dELL is an essential RNA polymerase II elongation factor with a general role in development Joel C. Eissenberg*†, Jiyan Ma*, Mark A. Gerber*, Alan Christensen‡, James A. Kennison§, and Ali Shilatifard*† *Edward A. Doisy Department of Biochemistry and Molecular Biology, St. Louis University School of Medicine, 1402 South Grand Boulevard, St. Louis, MO 63104; ‡School of Biological Sciences, University of Nebraska, Lincoln, NE 68588; and §Laboratory of Molecular Genetics, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD 20892-2785 Edited by Michael S. Levine, University of California, Berkeley, CA, and approved May 21, 2001 (received for review April 2, 2002)
Several eukaryotic proteins increase RNA polymerase II (Pol II) transcription rates in vitro. The relative contributions of these factors to gene expression in vivo is unknown. The ELL family of proteins promote Pol II elongation in vitro, and the Drosophila ELL homolog (dELL) is associated with Pol II at sites of transcription in vivo. The purpose of this study was to test whether an ELL family protein is required for gene expression in vivo. We show that dELL is encoded by the Suppressor of Triplo-lethal locus [Su(Tpl)]. We have characterized seven distinct mutant alleles of Su(Tpl) and show that a dELL transgene rescues recessive lethality of Su(Tpl). Su(Tpl) mutations cause abnormal embryonic segmentation and dominantly modify expression of diverse genes during development. These data show that an ELL family elongation factor is essential, acts broadly in development, and is not functionally redundant to other elongation factors in vivo.
R
NA polymerase II (Pol II) encounters numerous structural barriers to elongation in the template between initiation and termination. Several biochemical factors have been identified that can enhance Pol II processivity in vitro (1, 2). Among these, the mammalian elongation factors Elongin, TFIIF, and ELL are distinguished by their ability to increase the catalytic rate of Pol II in vitro by suppressing transient pausing (3–10). It is unknown whether these factors function redundantly in vivo. Importantly, ELL also has been implicated in the pathogenesis of acute myeloid leukemia, where it has been found as a fusion protein with the human trithorax protein homolog MLL (11–12). Three mammalian ELL family proteins—ELL, ELL2, and ELL3—have been described (8, 13, 14). Each increases the catalytic rate of transcription elongation by RNA Pol II. ELL and ELL2 are expressed in most or all tissues (8, 11, 15), whereas ELL3 is expressed only in testis (14). Although ELL homologs are found in Caenorhabditis elegans, Drosophila, Xenopus, teleost fishes, and mammals, they are absent from both budding and fission yeast, suggesting that the ELL family of elongation factors represents an adaptation of metazoans. Specifically, ELL could play an important role in expression of large genes and tissuespecific genes that must be expressed at high levels. However, nothing is known about the physiological role for ELL in normal cell function and differentiation. In Drosophila, the unique ELL family gene dELL enhances Pol II elongation in vitro and is associated with Pol II on chromosomes and in fly extract (16). dELL is expressed in all cell types examined, and at all developmental stages, suggesting it could play a widespread role in gene transcription during development. To test whether ELL-family proteins perform an essential function in gene expression, we identified and characterized mutations in dELL. We show that dELL is encoded by the Suppressor of Triplo-lethal [Su(Tpl)] locus. dELL mutations cause recessive lethality with a high frequency of embryonic segmentation defects. dELL mutations also dominantly modify phenotypes associated with ectopic expression or hypomorphic alleles of several large genes. These data demonstrate that an ELL family elongation factor is essential and is not functionally redundant to other elongation factors in vivo.
