derived from Atlantic salmon Salmo salar that ... - CyberLeninka

Journal of Fish Biology (2014) doi:10.1111/jfb.12503, available online at wileyonlinelibrary.com

Establishment and characterization of a new cell line (SSP-9) derived from Atlantic salmon Salmo salar that expresses type I if n S. Rodriguez Saint-Jean*, C. González†, M. Monrás†, A. Romero†‡, N. Ballesteros*, R. Enríquez† and S. Perez-Prieto*§ *Centro de Investigaciones Biológicas, CSIC, C/Ramiro de Maeztu 9, 28040 Madrid, Spain, †Instituto de Patología Animal, Universidad Austral de Chile, Valdivia, Chile and ‡Centro FONDAP: Interdisciplinary Center for Aquaculture Research (INCAR), Concepción, Chile (Received 13 February 2014, Accepted 11 July 2014) In the present work, the establishment and biological characterization of a new cell line, SSP-9, derived from the pronephros of the Atlantic salmon Salmo salar, are reported. These cells grew well in Leibovitz’s (L15) medium supplemented with 10% foetal calf serum at temperatures from 15 to 25∘ C, and they have been sub-cultured over 100 passages to produce a continuous cell line with an epithelial-like morphology. The SSP-9 cells attached and spread efficiently at different plating densities, retaining 80% of cell viability after storage in liquid nitrogen. When karyotyped, the cells had 40–52 chromosomes, with a modal number of 48. Viral susceptibility tests showed that SSP-9 cells were susceptible to infectious pancreatic necrosis virus and infectious haematopoietic necrosis virus, producing infectious virus and regular cytopathic effects. Moreover, these cells could be stimulated by poly I:C, showing significant up-regulation in the expression of the genes that regulate immune responses, such as ifn and mx-1. SSP-9 cells constitutively express genes characteristic of macrophages, such as major histocompatibility complex (mhc-II) and interleukin 12b (il-12b), and flow cytometry assays confirmed that SSP-9 cells can be permanently transfected with plasmids expressing a reporter gene. Accordingly, this new cell line is apparently suitable for transgenic manipulation, and to study host cell–virus interactions and immune processes. © 2014 The Authors. Journal of Fish Biology published by John Wiley & Sons Ltd on behalf of The Fisheries Society of the British Isles.

Key words: fish cell line; immune genes; infectious haematopoietic necrosis virus; infectious pancreatic necrosis virus; interferon.

INTRODUCTION Fish-derived cell lines are valuable tools to isolate, culture and study fish viruses, as well as to study toxicology, cellular physiology and gene regulation and expression. Moreover, the use of established and characterized cell lines is generally associated with greater reproducibility in biological research. Teleost cell lines have been developed from a wide range of tissues from different species (Lannan et al., 1984; Chen & Kou, 1988; Nicholson, 1988; Fryer & Lannan, 1994; Wang et al., 2010), although only a few fish cell lines have been derived from haematopoietic tissues or from §Author to whom correspondence should be addressed. Tel.: +34918373112; email: [email protected]

1 © 2014 The Authors. Journal of Fish Biology published by John Wiley & Sons Ltd on behalf of The Fisheries Society of the British Isles. This is an open access article under the terms of the Creative Commons Attribution-NonCommercial License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited and is not used for commercial purposes.

2

S . R O D R I G U E Z- S A I N T- J E A N E T A L.

salmonid leucocytes, such as the SHK-1 cell line from Atlantic salmon Salmo salar L. 1758 macrophages (Dannevig et al., 1997) or TO cells from leucocytes (Wergeland & Jakobsen, 2001), RTS11 from rainbow trout Oncorhynchus mykiss (Walbaum 1792) (Ganassin & Bols, 1998) and the GMLC from goldfish Carassius auratus (L. 1758) (Wang & Belosevic, 1995) or the CLC from carp Cyprinus carpio L. 1758 (Faisal & Ahne, 1990). Establishing new cell lines and their characterization could also provide alternative model systems to study specific mechanisms of viral pathogenesis, and to gain a better understanding of host–virus interactions. Indeed, cell lines of kidney and leucocyte origin provide useful models to study immunological responses and associated gene expression in the field of host–pathogen interactions. Thus, in an attempt to broaden the spectrum of the long-term cell lines derived from haematopoietic tissue that can be used to develop additional types of immune-response assays, kidney pronephros tissue from S. salar fish was cultured. Here, the derivation and characterization of this new cell line, designated as SSP-9, are described.

