Design of Constructs for the Expression of Biologically Active ...

‘rHE JOURNAL OF BIOLOGICAL CHEMISTRY ( 0

Vol. 266, No. 21, Issue of July 25, pp. 13726-13730, 1991 Printed in U.S.A.

1991 by The American Society for Biochemistry and Molecular Biology, Inc.

Design of Constructs forthe Expression of Biologically Active Recombinant Human FactorsX and Xa KINETIC ANALYSIS OF THE EXPRESSED PROTEINS* (Received for publication, January 10, 1991)

David L. Wolf#$j,Uma Sinha$,Tom E. HancockS, Pei-Hua Lin$, Terri L. Messiern, Charles T. Esmonll **, and William R. Churchll From $COR Therapeutics, Znc., South San Francisco, California 94080, 11 Howard Hughes Medical Institute, Departments of Pathology and Biochemistry, University of Oklahoma Health Sciences Center, and the Section of Cardiovascular Biology, Oklahoma Medical Research Foundation, Oklahoma City, Oklahoma 73104, and the VDepartment of Biochemistry, University of Vermont College of Medicine, Burlington, Vermont 05405-0068

Activation of vitamin K-dependent plasma proteases ent carboxylase. Calcium ion and phospholipid binding by occurs by specific interaction with componentsof the factor Xais a direct consequence of light chain carboxylation blood coagulation cascade. In this report, we describe (2). the direct expression and enzymatic characterization The extrinsiccoagulation pathway, composed of tissue facof the human coagulation zymogen factor X and its tor and factor VIIa, and the intrinsic pathway, consisting of activated form, factor Xa, from transformed Chinese factors IXa and VIIIa, catalyze the proteolytic activation of hamster ovary fibroblast cell lines. Expression was factor X to its active species, factor Xa (1).Both pathways achieved using eithera full-length factorX cDNA or a require calcium-dependent complex assemblyon phospholipid unique mutant factor Xa cDNA. The functional factor membranes. Factor X is also activated in vitro by a factor X Xa precursor contained a novel tripeptide bridge in place of the native 52-amino acid activationpeptide. activator isolatedfrom Russell’s viper venom (RVV)’ (3). Proteolytic cleavage at Arg234-Ile235 and release of a 52-amino This mutation allowed for intracellular processing and acid activation peptide from the amino terminus of the heavy secretion of the activated form of factor X. Secreted recombinant factorsX (rX) andXa (rXa) were purified chain lead to the formation of the active enzyme, factor Xa. The catalytic site of factor Xa is located on the heavy chain bysequentialanion-exchangeandimmunoaffinity chromatography. The enzymatic activities of factors ( 3 , 4 ) . Factor Xa formsa macromolecular complex with factor Va r X and rXa were compared with thoseof plasma factors X and Xa in three independent assay systems. In on negatively charged phospholipid surfaces. This complex comparison to human plasma factor X, the amidolytic, catalyzes the activation of prothrombin to thrombin, an improthrombinase complex, and plasma clotting activi- portant enzyme that elicits both pro- and anticoagulant