9894 –9899 兩 PNAS 兩 July 23, 2002 兩 vol. 99 兩 no. 15
Materials and Methods PCR and Sequencing of PCR Products. For Su(Tpl)10, Su(Tpl)17,
Su(Tpl)s1, Su(Tpl)S-192, and Su(Tpl)XS-706, genomic DNA was extracted from five heterozygous mutant adult flies as PCR templates. The PCRs were performed by the following regime: (i) denaturation at 94°C for 1 min, (ii) 30 cycles of 94°C for 1 min and 68°C for 3 min, and (iii) a final 3-min extension at 68°C. Primer sequences used to amplify the dELL-coding sequence were: 5⬘-GCT TACTA AT TAGCGGCTAGT TGCGCGCACGTTAT-3⬘ and 5⬘-GGGAATCTGCGGATGGTCTCATCGAAGTAGTCCC-3⬘. The PCR products were purified by using the High Pure PCR product purification kit (Roche) and used directly in cycle sequencing with dye-labeled terminators (BigDye Terminators, Perkin–Elmer). The cycle sequencing conditions were: 96°C for 2 min, 40 cycles (96°C for 30 sec, 50°C for 15 sec, 60°C for 4 min). The corresponding sequencing primers were as follows: PCR primers as mentioned above and some internal primers: 5⬘-GACCACCACCAACGCCAGAGCC-3⬘, 5⬘-GGAGGGA ACCCT TGA ATGCGT T-3⬘; 5⬘-CAGTCGGATATCGGGCGTAAGG-3⬘, 5⬘-TGTCCGATGTGTCCAGGCGCAAT-3⬘; 5⬘-ATTGCGCCTGGACACATCGGAC-3⬘, 5⬘CGACGTCCGGCCAGAGTCCA AC-3⬘; 5⬘-GT TGGACTCTGGCCGGACGTCG-3⬘, 5⬘-GGTCCATTGGATGATCACAGCACA-3⬘; 5⬘-GTGCTGTGATCATCCAATGGACC-3⬘, 5⬘-CTTCGGCGGCGTTGAAGAGG-3⬘; 5⬘-GCAGCAGGTGCA ACAGA AGCAG-3⬘, 5⬘-CTGCT TCTGT TGCACCTGCTGC-3⬘; and 5⬘-AGGACT TATCCGA ACGTCTGGAGA-3⬘, 5⬘-TCTCCAGACGTTCGGATAAGTCCT-3⬘, 5⬘CATCGTCGGCA ACATCACGCCGC-3⬘, 5⬘-GCGGCGTGATGTTGCCGACGATG-3⬘. For Su(Tpl)s2, homozygous mutant embryos were isolated from a stock balanced with a TM3 chromosome that expresses green fluorescent protein. DNA was prepared from the mutant embryos and the ELL ORF was amplified by using the following primers: 5⬘-CCGT T TCATA A AT T T TCCGG-3⬘ and 5⬘CATGGGAATCTGCGGATGGTC-3⬘. Cloned amplification products were then sequenced directly by using those primers and by using the following additional primers: 5⬘-GGCGATGA ACTA ACT TACG-3⬘; 5⬘-CTGCTGA ACGCAT TCAAGCG-3⬘; and 5⬘-GGAGCAGGAGGAGGAGGTGG-3⬘. Transgene Rescue Construct and Detection of Transgenic dELL Protein.
Previously, the full-length dELL cDNA had been cloned and inserted into a pRSET vector containing an upstream in-frame N-terminal His-6 epitope tag and an Express epitope tag (16). The epitope-tagged dELL cDNA was excised from this recombinant as an NdeI–EcoRI restriction fragment, and both ends were blunted by the Klenow fragment. This restriction fragment was then ligated to a SmaI-restricted BG⌬26S vector (provided by D. Dorsett, Saint Louis Univ. School of Medicine), which This paper was submitted directly (Track II) to the PNAS office. Abbreviations: Pol II, polymerase II; Su(Tpl), Suppressor of Triplo-lethal; dELL, Drosophila ELL homolog; DSIF, DRB sensitivity inducing factor. †To whom reprint requests may be addressed. E-mail:
[email protected] or
[email protected].
www.pnas.org兾cgi兾doi兾10.1073兾pnas.152193699
A dELL Transgene Complements the Recessive Lethality of Su(Tpl) Mutations. Genetic complementation of Su(Tpl) mutations with
Results Identification of dELL Mutations in Lines Carrying Su(Tpl) Alleles.