MATERIALS AND METHODS CELLS The SHK-1 cell line and SSP-9 cells were grown at 20∘ C in L-15 medium supplemented with foetal calf serum (FCS, 10% v/v), L-glutamine (4 mM) and gentamicin (50 μg ml−1 ). The cells were sub-cultured by standard procedures using 0⋅25% trypsin and 0⋅02% EDTA diluted in phosphate-buffered saline (PBS). All cell culture reagents were obtained from GIBCO (Life Technologies S.A.; www.lifetechnologies.com). RTS-11 cells are non-adherent, macrophage-like cells derived from the spleen. These cells are cultured similarly to the SHK-1, except for the higher FCS concentration of 20%. Oncorhynchus mykiss leucocytes (K cells) were used as controls and they were isolated from the head kidney of non-vaccinated fish using a Percoll gradient, as described elsewhere (Carrington et al., 2004). E S TA B L I S H M E N T O F T H E S S P- 9 C E L L L I N E : P R E PA R AT I O N A N D C U LT U R E The pronephros from several S. salar (mean ± s.d. body mass = 20 ± 3 g) were used, selecting only fish that appeared to be healthy, with no signs of infection or disease. Fish were sacrificed with an overdose of benzocaine (Sigma-Aldrich; www.sigmaaldrich.com) and the absence of viruses was confirmed by standard isolation methods, inoculating RTG-2 cells with pooled organ homogenates. The selected kidney tissue was collected under sterile conditions and gently pushed through a nylon mesh (100 μm pore size) in L-15 medium containing 2% FCS and 10 U ml−1 of heparin (Sigma-Aldrich). The resultant suspension was layered onto 3 ml of Histopaque 1077 (Sigma-Aldrich) in sterile plastic tubes and after centrifugation at 400 g for 30 min at room temperature, the thin opaque band of cells was collected with a capillary pipette. The cells were washed twice in L-15 medium and suspended in cell growth medium: L-15 supplemented with 20% FCS and 100 U of penicillin, 100 μg ml−1 of streptomycin and 50 μg ml−1 of gentamicin. The cells were counted and seeded (4 × 106 cells) in 25 cm2 tissue culture flasks, and then incubated for 24 h at 20∘ C. After attachment, the excess fluid was removed from the flask and cell culture growth medium was added. The cultures were incubated at 20∘ C and inspected daily. Cell growth was monitored, noting the appearance of cell colonies and any increase in their size on an inverted microscope (Olympus; www.olympus.es). Fresh medium was added weekly until cell monolayers had developed.

© 2014 The Authors. Journal of Fish Biology published by John Wiley & Sons Ltd on behalf of The Fisheries Society of the British Isles. 2014, doi:10.1111/jfb.12503