reties of factor rX were 50, 85, and 43%, respectively. sponsesduring cardiovascular trauma (1).FactorXa also The corresponding comparative activities for factor forms a ternary complex with factor VIIa and a lipoproteinrXa were 32,64, and 48%, respectively. The ability to associated coagulation inhibitor ( 5 , 6 ) .Formation of the factor directly express mutant forms of biologically active Xa-lipoprotein-associated coagulation inhibitor-factor VIIa human factor X will facilitate the structure/function complex has been shown to inhibit the extrinsic coagulation analysis of this important blood coagulation protein pathway. and may lead to thedevelopment of novel coagulation One approach for the structure/function characterization inhibitors. of topographical sites on factors X and Xa could be accomplished by site-directed mutagenesis. In this report, we describe the direct expression in Chinese hamster ovary (CHO) Factor X, a vitamin K-dependent blood coagulation glyco- cells of recombinant human factorsX (rX) and Xa (rXa) and factors. This protein, is the precursor for factor Xa, theenzyme component compare theirbiological activities to the plasma approach demonstrates a strategy for intracellular zymogen of the prothrombinase complex (1).In plasma, factor X circulates as a zymogen in the form of a two-chain polypeptide activation and establishes the foundationfor a more systemconsisting of a 17-kDa light chain joined by a disulfide bridge atic analysis of this important coagulation enzyme. t o a 45-kDa heavy chain. During biosynthesis, a number of EXPERIMENTALPROCEDURES post-translational processing events occur (1, 2). These include endopeptidic cleavage, glycosylation, and conversion of Materials-Menadione sodium bisulfite, p-nitrophenyl p’-guaniselect glutamic acid residues in the amino terminus of the dinobenzoate HC1, bovine brain phosphatidyl serine, hen egg phoslight chain toy-carboxyglutamic acid by a vitamin K-depend- phatidylcholine, rabbit brain cephalin, bovine factor X- and VII/Xdeficient plasma,and bovine serumalbumin were obtained from Sigma. Chromogenic substrates 2,2-azinodi(3-ethylbenzthiazolinesulHL44782-01 (to D. L. W.), HL29807-10 (to C. T. E.), and HL35058 fonic acid), Chromozym X (N-methoxycarbonyl-D-norleucylglycylarand HL040467 (to W. R. C.). The costs of publication of this article ginyl-4-nitranilideacetate),and Chromozym T H (tosylglycylprolylarwere defrayed in part by the payment of page charges. This article ginylMnitranilideacetate); M13mp19, and allDNA-modifying enmust therefore behereby marked “advertisement” in accordance with zymes were purchased from Boehringer Mannheim. Human factor 18 U.S.C. Section 1734 solely to indicate this fact. The abbreviations used are: RVV, Russell’s viper venom; CHO, To whom correspondence should be addressed COR TherapeuChinese hamster ovary; SDS-PAGE, sodium dodecyl sulfate-polytics, Inc., 256 E. Grand Ave., Suite 80, S. San Francisco, CA 94080. acrylamide gel electrophoresis. ** Investigator of the Howard HughesMedical Institute.