dELL is the unique ELL family protein in the Drosophila genome database, found at cytological position 76D on the third chromosome. Comparison of the genomic sequence information and EST sequences, together with 5⬘-rapid amplification of cDNA ends analysis, places the entire dELL gene within the large first intron of dMi-2 (Fig. 1). The Su(Tpl) maps genetically to the region of the third chromosome containing 76D (17). The Su(Tpl)JE3 mutant allele is associated with a P-element insertion in the large first intron of the dELL transcription unit. Su(Tpl)JE3 complements mutant alleles of Drosophila Mi-2 but not mutant alleles of Su(Tpl), suggesting that dELL could be the Su(Tpl) gene product. To confirm this inference, we sequenced the dELL-coding sequence in six independently isolated ethyl methanesulfonate-induced Su(Tpl) stocks: Su(Tpl)10 and Su(Tpl)17, which originally defined the Su(Tpl) locus (17, 18); Su(Tpl)s1 and Su(Tpl)s2, which were recovered in a screen for recessive lethal mutations in 76D (formerly called l (3)76BDs1 and l (3)76BDs2; ref. 19); and Su(Tpl)S-192 and Su(Tpl)XS-706, which were isolated in a screen for dominant suppressors of ectopic ras pathway activation in the eye (formerly SR3–4AS-192 and SR3–4AXS-706; ref. 20). All six alleles are strong suppressors of Tpl triplolethality (data not shown). All six ethyl methanesulfonate-induced mutant Su(Tpl) alleles have nucleotide changes that alter or truncate the dELL ORF (Fig. 2A). Su(Tpl)s1 has a 17-nt deletion beginning in codon 145, resulting in a frame-shift and severe truncation of the dELL protein. Su(Tpl)s2 has a C-to-T transition at codon 52, resulting in a nonsense mutation. The Su(Tpl)10 and Su(Tpl)17 alleles have nonsense mutations and encode C terminally truncated proteins of 435 and 789 aa, respectively. The Su(Tpl)S-192 allele contains three missense mutations: two of these, R917G and D919N, convert charged residues that are highly conserved between Drosophila and mammalian ELL family proteins to neutral side chains (Fig. 2B). The third, S660L, alters a residue conserved between dELL and mammalian ELL2. The Su(Tpl)XS-706 allele contains a single missense substitution at a nonconserved site. Su(Tpl)S-192 and Su(Tpl)XS-706 were isolated in the same genetic background during the same mutational screen but do not share any of the same codon changes. The sequence differences we have identified are therefore unlikely to be silent polymorphisms. Eissenberg et al.
dELL Is Required for Normal Embryonic Segmentation. Su(Tpl) mu-
tations are recessive lethal, and homozygous somatic clones of Su(Tpl) mutant alleles do not survive in the eye (22). To determine when zygotically Su(Tpl) mutant flies die, we established stocks carrying each of the Su(Tpl) alleles over a balancer chromosome expressing green fluorescent protein (GFP; ref. 23). Pairwise crosses of flies carrying each of the five distinct molecularly characterized alleles revealed that most or all heteroallelic (GFP⫺) progeny died by the end of embryogenesis or shortly after hatching (data not shown). Because previous studies demonstrated a substantial maternal pool of dELL mRNA in the oocyte (16), it is likely that embryonic development is supported to some extent by maternal dELL in the absence of functional zygotic protein. Because Su(Tpl) appears to be a germ-line lethal (unpublished data), it is not possible to remove the maternal contribution. Examination of heteroallelic Su(Tpl) mutant embryo cuticles from heterozygous mothers revealed a high frequency (⬎50% in crosses examined) of segmentation defects (Fig. 4). That similar defects are seen with different heteroallelic