S S P- 9 C E L L S D E R I V E D F R O M S A L M O S A L A R

3

S E R I A L PA S S A G E O F S S P- 9 C E L L S Once the cells had formed a monolayer, the cell sheets were digested in trypsin-EDTA solution (GIBCO) and transferred to a flask in 5 ml of fresh growth medium. The cell suspension was distributed into two 12⋅5 cm2 flasks and incubated at 20∘ C. Subsequently, the cells were sub-cultured at 1:2 or 1:3 every 7 days. C O L O N Y F O R M AT I O N The plating efficiency of SSP-9 cells was tested at passage 10. Cells were diluted in growth medium and seeded in triplicate in 12⋅5 cm2 flasks at densities of 1000 and 2000 cells by flask. The cells were incubated at 20∘ C, left undisturbed for 21 days and then stained with May–Grünwald stain. The colonies were counted on an inverted microscope and the plating efficiency (EP , %) was calculated using the following formula: EP = 100 N CC N CS −1 , where N CC is the number of cell colonies and N CS is the number of cells seeded (Freshney, 1994; Zhao et al., 2003). C H R O M O S O M E A N A LY S I S Chromosome preparations from the cultured cells were obtained as described elsewhere (Chen et al., 2005) and karyotypes were obtained for 75 chromosome spreads on five slides. S P E C I E S AU T H E N T I C AT I O N The species origin of the SSP-9 cell line was confirmed following the guidelines of the Consortium for the Barcode of Life (CBOL; http://barcoding.si.edu/), an international initiative that recommends the use of a very short genetic sequence from a standard part of the genome to identify species. The first 648 bp of the cytochrome C oxidase (coI) gene of the mitochondrial DNA coI subunit I gene contains substantial interspecies variation, with remarkably low intraspecies variation in most animals (Hebert et al., 2003). In the present work, the species origin of the SSP-9 cell line was confirmed by polymerase chain reaction (PCR) amplification of the coI as described elsewhere (Dalvin et al., 2010). DNA was extracted from the SSP-9 cell line at passage 50 using the DNeasy kit (Qiagen; www.qiagen.com) and PCR was carried out in a geneAmp PCR system (Perkin-Elmer Cetus; www.perkinelmer.com), using the SS76 and SS08 primers and the cycling conditions described in Table I. C E L L G R O W T H AT TA C H M E N T A N D P R O L I F E R AT I O N Cell proliferation experiments were carried out using a real-time cell analyser (RTCA) single plate (SP) apparatus (xCELLigence System, Roche Applied Science; www.roche-as.es). By measuring electrical impedance across inter-digitized microelectrodes integrated into the bottom of tissue culture E-Plates, this system monitors cellular events in real time without the need for cell labelling. Each individual well of a specific 96-well microtiter plate (E-Plate View 96) contains a gold sensor electrode array that allows cells to be monitored. The impedance across the electrodes is measured in real time, providing sensitive, immediate detection of the cell’s conditions and responses from wells containing that may contain few cells or that are at confluence. The changes in impedance detected by the system as a result of the presence of cells are expressed as a cell index (I C ). This detection method is proportional to both cell number and morphology, as increased cell spreading is also reflected by a higher I C . When using such a system, the basal I C value must first be registered with the medium alone, before adding the cells (Limame et al., 2012). For real-time cell analysis, 100 μl of growth media (L15 + 10% FCS) was added to each well of the E-Plate view 96 to obtain background readings. A sequential 1:1 dilution of 5000–40 000 cells per well was seeded in 100 μl of media in the E-Plate View 96 (four wells per sample) and the E-Plates were incubated for 30 min at room temperature before they were placed on the RTCA SP Station located in the cell culture incubator. Cell attachment, spreading and proliferation were monitored every 30 min using the RTCA SP apparatus and


mhcII-F mhcII-R

IL-12F IL-12R IFN-1F IFN-1R mx1-F mx1-R EF-F EF-R SS76-F SS76-R

mhc-II

il-12

G1 G3

ihnv-g

ipnv-vp2

SS08-F SS08-R V1 V2

ssacoI208

ssacoI076

ef-1𝛼

mx-1

ifn-1

Primer name

Genes

ATTCTGTGGGAAACAGTG TGATACATGGGGATACTC

ATCGGGGCCCCCGACATA GAAAGGAGGGAGGGAGAAGTCAAAAA ATGAATTCGAACCCCCAGGACAAGT GCGAATTCTGATTGGTCTGAGCACGC

ATGTGGTTACGGGAGGC ATGTGGTTACGGGAGGC AAAACTGTTTGATGGGAATATGAAA CGTTTCAGTCTCCTCTCAGGTT AGCTCAAACGCCTGATGAAG ACCCCACTGAAACACACCTG GATCCAGAAGGAGGTCACCA TTACGTTCGACCTTCCATCC CCAGCCTGGCGCCCTTCTG AAGGCATGGGCTGTAACAATTACGTT

