(1)A558(T), which lack nucleotides 561 to 726, 559 to 726, and 558 to 726, respectively, were not infectious in AGMK cells and were also not infectious in HeLa S3 cells, in which the specific infectivity of the parent cDNA clone PV1(M)pDS306(T) is more than 103 PFU/,ug of DNA. To synthesize viral RNAs that have a higher specific infectivity than viral cDNAs, we inserted the bacteriophage T7 promoter just before each poliovirus sequence of the cDNA clones. The promoter-containing plasmids derived from pVS(1)IC-O(T), pVM(l)pDS306(T), pVM(1)ICDA21(T), pVM(1)A561(T), pVM(1)A559(T), and pVM(1) A558(T) were designated pVST7(1)0(T), pVMT7(1)DS(T), pVMT7(1)DA21(T), pVMT7(1)A561(T), pVMT7(1)A559(T), and pVMT7(1)A558(T), respectively. RNAs were transcribed in vitro from these plasmids and used for transfection into HeLa S3 cells as described in Materials and Methods. RNA transcripts synthesized from plasmids pVMT7(1)A561(T), pVMT7(1)A559(T), and pVMT7(1)A558 (T), however, showed no infectivity in HeLa S3 monolayer cells, although the specific infectivities of RNA transcripts from pVST7(1)0(T) and pVMT7(1)DS(T) were more than 105 PFU/,ug of RNA under similar conditions. Thus, we failed to obtain viruses PV1(M)IC-A561, PV(M)IC-A559, and PV1(M)

IC-A558 (Fig. 7). Virus PV1(M)IC-A561 that was not produced in cells transfected with RNA from pVMT7(1)A561(T) would have had a genome carrying a deletion three nucleotides longer

than that of PV1(M)IC-DA21. Since viability of virus PV1(M)IC-DA21 was fairly high concerning phenotypes in plaque size (Table 1, experiment 2), monkey neurovirulence (Fig. 3B), and final yield (Fig. 4B), the three nucleotides, UCC, of positions 561 to 563 may have an essential role(s) for the production of infections particles such as signals for ribosome entry, packaging, and so on. Therefore, we further tested the viability of the RNA transcripts from plasmids pVMT7(1)A561(T), pVMT7(1)A559(T), and pVMT7(1)A558 (T) as RNA replicons (Fig. 8). RNA transcripts synthesized from pVMT7(1)DS(T), pVMT7(1)DA21(T), pVMT7(1)A561 (T), pVMT7(1)A559(T), and pVMT7(1)A558(T) were introduced into HeLa S3 monolayer cells, and amounts of these RNAs replicated in the cells were measured as described in Materials and Methods. Virus-specific RNAs were replicated in cells transfected with RNAs synthesized from the parent plasmid pVMT7(1)DS(T) (Fig. 8, lanes 1 and 7) and a deletion plasmid pVMT7(1)DA21(T) (lanes 2 and 8) but not in cells transfected with RNAs from deletion plasmids pVMT7(1)A561(T) (lanes 3 and 9), pVMT7(1)A559(T) (lanes 4 and 10), and pVMT7(1)A558(T) (lanes 5 and 11). Thus, l

2 3 4 5 6

7

8 9 10 1112

1

1/3 1/30 FIG. 8. RNA replication in RNA-transfected cells. HeLa S3 monolayer cells were transfected with poliovirus RNA produced by in vitro transcription, and amounts of RNA replicated in the transfected cells were compared with each other by dot-blot hybridization as described in Materials and Methods. Plasmids from which RNAs were transcribed are as follows: lanes 1 and 7, pVMT7(1)DS(T); lanes 2 and 8, pVMT7(1)DA21(T); lanes 3 and 9, pVMT7(1)A561(T); lanes 4 and 10, pVMT7(1)A559(T); lanes 5 and 11, pVMT7(1)A558(T); lanes 6 and 12, no plasmid. Cell extracts were prepared 1 h (lanes 1 to 6) and 8 h (lanes 7 to 12) posttransfection. Dilutions of the extracts are indicated on the left side of the figure.