combinations of independently isolated Su(Tpl) mutations rules out the possibility that cryptic mutations in other linked genes cause these defects. The most frequently observed defects included partially or completely missing denticle belts and denticle belt fusions, often involving even-numbered abdominal belts and兾or the third thoracic belt. The cuticle defects and late embryonic lethality likely reflect depletion of maternally loaded dELL RNA and兾or protein and imply a requirement for dELL in anterior–posterior segmentation. dELL Is Required for the Normal Expression of Diverse Genes During Development. Tpl is the only locus in the Drosophila genome that
is both triplo- and haplo-lethal (24). The Su(Tpl)10 and Su(Tpl)17 mutations were initially isolated in a screen for Tpl loss-offunction alleles (18) and were later shown to map to a separate locus called Su(Tpl) (17). In light of our identification of dELL as the Su(Tpl) gene product, the ability of Su(Tpl) to dominantly suppress the triplo-lethality of Tpl could be rationalized if transcription elongation were limiting in normal Tpl gene expression. Reduced dELL levels could reduce the output of each Tpl allele in a three-dose Tpl fly, resulting in Tpl gene product levels closer to wild-type levels (two Tpl doses). Although the Tpl gene product is unknown, other dominant phenotypes of Su(Tpl) are consistent with this interpretation and suggest that dELL can be limiting for gene expression: (i) Su(Tpl)S-192 and Su(Tpl)XS-706 were isolated in a screen for dominant modifiers of rough eye phenotypes resulting from an activated form of Ras1 expressed under control of the sevenless enhancer兾promoter (20). Additional alleles (called SS3–4; ref. 22) were isolated in a separate screen for suppressors of ectopic seven in absentia expression in the eye, also mediated by ras pathway activation. Thus, dELL activity is limiting in normal PNAS 兩 July 23, 2002 兩 vol. 99 兩 no. 15 兩 9895
BIOLOGY
contained the promoter and first intron of the Drosophila Chip gene upstream of the insertion site. Orientation of the inserted cDNA was confirmed by sequencing, and the resulting construct was digested with EcoRI and NotI to release the promoter, cDNA, and epitope tags. This fragment was then ligated to the NotI–EcoRI fragment of the pCaSpeRN vector (provided by Dale Dorsett). The resulting construct was then used to generate transgenic lines for subsequent rescue experiments and immunocytological analysis. Immunostaining was with 6xHis-Gly Ab (Invitrogen) as described (16).
DEVELOPMENTAL
Fig. 1. Molecular organization of the dELL locus. dELL is encoded by sequences lying within the large intron of dMi-2. The relative position of the P-element associated with the Su(Tpl)JE3 allele is shown at the apex of the triangle below the map.
a dELL transgene provided additional evidence that Su(Tpl) is the dELL gene. A 6xHis-tagged dELL cDNA fragment was fused downstream of the promoter and first intron of the ubiquitously expressed Chip gene (21). Previous studies showed that 6xHis-tagged dELL is associated with Pol II in transgenic fly extracts (16). Expression of epitope-tagged dELL from the transgene was verified by immunostaining of transgenic polytene chromosomes (Fig. 3A); like endogenous dELL (16), the tagged transgenic protein targets numerous chromosomal sites including puffs, and colocalizes extensively with phosphorylated Pol II. This transgene rescues flies carrying heteroallelic combinations of Su(Tpl) mutations to fertile adults (Fig. 3B). Thus, dELL is essential in flies and has unique functions not redundant to other elongation factors (e.g., Elongin, TFIIF, and CSB).