ACACCCTTATCTGCCACGTC TCTGGGGTGAAGCTCAGACT

Primer sequence 5′ –3′

753 bp

613 bp

71 bp

63 bp

AF498320

NM_001171901

NM_001124531

AJ548830.1

AJ25143260

Accession number or product size

Table I. List of primer pairs designed for gene expression analysis

40× 94∘ C 30 s, 53∘ C 30 s

30× 94∘ C 30 s, 62∘ C 30 s

40× 95∘ C 10 s, 60∘ C 1 min

40× 95∘ C 30 s, 60∘ C 1 min

Cycling conditions

4 S . R O D R I G U E Z- S A I N T- J E A N E T A L.


S S P- 9 C E L L S D E R I V E D F R O M S A L M O S A L A R

5

the effects of different concentrations of FCS (5, 10 and 15%) on the growth of SSP-9, or on cells infected with infectious pancreatic necrosis virus (IPNV), were recorded. The impedance recordings from the cells in each individual well of the E-Plate View 96 were automatically converted to I C values by the RTCA Software. The I C is a quantitative measure of the cell number in a well and it represents a relative change in the measured electrical impedance to reflecting the cell status. All the data were recorded at 1, 6 and 24 h.

C E L L C RY O P R E S E RVAT I O N The capacity of SSP-9 cells to withstand freezing in liquid nitrogen (−196∘ C) was determined, changing the medium 24 h before freezing and replacing 50% of the volume with fresh medium. The cells were then disaggregated and after centrifugation at 800 g for 5 min, the cell pellet was resuspended at a density of 5 × 106 cells ml−1 in ice-cold medium containing 20% FCS, antibiotics and 10% dimethyl sulphoxide (DMSO, Merck; www.merck.es). The cell suspension was aliquoted into cryovials (1 ml: Nunc, Sigma-Aldrich), which were frozen (Nalgene; www.nalgeneiberia.com) and stored at −70∘ C overnight before they were transferred to liquid nitrogen. The viability of the cells was assessed after 3 months storage by recording the proliferation of the cells over 6 h. V I R A L S U S C E P T I B I L I T Y A N D V I R A L R E P L I C AT I O N EFFICIENCY The susceptibility of the SSP-9 cells to salmonid viruses was determined, such as the birnavirus IPNV and the rhabdovirus infectious haematopoietic necrosis virus (IHNV). SSP-9 cells grow well at temperatures from 15 to 25∘ C and they were habitually propagated at 20∘ C. Viruses were cultured as described previously (Alonso et al., 2003), and SSP-9 cells at passage 50 were seeded in 24 well plates, grown to 70% confluence and incubated for 24 h at 20∘ C. After removal of the medium, the cell culture was inoculated with 0⋅1 ml of the virus suspension at a multiplicity of infection (MOI) of 0⋅1, which was allowed to adsorb for 1 h at 20∘ C (for IPNV) or 15∘ C (for IHNV). Subsequently, 0⋅9 ml of maintenance medium, containing 2% FCS, was added, and the cultures were incubated for 72 h. The appearance of a cytopathic effect (CPE) was assessed daily, with 1 ml of tissue culture fluid being collected from the wells 1, 2 and 3 days after viral inoculation. These samples were assayed for viral titres by the end-point 50% method (tissue culture infective dose, TCID50 ml−1 ) adapted from Reed & Muench (1938); the data from a reverse transcriptase (RT)-PCR and the sequence of the segments amplified were recorded to confirm the identity of the viruses amplified (Alonso et al., 1999); the sequence analysis was developed at the Sequencing Service of the CIB Centre (Secugen-CSIC). The CPE of IPNV, which restricted the proliferation of the infected cell population, was also recorded using the real-time xCELLigence system. CELL TRANSFECTION To determine the suitability of SSP-9 cells for transfection, the pAcGFP1-1 plasmid (Clontech, www.clontech.com) with the cytomegalovirus promoter, that encodes the green fluorescent protein (GFP), pAcGFP1-VP2, pAcGFP1-G gene (from IHNV) and the pcDNA-VP2 plasmid described previously (de las Heras et al., 2009) were used. Briefly, the cells were seeded in 70–80% confluent SSP cells growing on coverslips in 24 well plates at 80% confluence (5 × 105 cells per well) and transfected for 48 h with the plasmid (1 μg) along with the fuGENE HD transfection reagent (Roche Molecular Biochemicals). Green fluorescence was observed on an Epifluorescence microscope (Zeiss Axioplan; www.zeiss.es) coupled to a CCD digital camera Leica DFC 350 FX (www.leica-microsystems.com). In parallel, the transfected SSP-9 cells were detached with trypsin, suspended in PBS and examined in a flow cytometer (EPICS XL, Coulter; www.beckmancoulter.com). In each histogram, the y-axis represents the relative number of cells emitting a particular fluorescence intensity and the x-axis is divided into 256 channels, representing the levels of fluorescence. A predefined background fluorescence is defined by the negative controls and used to set the


