Derivation of an induced pluripotent stem cell line ...

Download PDF
6 downloads 0 Views 1MB Size Report
Comment
May 21, 2018 - d Siriraj Center of Research Excellence in Precision Medicine, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand.
Stem Cell Research 30 (2018) 113–116

Contents lists available at ScienceDirect

Stem Cell Research journal homepage: www.elsevier.com/locate/scr

Lab Resource: Stem Cell Line

Derivation of an induced pluripotent stem cell line (MUSIi004-A) from dermal fibroblasts of a 48-year-old spinocerebellar ataxia type 3 patient

T

Alisa Ritthaphaia,b, Methichit Wattanapanitchb, Manop Pithukpakornc,d, Worapa Heepchantreee, Rungtip Soi-ampornkula,b, Panchalee Mahaisavariyaa,f, Daranporn Triwongwaranatf, ⁎ Kovit Pattanapanyasatb,g, Chinnavuth Vatanashevanopakorna,b, a

Department of Biochemistry, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand Siriraj Center for Regenerative Medicine, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand c Department of Medicine, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand d Siriraj Center of Research Excellence in Precision Medicine, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand e Research Department, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand f Department of Dermatology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand g Siriraj Center of Research Excellence for Microparticle and Exosome in Diseases, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand b

A B S T R A C T

Dermal fibroblasts were obtained from a 48-year-old female patient with spinocerebellar ataxia type 3 (SCA3). Fibroblasts were reprogrammed by nucleofection with episomal plasmids, carrying L-MYC, LIN28, OCT4, SOX2, KLF4, EBNA-1 and shRNA against p53. The SCA3 patient-specific iPSC line, MUSIi004-A, was characterized by immunofluorescence staining to verify the expression of pluripotent markers. The iPSC line exhibited an ability to differentiate into three germ layers by embryoid body (EB) formation. Karyotypic analysis of the MUSIi004-A line was normal. The mutant allele was still present in the iPSC line. This iPSC line represents a useful tool for studying neurodegeneration in SCA3.

Resource table.

Unique stem cell line identifier Alternative name of stem cell line Institution

Contact information of distributor

Type of cell line Origin Additional origin info

Cell Source Clonality

⁎

MUSIi004-A EFSCA3-01.1 Department of Biochemistry, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand Chinnavuth Vatanashevanopakorn, [email protected] Human induced pluripotent stem cells Human Age: 48-year-old Sex: Female Ethnicity: Thai Dermal fibroblasts Clonal

Method of reprogramming Genetic Modification Type of Modification Associated disease Gene/locus Method of modification Name of transgene or resistance Inducible/constitutive system Date archived/stock date Cell line repository/bank Ethical approval

Episomal vectors/plasmids No N/A Spinocerebellar ataxia type 3 (SCA3) ATXN3 No No No December 28, 2016 N/A Siriraj Institutional Review Board, Certificate of Approval number Si084/2016, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand.

Corresponding author at: Department of Biochemistry, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand. E-mail address: [email protected] (C. Vatanashevanopakorn).

https://doi.org/10.1016/j.scr.2018.05.012 Received 19 April 2018; Received in revised form 14 May 2018; Accepted 17 May 2018 Available online 21 May 2018 1873-5061/ © 2018 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).

Stem Cell Research 30 (2018) 113–116

A. Ritthaphai et al.

Resource utility

Resource details

The MUSIi004-A iPSC line harbors abnormal CAG repeat expansion in the ATXN3 gene causing spinocerebellar ataxia type 3 (SCA3). The cell line can be used as an effective in vitro model for studying pathogenesis of SCA3.

Human dermal fibroblasts (HDFs) were obtained from a skin biopsy of a 48-year-old woman diagnosed with SCA3, an autosomal dominant neurodegenerative disease caused by a CAG repeat expansion within ATXN3 (Cancel et al., 1995). The HDFs (Fig. 1A) were reprogrammed

Fig. 1. Characterization of MUSIi004-A iPSC line. 114

Stem Cell Research 30 (2018) 113–116

A. Ritthaphai et al.

Table 1 Characterization and validation. Classification

Test

Result

Data

Morphology Phenotype

Photography Qualitative analysis (immunofluorescence)