Fig. 2. dELL mutations are present in six alleles of Su(Tpl). (A) The complete amino acid sequence of dELL is shown; the N-terminal shaded region indicates sequence homologous to the transcription elongation activity domain兾p53 interaction domain (9, 35), and the C-terminal shaded region indicates sequence homologous to mammalian ELL sequences required for the transformational activity of MLL–ELL fusion protein in myeloid precursor cells. Above the sequence are indicated the sites of mutations in Su(Tpl) mutant alleles. (B) Sequence alignment of the conserved C-terminal domain of mammalian and Drosophila ELL proteins. Residues that are identical in all four proteins are in red; residues representing conservative substitutions in all four proteins are in blue. Sites of C-terminal domain mutations found in the Su(Tpl)S-192 allele are indicated on the last line.
signaling through the ras pathway in Drosophila; (ii) Su(Tpl)s1 and Su(Tpl)s2 dominantly suppress the ectopic expression of the homeotic gene Sex combs reduced (Scr) caused by the Pc4 mutation (19). Thus, dELL is limiting for Scr expression. We reasoned that if ELL mutations can suppress dominant phenotypes because ELL is limiting for expression of ectopically expressed genes, then these dELL mutations should also increase the severity of hypomorphic phenotypes. Indeed, we found that Su(Tpl) alleles significantly enhance the mutant phenotypes displayed by hypomorphic alleles of Notch (Nnd-1; Fig. 5A) and cut (ct53d; Fig. 5B). Because both the ct53d and Nnd-1 mutations reduce gene expression (25, 26), the dominant enhancement of these mutations by Su(Tpl) indicates that dELL normally increases expression of ct and N. Discussion ELL family of proteins have been characterized biochemically on the basis of their ability to promote Pol II elongation activity in 9896 兩 www.pnas.org兾cgi兾doi兾10.1073兾pnas.152193699
vitro by suppressing transient pausing on a purified DNA template (8, 10, 13, 14). This suggests an important role for ELL-dependent elongation in gene expression. Consistent with this inference, the Drosophila ELL homolog was recently found to colocalize with phosphorylated RNA Pol II on chromosomes, concentrated at sites of active transcription in vivo (16). Here, we provide the first genetic evidence that an ELL family protein is essential and required for normal development. dELL appears to act widely, in contrast to other metazoan elongation factors examined in vivo. Mutation of a zebrafish homolog of the putative yeast elongation factor Spt5p disrupts proper development of catecholaminergic neurons in the peripheral and central nervous system (27). Spt5p is part of the DRB sensitivity-inducing factor (DSIF) complex, which has both positive and negative effects on transcription in vitro (28, 29). The zebrafish mutation abolishes the negative, but not the positive activity of DSIF on Pol II elongation in vitro (27). Eissenberg et al.
Eissenberg et al.
How can dELL be essential and limiting for gene expression in Drosophila, when flies also express homologs of other elongation factors that act similarly to enhance Pol II Km and兾or Vmax (e.g., DRB sensitivity-inducing factor, TFIIF, Elongin)? Fig. 6 illustrates three models for dELL–Pol II interaction that could explain how dELL can be a nonredundant elongation factor in metazoan cells. dELL may be a gene-specific elongation factor (Fig. 6A). By this model, dELL would be associated with elongating polymerase at some loci, whereas other elongation factors would be required for Pol II elongation at other loci. Alternatively, dELL may be required during a phase of elongation distinct from that requiring other factors (Fig. 6B). By this model, dELL could be exchanged for other elongation factors that act during an earlier (or later) phase of elongation. Finally, dELL may bind Pol II together with other elongation factors, each contributing additively or cooperatively to Pol II elongation (Fig. 6C). These models are not necessary mutually exclusive. Detailed knowledge of Pol II holoenzyme structure, elongation factor binding sites, and the composition of elongating Pol II PNAS 兩 July 23, 2002 兩 vol. 99 兩 no. 15 兩 9897
BIOLOGY
Mutation in the zebrafish homolog of the putative yeast elongation factor Spt6p results in reduced pigmentation and tail growth, small ears, and reduced numbers of myocardial cells in embryogenesis (30). Mutation in the nematode homolog of Spt6p alters the timing of gut precursor cell division in gastrulation (31). The role of Spt6p in the Pol II transcription mechanism is unclear, but genetic and biochemical evidence in yeast suggests a role in promoting transcription through chromatin (32–34). Thus, homologs of the Spt5p and Spt6p ‘‘histone group’’ of putative elongation factors seem to have evolved specialized functions in metazoans, or at least appear to be limiting for proper differentiation only in a restricted number of cell types. In contrast, our data suggests that dELL has a broad role in gene expression in various tissues throughout development, consistent with its ubiquitous expression and widespread distribution on polytene chromosomes (Fig. 3; ref. 16). The fact that dELL is essential and that it modifies a variety of mutant phenotypes implicates dELL in the regulation of diverse genes and shows that it is not functionally redundant with other elongation factors in vivo.