6

S . R O D R I G U E Z- S A I N T- J E A N E T A L.

threshold on the immunofluorescence histogram (bar) above which cells are considered positive for antibody binding. Untreated cells and cells transfected with the pcDNA-VP2 plasmid and incubated with an irrelevant antibody were stained by indirect immunofluorescent assay (IFA) and used as negative controls to determine the background fluorescence. The cells transfected with the pcDNA-VP2 were stained (after three successive passages) with specific anti-IPNV antiserum and processed by IFA to detect the IPNV-VP2 protein, as described previously (de las Heras et al., 2009).

K I N E T I C S O F I N T E R F E R O N E X P R E S S I O N I N S S P- 9 A N D OT H E R C E L L L I N E S SSP-9, RT-S11 and SHK-1 cells were seeded at a concentration of 1 × 105 cells per well in 24 well culture plates, and 1 day later they were stimulated with poly I:C (10 μg ml−1 ) and then incubated at 20∘ C (control cells were treated similarly without receiving poly I:C). Several hours after stimulation, the cells were harvested for RNA isolation by the Trizol method and the expression of type ifn-1 mRNA was determined by quantitative reverse transcriptase (qRT)-PCR, as described previously (de las Heras et al., 2009; Ballesteros et al., 2012). Three parallel samples were harvested at each time point and all qPCRs were performed in triplicate. The mRNA expression of each gene was expressed relative to the endogenous control (elongation factor 1-𝛼; ef-1𝛼) and with respect to the empty pcDNA plasmid for some samples using the formula 2−ΔΔCt (Livak & Schmittgen, 2001), where ΔΔCt = ΔCt of the samples of the target gene −ΔCt of the calibrator (pcDNA control). Table I shows the primer sequences used and the thermal profile designed for qRT-PCR. G E N E E X P R E S S I O N A N A LY S I S : M H C I I A N D I L 1 2 B K I N E T I C S I N S S P- 9 A N D O T H E R C E L L L I N E S Several co-stimulatory molecules have recently been described in O. mykiss, such as the mhcII and il-12p40, and they can be considered as markers of antigen-presenting cells (APCs). The ability of SSP-9 cells derived from haematopoietic tissue to express these genes was studied as described previously (Chaves-Pozo et al., 2010; Ballesteros et al., 2012), and the primers and conditions used are detailed in Table I. S TAT I S T I C A L A N A LY S I S Prior to performing the statistical analyses, the normal distribution of the data was checked and confirmed using the Shapiro–Wilk test. An appropriate statistical t-test was also used to compare some paired samples and to determine the differences between the experimental groups. All statistical analyses were performed using SPSS Version 15 (www.ibm.com/spss-statistics) and P values