Normal Expression of pluripotent markers: OCT4, NANOG, SSEA4, TRA-1-60 and TRA-1-81 Percentage of cells positive for pluripotent markers: OCT4-93.61% NANOG - 91.91% 46, XX, resolution 400 Not performed 16 sites tested, all matched Heterozygous, ATXN3 expanded mutant allele and wild type allele Not performed Mycoplasma testing by real-time PCR: negative Expression of three germ layer markers, βIII tubulin, SMA, and AFP, in embryoid bodies. Not performed Not performed Not performed

Fig. 1 panel C Fig. 1 panel F

Quantitative analysis (immunofluorescence counting) Genotype Identity Mutation analysis (if applicable)

Karyotype (G-banding) and resolution Microsatellite PCR (mPCR) STR analysis Gel electrophoresis of PCR products

Microbiology and virology Differentiation potential

Southern Blot OR WGS Mycoplasma Embryoid body formation

Donor screening (optional) Genotype additional info (optional)

HIV 1+2 Hepatitis B, Hepatitis C Blood group genotyping HLA tissue typing

Fig. 1 panel F (representative)

Fig. 1 panel H N/A Available with authors Fig. 1 panel E N/A Supplementary Table 1 Fig. 1 panel G N/A N/A N/A

into iPSCs by nucleofection with episomal plasmids expressing OCT4, SOX2, KLF4, LIN28, hL-MYC, EBNA-1 and shRNA against p53 (Okita et al., 2011). Cells were maintained on Matrigel-coated plate containing media indicated in the schematic representation (Fig. 1B). Three iPSC clones were isolated 33 days after reprogramming. The iPSC line presented here was designated MUSIi004-A (Fig. 1C). Quantitative PCR analysis demonstrated that the MUSIi004-A line was free of mycoplasma (Supplementary Table 1). At passage 26, iPSC line was free of episomal plasmids (Fig. 1D). The MUSIi004-A line carries the ATXN3 mutant allele similar to that of the parental HDFs (Fig. 1E). Immunofluorescence staining showed that the iPSC line expressed pluripotent markers OCT4, NANOG, SSEA-4, TRA-1-60 and TRA-1-81 (Takahashi et al., 2007) (Fig. 1F). Quantification of OCT4-positive cells and NANOG-positive cells was 93.61% and 91.91%, respectively (Table 1). The ability to differentiate into three germ layers was confirmed by embryoid body (EB) formation (Fig. 1G). Expression of the ectodermal marker βIII tubulin, the mesodermal marker smooth muscle actin (SMA) and the endodermal marker alpha-fetoprotein (AFP) was detected (Fig. 1G). In addition, the MUSIi004-A line exhibited a normal karyotype (46, XX) (Fig. 1H). Autosomal short tandem repeat (STR) analysis confirmed the identity of the MUSIi004-A line as compared to the parental HDFs.

N2B27 medium supplemented with 100 ng/ml bFGF for another 4 days. Cells were cultured with Essential 8™ medium (Gibco) from day 15 until iPSC colonies emerged. The iPSC line was routinely cultivated in Matrigel-coated culture plates with Essential 8™ medium at 37 °C with 5% CO2. The iPSCs were subcultured every 4–5 days at 1:8 ratio with 50 mM EDTA in PBS without calcium and magnesium.

Materials and methods

PCR was performed on the Veriti Thermal Cycler (Applied Biosystems) using genomic DNA from the parental HDFs or the MUSIi004-A iPSCs as a template, AXTN3 primers (Table 2) and DreamTaq Green PCR master mix (Thermo Scientific). Primers were designed to amplify the CAG repeat fragment within ATXN3. Cycle parameters were initial denaturation at 95 °C for 3 min, followed by 38 cycles of denaturation at 95 °C for 30 s, annealing at 62 °C for 30 s and extension at 72 °C for 1 min, and a final extension at 72 °C for 10 min. The lower band (205 bp) from gel electrophresis indicated the normal allele (normal number of CAG repeats) while the upper band (382 bp) represented the mutant allele (expanded CAG repeats). Water sample was used as a negative control.