DEVELOPMENTAL
Fig. 3. A dELL transgene complements the recessive lethality of Su(Tpl). (A) Immunofluorescence colocalization of the transgenically expressed 6xHis-dELL protein and phosphorylated RNA Pol II on transgenic third instar larval salivary gland polytene chromosomes. The 6xHis-dELL is detected by using 6xHis-Gly Ab (Invitrogen), and phosphorylated Pol II is detected with a mAb specific for the phosphorylated form of the Pol II large subunit C-terminal domain (H14; Covance). (B) A transgenic copy of dELL complements the recessive lethality of heteroallelic Su(Tpl) mutant flies.
Fig. 5. Su(Tpl) mutations are dominant enhancers of Nnd-1 and ct53d. (A) Wings of adult males that are Nnd-1 and either Su(Tpl)⫹ or mutant for one of five different dELL mutations. (B) Tabulation of wing nicks in adult males that are ct53d and either Su(Tpl)⫹ or mutant for one of five different dELL mutations.
Fig. 4. Su(Tpl) mutations cause recessive embryonic segmentation defects. (A) Tabulation of cuticular defects observed in various heteroallelic combinations of Su(Tpl) mutations. (B) Examples of the most commonly observed cuticle defects in heteroallelic mutant Su(Tpl) embryos. F, fusion of adjacent denticle belts; H, failure of head involution; I, incomplete denticle belt; and M, missing denticle belt.
complexes at specific loci will be required to distinguish among these models. dELL Mutations Preferentially Affect Expression of Large Genes.
Su(Tpl) alleles enhance hypomorphic phenotypes of Notch and cut and suppresses ectopic expression of Sex combs reduced. Interestingly, Su(Tpl) alleles fail to enhance any of five white hypomorphic mutations (wapricot, wapricot-like, weosin, wcoffee, and wcarrot) and two hypomorphic rudimentary mutations (r hd1 and r hd1–12) (data not shown). One way to rationalize this differ9898 兩 www.pnas.org兾cgi兾doi兾10.1073兾pnas.152193699
ence is if dELL is limiting for expression primarily of large genes. By this reasoning, the probability of Pol II pausing while transcribing relatively large genes like Notch (35 kb), cut (65 kb), and Scr (23 kb) would be high, and such genes would be particularly sensitive to dELL concentration. The probability of Pol II pausing on short genes like rudimentary (13 kb) and white (5.9 kb) would be correspondingly low, and thus reduced dELL levels would be expected to have little or no effect. Of course, the number and structure of specific pause sites, nucleotide sequences and relative proportion of intron and exon sequences could also inf luence the requirement for dELL. A preferential role for dELL in transcription of large genes is consistent with the fact that ELL family proteins are found in all metazoans examined, but absent from bacteria and yeast. The average size of metazoan transcription units are significantly larger that those found in bacteria and yeast, mostly owing to the larger number and size of introns in metazoan genes. Although most Pol II elongation factors have homologs in yeast and higher eukaryotes, ELL family proteins appear to have co-evolved with the dramatic growth in transcription unit lengths that accompanied the evolution of metazoan eukaryotes. dELL Mutations and ELL Protein Structure兾Function. A C-terminal
domain of mammalian ELL has been implicated in the apoptosis caused by ELL overexpression in cultured cells (35) and in the increased proliferative potential of myeloid precursors caused by the MLL–ELL fusion protein (12). This domain is conserved among the three mammalian ELL-family proteins and is also Eissenberg et al.