* This work was supported by National Institutes of Health Grants

13726

Humanand Factor X X-deficient plasma, human antithrombin 111, and human prothrombin were obtained from American Bioproducts Co. Human factors X, Xa, Va, and human a-thrombin; andpurified RVV factor X activator were purchased from HaematologicTechnologies. Human andbovine factors X were also isolated as described (7). Lipofectin reagent and G418-neomycin were from Bethesda Research Laboratories-GIBCO. Coagulation reagents thromboplastin C (composed of rabbit brainderived thromboplastin) and actin FS (composed of soy phosphatides in ellagic acid) were from Baxter. All reagents were of analytical grade. Construction of Human Factor X and Xu-expressing Cell LinesT h e HindIII-XbaI fragmentof plasmid Bluescript containing the fulllength human factor X cDNA (8) was subcloned into the HindIIIXbaI siteof m13mp19. Oligonucleotide site-directed mutagenesiswas performed as described by Kunkel et al. (9) utilizing the following oligomer: 5”ACCCTGGAACGCAGGAAGAGGCGGAAAAGAAT CGTGGGAGGCCAGGAATGC-3’. The mutagenesis was composed of deletion of the activation peptide and duplication of the tripeptide cleavage site (Fig. 1). Sequence verification of the mutagenesis was performed by dideoxy chain termination nucleotide sequencing (10). The SmaI-EcoRV fragments of the modified factor X cDNA was subcloned into the XbaI site of the expression vector pBN following treatment with Klenow polymerase (11).The expression vector pBN was derived by subcloning the SR-a promoter (12) obtained from p B J l (13) into the NruI-XbaI site of pRC/CMV, thus replacing the CMV promoter with the SR-a promoter. CHO-K1 cells (obtained from the University of California Cell Culture Facility) were grown in RPMI 1640 medium supplemented with 10% fetal bovine serum, 50 mg/ml penicillin/streptomycin, 2 mM glutamine, and 4pg/ml vitamin K,. The factor X expression vectors pBNX and pBNXa were transfected into CHO cells by the method of lipofectin reagent DNA uptake (14). Transfected cells were selected for G418-neomycin resistance, and individual clones were isolated and screened at equal cell density for high level expression in serum-free medium. Factor X antigen was assessedusing an enzyme-linked immunosorbent assay for factor X (15) andby immunoblotting (15). Factor Xa activitywas as described below. determined usingChromozymXhydrolysis Serum-free medium, bovine and human factors X, and the human factor Xa were used as controls. Purification of Factors rX andrXa-Recombinant factor X- or XaexpressingCHO cells were grown to confluency in roller bottles. Following multiple washing of the cells with serum-free medium, the cells were cultured for consecutive 24-h periods at 37 “C in serumfree medium supplemented with 4pg/ml vitamin KB. Conditioned medium was centrifuged a t 15,000 X g; for 20 min, followed by filtration of the supernatant througha 0.2-pm filter. To themedium was added Tris-HC1 (pH 7.5) to 20 mM and NaEDTA to 10 mM, followed by chromatography ona Q-Sepharose Fast Flow column (PharmaciaLKB BiotechnologyInc.). All chromatographicsteps were performed a t 4 “C. The column was washed extensively with 20 mM Tris-HC1(pH 7.5), 10 mM EDTA, 0.15 M NaC1; andbound proteins were eluted with 20 mM Tris-HC1 (pH 7.5), 0.5 M NaC1, 5 mM CaC12. Peak fractions were pooled and either storeda t -20 “C or applied directly to an anti-factor Xmonoclonal antibodyaffinity column asdescribed previously (16).The particular antibodyused for isolation (aHFX-ld) isspecific for human factor X,is not influenced by Ca“, and binds both factors X and Xa.’ Recombinant factor Xa waspurified furtheron a benzamidine-Sepharosecolumn(Pierce Chemical Co.) as described by Krishnaswamy et al. (7). The concentrations of the recombinant proteinswere determined by quantitative enzyme-linked immunosorbent assay; colorimetric protein assay (bicinchoninicacid) (15); andabsorbancemeasurements a t 280 nm using extinction coefficients and molecular masses of 11.6 and 58.9 kDa for factor X (17)and 11.6 and 46 kDa for factorXa(18), respectively. SDS-polyacrylamide gel electrophoresis(SDS-PAGE) was performed as described by Laemmli (19), and the proteins were visualized by silver staining (15). Amino-terminal protein sequence analysis was performed using an Applied Biosystems Model 473A protein sequenator as described by Matsudaira (20). Approximately 4-8 residues were determined for each peptide. Amino acid sequence numbering of factor X is based on the single-chain precursor form and begins with the initiation methionine of the light chain signal sequence (8). Functional Analysis of Factors rX and rXa-Plasma factor X and factor rX were activated by incubation with RVV for 15 min atroom temperature a t a protease/protein ratio of 1:lOO (w/w) in 20 mM Tris-

’ W. Church, unpublished data.