Detection of episomal plasmids Genomic DNA was isolated using PureLink™ Genomic DNA Kit (Invitrogen). PCR was performed on the Veriti Thermal Cycler (Applied Biosystems) with genomic DNA, specific primers to amplify the EBNA1 sequence in the episomal plasmids (Table 2) and DreamTaq Green PCR master mix (Thermo Scientific). Cycle parameters composed of initial denaturation at 95 °C for 1 min, followed by 35 cycles of denaturation at 95 °C for 30 s, annealing at 59 °C for 30 s and extension at 72 °C for 20 s, then a final extension at 72 °C for 5 min. The presence of 206 bp band from gel electrophoresis indicates retention of episomal plasmids within the iPSCs. The episomal plasmid pCXLE-OCT3/4-shp53 and water sample were used as positive and negative controls, respectively. Mutation analysis

HDF isolation and reprogramming HDFs were isolated from a 5-mm skin biopsy from the arm of a 48year-old female SCA3 patient and cultured in fibroblast medium (DMEM with 10% fetal bovine serum (FBS), 0.1 mM non-essential amino acid (NEAA), 2 mM GlutaMAX™, 100 U/ml penicillin/streptomycin and 100 ng/ml amphotericin B, all from Gibco). The reprogramming protocol was adapted from the ThermoFisher Epi5 iPSC reprogramming kit and Lonza's protocol. Briefly, fibroblasts were trypsinized, resuspended in 100 μl P2 4D Nucleofector™ Solution (Lonza) containing the 2.5 μg of each episomal plasmid including pCXLE-hSK (SOX2, KLF4), pCXLE-hUL (L-MYC, LIN28), pCXLE-OCT3/ 4-shp53 (OCT4, shP53) and pCXWB-EBNA1 (Okita et al., 2011). After nucleofection, cells were maintained in Matrigel (BD-Biosciences, 1:40 dilution)-coated 6-well plate containing fibroblast medium supplemented with 10 μM Y-27632 and 0.5 mM valproic acid (VPA) for 1 day before changing to N2B27 medium (DMEM/F12 with HEPES, 1× N2supplement, 1× B27, 0.1 mM NEAA, 2 mM GlutaMAX™ and 0.1 mM 2mercaptoethanol, all from Gibco) supplemented with 100 ng/ml basic fibroblast growth factor (bFGF) and 0.5 mM VPA for 10 days then

Immunofluorescence staining Cells were fixed with 4% paraformaldehyde for 20 min and permeabilized with 0.1% Triton X-100 in PBS for 10 min (for intracellular staining). Cells were incubated with 3% BSA in PBS for 1 h to block nonspecific antibody binding. Cells were incubated with primary antibodies overnight at 4 °C and incubated with secondary antibodies 1 h in the dark at room temperature (Table 2). Nuclei were counterstained with DAPI. Images were visualized with the Eclipse Ti-S microscope (Nikon) 115

Stem Cell Research 30 (2018) 113–116

A. Ritthaphai et al.

Table 2 Reagents details. Antibodies used for immunocytochemistry Antibody - Mouse anti-OCT4 - Mouse anti-NANOG - Mouse anti-SSEA-4 - Mouse anti-TRA-1-60 - Mouse anti-TRA-1-81 - Mouse anti-AFP - Mouse anti-SMA - Mouse anti-βIII tubulin - AlexaFlour488 Goat Anti-Mouse IgG - AlexaFlour568 Goat Anti-Mouse IgG

Pluripotent markers

Differentiation markers

Secondary antibodies

Dilution 1:100 1:500 1:100 1:100 1:100 1:100 1:100 1:100 1:500 1:500

Company cat # and RRID Millipore Cat# MABD76, RRID:AB_10919170 Millipore Cat# MABD24, RRID:AB_11203826 Millipore Cat# MAB4304, RRID:AB_177629 Millipore Cat# MAB4360, RRID:AB_2119183 Millipore Cat# MAB4381, RRID:AB_177638 Millipore Cat# ST1673-100UG, RRID:AB_10693988 Millipore Cat# CBL171, RRID:AB_2223166 Millipore Cat# MAB1637, RRID:AB_2210524 Thermo Fisher Scientific Cat# A-11001, RRID:AB_2534069 Thermo Fisher Scientific Cat# A-11004, RRID:AB_2534072

Primers

Episomal plasmids Mutation analysis Mycoplasma detection

Target

Forward/reverse primer (5′-3′)