We thank J. Engelman for isolating and sequencing the Su(Tpl)JE3 allele, C. Tegtmier and K. Dixit for help with cuticle preps, M. Donlin for help in database searches, and D. Dorsett for plasmids and helpful discussions, suggestions, and encouragement. This work was supported by National Institutes of Health Grants 1R55GM057005 and 1R01CA089455, National Science Foundation Grants MCB 0131414 (to J.C.E.) and MCB 9808209 (to A.C.C.), American Cancer Society Grant RP69921801, and by a Mallinckrodt Foundation award (to A.S.). A.S. is a Scholar of the Leukemia and Lymphoma Society.
1. Shilatifard, A. (1998) FASEB J. 12, 1437–1446. 2. Reines, D., Conaway, R. C. & Conaway, J. W. (1999) Curr. Opin. Cell. Biol. 11, 342–346. 3. Price, D. H., Sluder, A. E. & Greenleaf, A. L. (1989) Mol. Cell. Biol. 9, 1465–1475. 4. Bradsher, J. N., Jackson, K. W., Conaway, R. C. & Conaway, J. W. (1993) J. Biol. Chem. 268, 25587–25593. 5. Garrett, K. P., Tan, S., Bradsher, J. N., Lane, W. S., Conaway, J. W. & Conaway, R. C. (1994) Proc. Natl. Acad. Sci. USA 91, 5237–5241. 6. Duan, D. R., Pause, A., Burgess, W. H., Aso, T., Chen, D. Y., Garrett, K. P., Conaway, R. C., Conaway, J. W., Linehan, W. M. & Klausner, R. D. (1995) Science 269, 1402–1406. 7. Reines, D., Conaway, J. W. & Conaway, R. C. (1996) Trends Biochem. Sci. 21, 351–355. 8. Shilatifard, A., Duan, D. R., Haque, D., Florence, C., Schubach, W. H., Conaway, J. W. & Conaway, R. C. (1997) Proc. Natl. Acad. Sci. USA 94, 3639–3643. 9. Shilatifard, A., Haque, D., Conaway, R. C. & Conaway, J. W. (1997) J. Biol. Chem. 272, 22355–22363. 10. Elmendorf, B. J., Shilatifard, A., Yan, Q., Conaway, J. W. & Conaway, R. C. (2001) J. Biol. Chem. 276, 23109–23114. 11. Thirman, M. J., Levitan, D. A., Kobayashi, H., Simon, M. C. & Rowley, J. D. (1994) Proc. Natl. Acad. Sci. USA 91, 12110–12114. 12. DiMartino, J. F., Miller, T., Ayton, P. M., Landewe, T., Hess, J. L., Cleary, M. L. & Shilatifard, A. (2000) Blood 96, 3887–3893. 13. Shilatifard, A., Lane, W. S., Jackson, K. W., Conaway, R. C. & Conaway, J. W. (1996) Science 271, 1873–1876. 14. Miller, T., Williams, K., Johnstone, R. W. & Shilatifard, A. (2000) J. Biol. Chem. 275, 32052–32056. 15. Thirman, M. J., Diskin, E. B., Bin, S. S., Ip, H. S., Miller, J. M. & Simon, M. C. (1997) Proc. Natl. Acad. Sci. USA 94, 1408–1413. 16. Gerber, M., Dean, K., Ma, J., Eissenberg, J. C. & Shilatifard, A. (2001) EMBO J. 20, 6104–6114. 17. Dorer, D. R., Ezekiel, D. H. & Christensen, A. C. (1995) Genetics 141, 1037–1042.