5362

J. VIROL.

IIZUKA ET AL.

poliovirus RNAs carrying deletions of positions 561 to 726, 559 to 726, and 558 to 726 are inactive as RNA replicons. These results suggest that the deletion of three nucleotides, UCC, at positions 561 to 563 is fatal to viral RNA synthesis, viral protein synthesis, or both. DISCUSSION We succeeded in producing a less neurovirulent phenotype in polioviruses in vitro by introducing long deletions into the 5' noncoding sequence of the genomes. The deletion mutants that lacked the genome region of nucleotide positions 564 to 726 showed slower production of infectious

particles in the infected cells compared with that of the parent viruses at least partly because of a lowered rate of virus-specific protein synthesis. These observations support our previous notion (12, 14, 22, 24) that the attenuation of poliovirus may result from a lowered rate of viral proliferation. The attenuation phenotype provided by long deletions must be stabler than that provided by point mutations, short deletions (29), or short insertions (18). It is possible, however, that the method presented here cannot be applied to

the construction of vaccine strains because the deletion mutants may grow poorly in the human intestinal tract. It is of interest that the final yield of deletion mutant PV1(M)IC-DA21 was on the same level as that of the parent Mahoney virus, whereas the final yield of deletion mutant PV1(Sab)IC-DA21 was more than 10-fold lower than that of the parent Sabin 1 virus (compare Fig. 4B with Fig. 4A), although both the mutants harbor the same deletion in their genomes that seems to affect the efficiency of the initiation step of viral protein synthesis. It could be that the amount of virus-specific proteins produced in cells infected with the virulent Mahoney virus is more than sufficient for virus production and that the final yield of infectious particles is limited by the amount of virion RNA synthesized in the infected cells. On the other hand, virus-specific protein synthesis of the attenuated Sabin 1 virus may be in keeping with the virion RNA synthesis in the infected AGMK cells. Using an in vitro translation system, it was reported (34, 35) that the virulent Mahoney RNA is a more efficient mRNA than the attenuated Sabin 1 RNA. Thus, the lowered translation rate of the viral proteins may result in a stronger reduction in final yield of infectious particles in the Sabin 1 virus compared with the Mahoney virus. Three nucleotides, UCC, from positions 561 to 563 in the 5' noncoding region were found to be essential for RNA replication and therefore virus production. According to the secondary structure of the 5' noncoding sequence of poliovirus genomes proposed by Pilipenko et al. (27), the three nucleotides, UCC, are not involved in the formation of secondary structures. To gain insight into the function of this part of the genome, we performed computer analysis of the nucleotide sequences. The results showed that the nucleotide sequence of positions 542 to 562 was perfectly conserved among the genomes of enteroviruses and rhinoviruses and that this part of the genome is highly complementary to nucleotide positions 1301 to 1317 of human 28S rRNA reported by Gonzalez et al. (8) (Fig. 9). The meaning of this observation is unclear at present. However, this part of the genome might have an important function in ribosome entry onto the viral mRNA. A small-plaque phenotype of virus PVI(Sab)IC-DA21 was less stable compared with that of the parent Sabin 1 virus, although the nucleotide sequence of the 5' noncoding region of the genome was unchanged. All the large-plaque variants

3

poliovirus typel A

,

C

GACUCUUUGG UCCGUGUUUC CU GA GGAACC AGGC ACAAAG A' 4 A Xu + 1300 C 1310 A 1320

AU

{C

560 +

550 u XG G

%C 540 4 AA

'G

''

'C''

''

'A

UG

Human 28S rRNA FIG. 9. Nucleotide sequence in human 28S rRNA complementary to that in the genome of poliovirus type 1. Nucleotide sequences of the poliovirus type 1 genome and human 28S rRNA are shown. Numbers indicated over and under nucleotide sequences are nucleotide positions of the poliovirus type 1 genome and human 28S rRNA, respectively. A nucleotide sequence perfectly conserved in the genomes of polioviruses, coxsackieviruses, and human rhinoviruses is indicated by bold letters.

generated from virus PV1(Sab)IC-DA21 lost the d phenotype. Since both small-plaque and d phenotypes of the Sabin 1 strain were mapped into the Sabin-specific capsid proteins (14, 24), and since both the phenotypes always changed together (14, 24), it is very possible that the mutation(s) in the genome of the large-plaque variants is the same as that determining the different phenotypes between the Mahoney and Sabin 1 viruses. It is unknown at present why the determinant(s) of the deletion mutant PV1(Sab)IC-DA21 is more changeable than that of the parent Sabin 1 virus although the nucleotide sequence encoding the capsid proteins of both the viruses is exactly the same. Nucleotide substitutions in the genome region coding for the capsid proteins of the large-plaque variants are currently being detected. ACKNOWLEDGMENTS We thank Shusuke Kuge, Hiroshi Yoshikura, Isao Yoshioka, and Keizo Inoue for many helpful discussions and suggestions during this work. We also thank Akira Oinuma and Yuko Kameda for help in the preparation of the illustrations and the manuscript, respectively, and Yuki lizuka for excellent assistance to N.I. This work was supported by research grants from the Ministry of Education, Science and Culture of Japan, Japan Health Sciences Foundation, and the WHO Programme for Vaccine DevelopmentHepatitis A/Polio. LITERATURE CITED 1. Bienkowska-Szewczyk, K., and E. Ehrenfeld. 1988. An internal 5'-noncoding region required for translation of poliovirus RNA in vitro. J. Virol. 62:3068-3072. 2. Callahan, P. L., S. Mizutani, and R. J. Colonno. 1985. Molecular cloning and complete sequence determination of RNA genome of human rhinovirus type 14. Proc. Natl. Acad. Sci. USA 82:732-736. 3. Davanloo, P., A. H. Rosenberg, J. J. Dunn, and F. W. Studier. 1984. Cloning and expression of the gene for bacteriophage T7 RNA polymerase. Proc. Natl. Acad. Sci. USA 81:2035-2039. 4. Dildine, S. L., and B. L. Semler. 1989. The deletion of 41 proximal nucleotides reverts a poliovirus mutant containing a temperature-sensitive lesion in the 5' noncoding region of geomic RNA. J. Virol. 63:847-862. 5. Doi, Y., and H. Itoh. 1979. Live oral poliomyelitis vaccine: preparation and selection of candidate seed virus from Sabin's type 1 virus. Virus 29:31-44. (In Japanese.) 6. Egashira, Y., N. Uchida, and H. Shimojo. 1967. Evaluation of Sabin live poliovirus vaccine in Japan. V. Neurovirulence of