EBNA-1 containing plasmids ATXN3 Mycoplasma 16s rRNA

F: ATCGTCAAAGCTGCACAGAG/R: CCCAGGAGTCCCAGTAGTCA F: FAM-CCAGTGACTACTTTGATTCG/R: TGGCCTTTCACATGGATG TGAA F: GGAGCTGGTAATRCCCAAAGTC/R: CCATCCCCACGTTCTCGTAG/Probe: FAM-CCCAGTCACCAGTCCTGCCTTAGGBHQ1

STR analysis

and captured with NIS Elements D 4.20.00 64-bit software. Manual quantification of each pluripotent marker (OCT4 and NANOG) was performed from four image fields, which consist of 6167 and 6455 DAPI-positive cells for OCT4 and NANOG, respectively.

STR analysis was performed at Department of Forensic Medicine, Faculty of Medicine Siriraj Hospital. Genomic DNA of the parental HDFs and the MUSIi004-A iPSCs was amplified with the AmpFISTR® Identifiler® Plus PCR amplification kit (Applied Biosystems) before analysis by capillary electrophoresis. Loci tested were D8s1179, D21S11, D7S820, CSF1PO, D3S1358, TH01, D13S317, D16S539, D2S1338, D19S433, vWA, TPOX, D18S51, AM, D5S818 and FGA.

In vitro differentiation by EB formation Confluent iPSCs were treated with 1 mg/ml Dispase for 30 min. The detached colonies were washed with DMEM/F12 and cultured in SR medium (KO-DMEM, 20% KnockOut serum replacement, 2 mM GlutaMAX™, 0.1 mM NEAA, 0.1 mM 2-mercaptoethanol, 1× insulintransferrin‑selenium and 100 U/ml penicillin/streptomycin, all from Gibco) in Petri dish for 3 days. The EBs were seeded onto 0.1% gelatincoated 24-well plates and cultured in the same medium for another 2 weeks. Medium was changed every other day.

Acknowledgements This research project was supported by the Siriraj Research Fund, Faculty of Medicine Siriraj Hospital, Mahidol University, Grant number (IO) R015933012 and R016033017 and the Thailand Research Fund (TRF) – Distinguished Research Professor Grant, contract no. DPG5980001 and IRG 5980006. MW, MP, DT and CV are supported by Chalermphrakiat Grant, Faculty of Medicine Siriraj Hospital, Mahidol University. AR is supported by Siriraj Graduate Scholarship, Faculty of Medicine Siriraj Hospital, Mahidol University.

Mycoplasma testing Genomic DNA was isolated from the iPSC line using PureLink™ Genomic DNA Kit (Invitrogen). Mycoplasma contamination was detected by quantitative PCR using specific primers and probe (Table 2) to amplify a 113 bp product on the CFX96 real-time system (Biorad). Cycle parameters were activation at 95 °C for 1 min, followed by 40 cycles of denaturation at 95 °C for 2 s, annealing at 60 °C for 30 s and extension at 70 °C for 2 s. Fluorescent signal was acquired at the end of the annealing step. Genomic DNA from known Mycoplasma contaminated hESCs and water were used as positive and negative controls, respectively.

Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.scr.2018.05.012. References Cancel, G., Abbas, N., Stevanin, G., Durr, A., Chneiweiss, H., Neri, C., Duyckaerts, C., Penet, C., Cann, H.M., Agid, Y., Brice, A., 1995. Marked phenotypic heterogeneity associated with expansion of a CAG repeat sequence at the spinocerebellar ataxia 3/ Machado-Joseph disease locus. Am. J. Hum. Genet. 57 (4), 809–816. Okita, K., Matsumura, Y., Sato, Y., Okada, A., Morizane, A., Okamoto, S., Hong, H., Nakagawa, M., Tanabe, K., Tezuka, K., Shibata, T., Kunisada, T., Takahashi, M., Takahashi, J., Saji, H., Yamanaka, S., 2011. A more efficient method to generate integration-free human iPS cells. Nat. Methods 8, 409–412. Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda, K., Yamanaka, S., 2007. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131, 861–872.

Karyotyping iPSCs at passage 10 were treated with colcemid for 1 h to allow metaphase arrest. Karyotyping was performed on 400 G-band resolution chromosome at Research Department, Faculty of Medicine Siriraj Hospital. 25 metaphases were assessed.

116