18. Roehrdanz, R. L. & Lucchesi, J. C. (1980) Genetics 95, 355–366. 19. Kehle, J., Beuchle, D., Treuheit, S., Christen, B., Kennison, J. A., Bienz, M. & Mu ¨ller, J. (1998) Science 282, 1897–1900. 20. Karim, F. D., Chang, H. C., Therrien, M., Wassarman, D. A., Laverty, T. & Rubin, G. M. (1996) Genetics 143, 315–329. 21. Morcillo, P., Rosen, C., Baylies, M. K. & Dorsett, D. (1997) Genes Dev. 11, 2729–2740. 22. Neufeld, T. P., Tanga, A. H. & Rubin, G. M. (1998) Genetics 148, 277–286. 23. Rudolph, T., Lu, B., Westphal, T., Szidonya, J., Eissenberg, J. & Reuter, G. (1999) Drosophila Inf. Serv. 82, 99–100. 24. Lindsley, D. L., Sandler, L., Baker, B. S., Carpenter, A. T. C., Denell, R. E., Hall, J. C., Jacobs, P. A., Miklos, G. L. G., Davis, B. K., Gethmann, R. C., et al. (1972) Genetics 71, 157–184. 25. Jack, J. W., Dorsett, D., Delotto, Y. & Liu, S. (1991) Development (Cambridge, U.K.) 113, 735–747. 26. Hing, H. K., Bangalore, L., Sun, X. & Artavanis-Tsakonas, S. (1999) Eur. J. Cell Biol. 78, 690–697. 27. Guo, S., Yamaguchi, Y., Schilbach, S., Wada, T., Lee, J., Goddard, A., French, D., Handa, H. & Rosenthal, A. (2000) Nature (London) 408, 366–369. 28. Wada, T., Takagi, T., Yamaguchi, Y., Ferdous, A., Imai, T., Hirose, S., Sugimoto, S., Yano, K., Hartzog, G. A., Winston, F., et al. (1998) Genes Dev. 12, 343–356. 29. Renner, D. B., Yamaguchi, Y., Wada, T., Handa, H. & Price, D. H. (2001) J. Biol. Chem. 276, 42601–42609. 30. Keegan, B. R., Feldman, J. L., Lee, D. H., Koos, D. S., Ho, R. K., Stanier, D. Y. R. & Yelon, D. (2002) Development (Cambridge, U.K.) 120, 1623–1632. 31. Nishiwaki, K., Sano, T. & Miwa, J. (1993) Mol. Gen. Genet. 239, 313–322. 32. Winston, F. (1992) in Transcriptional Regulation, eds. McKnight, S. L. & Yamamoto, K. R. (Cold Spring Harbor Lab. Press, Plainview, NY), pp. 1271–1293. 33. Bortvin, A. & Winston, F. (1996) Science 272, 1473–1476. 34. Lindstrom, D. L. & Harzog, G. A. (2001) Genetics 159, 487–497. 35. Johnstone, R. W., Gerber, M., Landewe, T., Tollefson, A., Wold, W. S. & Shilatifard, A. (2001) Mol. Cell. Biol. 21, 1672–1681. DEVELOPMENTAL
conserved in dELL. The finding that the Su(Tpl)S-192 allele contains missense mutations at highly conserved residues in this domain suggests that the conserved C-terminal domain is essential for the normal activity of dELL. Identification of dELL mutations and the ability to complement these mutations with a wild-type transgene now makes possible a targeted mutagenesis strategy to define the functional significance of conserved domains in ELL family proteins.
Eissenberg et al.
PNAS 兩 July 23, 2002 兩 vol. 99 兩 no. 15 兩 9899
BIOLOGY
Fig. 6. Models of ELL function in vivo. Several factors, including the ELL family proteins and TFIIF, operate in vitro to increase the overall rate of transcription elongation by altering the Km and兾or Vmax of elongating polymerase. Three models may account for the functional nonredundancy of ELL elongation factors and other members of its kinetic class, which includes Elongins, CSB, and DRB sensitivity-inducing factor (represented here by TFIIF). (A) ELL may act specifically on a distinct subset of genes from those requiring other elongation factors. (B) ELL may act at a distinct kinetic phase of Pol II elongation. (C) ELL may act additively or cooperatively with other elongation factors to achieve optimal Pol II elongation rates in vivo.