VOL. 63, 1989

7.

8.

9. 10. 11.

12.

13.

14.

15.

16.

17. 18.

19. 20. 21.

22.

CONSTRUCTION OF LESS NEUROVIRULENT POLIOVIRUSES

virus strains derived from vaccinees and their contacts. Jpn. J. Med. Sci. Biol. 20:281-302. Evans, D. M. A., G. Dunn, P. D. Minor, G. C. Schild, A. J. Cann, G. Stanway, J. W. Almond, K. Currey, and J. V. Maizel, Jr. 1985. Increased neurovirulence associated with a single nucleotide change in a noncoding region of the Sabin type 3 poliovaccine genome. Nature (London) 314:548-550. Gonzalez, I. L., J. L. Gorski, T. J. Campen, D. J. Dorney, J. M. Erickson, J. E. Sylvester, and R. D. Schmickel. 1985. Variation among human 28S ribosomal RNA genes. Proc. Natl. Acad. Sci. USA 82:7666-7670. Holland, J., K. Spindler, F. Horodyski, E. Grabau, S. Nichol, and S. VandePol. 1982. Rapid evolution of RNA genomes. Science 215:1577-1585. lizuka, N., S. Kuge, and A. Nomoto. 1987. Complete nucleotide sequence of the genome of coxsackievirus Bi. Virology 156: 64-73. Jenkins, O., J. D. Booth, P. D. Minor, and J. W. Almond. 1987. The complete nucleotide sequence of coxsackievirus B4 and its comparison to other members of the Picornaviridae. J. Gen. Virol. 68:1835-1848. Kawamura, N., M. Kohara, S. Abe, T. Komatsu, K. Tago, M. Arita, and A. Nomoto. 1989. Determinants in the 5' noncoding region of poliovirus Sabin 1 RNA that influence the attenuation phenotype. J. Virol. 63:1302-1309. Kitamura, N., B. L. Semler, P. G. Rothberg, G. R. Larsen, C. J. Adler, A. J. Dorner, E. A. Emini, R. Hanecak, J. J. Lee, S. van der Werf, C. W. Anderson, and E. Wimmer. 1981. Primary structure, gene organization and polypeptide expression of poliovirus RNA. Nature (London) 291:547-553. Kohara, M., S. Abe, T. Komatsu, K. Tago, M. Arita, and A. Nomoto. 1988. A recombinant virus between the Sabin 1 and Sabin 3 vaccine strains of poliovirus as a possible candidate for a new type 3 poliovirus live vaccine strain. J. Virol. 62: 2828-2835. Kohara, M., S. Abe, S. Kuge, B. L. Semler, T. Komatsu, M. Arita, H. Itoh, and A. Nomoto. 1986. An infectious cDNA clone of the poliovirus Sabin strain could be used as a stable repository and inoculum for the oral polio live vaccine. Virology 151:21-30. Kohara, M., T. Omata, A. Kameda, B. L. Semler, H. Itoh, E. Wimmer, and A. Nomoto. 1985. In vitro phenotypic markers of a poliovirus recombinant constructed from infectious cDNA clones of the neurovirulent Mahoney strain and the attenuated Sabin 1 strain. J. Virol. 53:786-792. Kuge, S., N. Kawamura, and A. Nomoto. 1989. Genetic variation occurring on the genome of an in vitro insertion mutant of poliovirus type 1. J. Virol. 63:1069-1075. Kuge, S., and A. Nomoto. 1987. Construction of viable deletion and insertion mutants of the Sabin strain of type 1 poliovirus: function of the 5' noncoding sequence in viral replication. J. Virol. 61:1478-1487. LaemmUi, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London) 227:680-685. LaMonica, N., J. W. Almond, and V. R. Racaniello. 1987. A mouse model for poliovirus neurovirulence identifies mutations that attenuate the virus for humans. J. Virol. 61:2917-2920. Lindberg, A. M., P. 0. K. St&lhandske, and U. Pettersson. 1987. Genome of coxsackievirus B3. Virology 156:50-63. Nomoto, A., N. Iizuka, M. Kohara, and M. Arita. 1988. Strategy for construction of live picornavirus vaccines. Vaccine 6:134-

5363

137. 23. Nomoto, A., T. Omata, H. Toyoda, S. Kuge, H. Horie, Y. Kataoka, Y. Genba, Y. Nakano, and N. Imura. 1982. Complete nucleotide sequence of the attenuated poliovirus Sabin 1 strain genome. Proc. Natl. Acad. Sci. USA 79:5793-5797. 24. Omata, T., M. Kohara, S. Kuge, T. Komatsu, S. Abe, B. L. Semler, A. Kameda, H. Itoh, M. Arita, E. Wimmer, and A. Nomoto. 1986. Genetic analysis of the attenuation phenotype of poliovirus type 1. J. Virol. 58:348-358. 25. Omata, T., M. Kohara, Y. Sakai, A. Kameda, N. Imura, and A. Nomoto. 1984. Cloned infectious complementary DNA of the poliovirus Sabin 1 genome: biochemical and biological properties of the recovered virus. Gene 32:1-10. 26. Pelletier, J., and N. Sonenberg. 1988. Internal initiation of translation of eukaryotic mRNA directed by a sequence derived from poliovirus RNA. Nature (London) 334:320-325. 27. Pilipenko, E. V., V. M. Bfinov, L. I. Romanova, A. N. Sinyakov, S. V. Maslova, and V. I. Agol. 1989. Conserved structural domains in the 5'-untranslated region of picornaviral genomes: an analysis of the segment controlling translation and neurovirulence. Virology 168:201-209. 28. Racaniello, V. R., and D. Baltimore. 1981. Cloned poliovirus complementary DNA is infectious in mammalian cells. Science 214:916-919. 29. Racaniello, V. R., and C. Meriam. 1986. Poliovirus temperaturesensitive mutant containing a single nucleotide deletion in the 5'-noncoding region of the viral RNA. Virology 155:498-507. 30. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467. 31. Semler, B. L., A. J. Dorner, and E. Wimmer. 1984. Production of infectious poliovirus from cloned cDNA is dramatically increased by SV40 transcription and replication signals. Nucleic Acids Res. 12:5123-5141. 32. Skern, T., W. Sommergruber, D. Blaas, P. Gruendler, F. Fraundorfer, C. Pieler, I. Fogy, and E. Kuechler. 1985. Human rhinovirus 2: complete nucleotide sequence and proteolytic processing signals in the capsid protein region. Nucleic Acids Res. 13:2111-2126. 33. Stanway, G., P. J. Hughes, R. C. Mountford, P. D. Minor, and J. W. Almond. 1984. The complete nucleotide sequence of a common cold virus: human rhinovirus 14. Nucleic Acids Res. 12:7859-7875. 34. Svitkin, Y. V., S. V. Maslova, and V. I. Agol. 1985. The genomes of attenuated and virulent poliovirus strains differ in their in vitro translation efficiency. Virology 147:243-252. 35. Svitkin, Y. V., T. V. Pestova, S. V. Maslova, and V. I. Agol. 1988. Point mutations modify the response of poliovirus RNA to a translation initiation factor: a comparison of neurovirulent and attenuated strains. Virology 166:394-404. 36. Toyoda, H., M. Kohara, Y. Kataoka, T. Suganuma, T. Omata, N. Imura, and A. Nomoto. 1984. Complete nucleotide sequences of all three poliovirus serotype genomes: implication for genetic relationship, gene function and antigenic determinants. J. Mol. Biol. 174:561-585. 37. Trono, D., R. Andino, and D. Baltimore. 1988. An RNA sequence of hundreds of nucleotides at the 5' end of poliovirus RNA is involved in allowing viral protein synthesis. J. Virol. 62:2291-2299. 38. van der Werf, S., J. Bradley, E. Wimmer, F. W. Studier, and J. J. Dunn. 1986. Synthesis of infectious poliovirus RNA by purified T7 RNA polymerase. Proc. Natl. Acad. Sci. USA 83:2330-2334.