X a Expression

13727

HCl (pH 7.5), 0.15 M NaCI, 5 mM CaC12,0.1%bovine serum albumin. Under these conditions, maximal factor X activation was found to occur. The samples were placed on ice and used within 1 h following activation. Amidolytic activity of factor Xa toward Chromozym X (50-500 p ~ was ) determined by following increments of absorbance a t 405 nm due to peptide nitroanilide hydrolysis. Assays were carried out a t room temperature using a V,,, plate reader (Molecular Devices). Initial rates of substrate hydrolysis were determined in 20 mM Tris-HC1 (pH 8.0), 0.15 M NaCl, 5 mM CaC12,0.1% bovine serum albumin. The kinetic constants (kc,, and K,) were determined by nonlinear regression analysis using Michaelis-MentenEquations (Enzfitter, Elsevier Scientific Publishing Co., Inc.). Duplicate measurements were averaged for each analysis, and the reported data (Table I) represent the average of three to eight separate determinations. The ability of factor Xa to activate prothrombin in the presence of factor Va, Ca”, and synthetic phospholipid vesicles was determined by measuring the product of the activation, a-thrombin (21). Both human plasma factor X and factor rX were activated by RVV prior to assaying in the prothrombinase complex. The reaction mixture consisted of 0.5-1.5 nM factor Xa, 7.5 nM factor Va, 20 p M phosphatidylcholine (75%)/phosphatidylserine(25%) in20 mM Tris-HC1 (pH 7.5), 0.15 M NaCl, 5 mM CaCl,, 0.1% bovine serum albumin. Reactions were carried out a t room temperature and initiated by adding prothrombin to the reaction mixture. Aliquots were removed at various times and assayed directly for the productionof thrombin. A standard curve of a-thrombin concentration as a function of Chromozym T H hydrolysis was used to estimate the amount of thrombin generated. For determination of steady-state kinetic constants, the concentra0.2 and 1.5 p ~ Kinetic . tion of prothrombin wasvariedbetween a nonlinear regression constants were calculated from the data using analysis (Enzfitter) of the initial rates of thrombin formation and assuming Michaelis-Menten type kinetics. The reported data (Table I) represent the average of three to five separate determinations. Functional clotting activities of factors rX and rXa were determinedusing an MLAElectra 800 fibrometer.Threeassays were where the clotting performed (i)a two-stage prothrombin time assay, time was determined after addition of bovine factors VII- and XCa’+ todilutions of deficientplasma,rabbitbraincephalin,and purified plasma or recombinant factors Xa or X preincubated with purified RVV; (ii) an activated partial thromboplastin time assay, which wasperformed using eitherbovine factors VII- and X-deficient plasma or human factor X-deficient plasma, and actin FS; and a(iii) factor X-dependent prothrombin time assay, which was performed using human factor X-deficient plasma and reagent thromboplastin C. Clotting assays were performed in duplicate and repeated two to three times, and the activities of factors rX and rXa were interpolated from standard clotting curves of purified human factors X and Xa accordingly. Active enzyme content was quantified as follows. The concentration of human a-thrombin was determined by active-site titration employingp-nitropheny1p’-guanidinobenzoate HCl(22). This standard a-thrombin preparation was then used to calibrate a reference solution of human antithrombin 111 (23). Accordingly, human antithrombin 111 titrations of plasma and recombinant human factorsX and Xa, based on inhibition of amidolytic activity (see above), were performed assuming a 1:l stoichiometry for protease inhibitor (24). RESULTS

Plasma coagulation proteins are unique because of their requirement for several intracellular post-translational modifications includingproteolysis of the signal peptide and propeptide (Fig. 1, arrows 1-2); y-carboxylation of glutamate residues in the light chain;and, as in the case of factor X and protein C, intramolecularcleavage of the single chain precursor to the two-chain form (1,2). During synthesis, proteolytic cleavage of the factor X precursor also occurs at Arg’79-Ser1R” Ile~~~ (Fig. 1, arrows 3-4) (8, 18,26). Cleavage a t A ~ - p - results in activation (Fig. 1, arrow 5 ) . Following zymogen activation, it is suggested that factor Xaundergoes autoproteolysis, possibly a t Arg464-Ser465 (Fig. 1, arrow 6) (3, 26). The net effect of this cleavage on factor Xa enzymatic activity is unknown at present. Signal sequence cleavage most likely occurs at LeuZ3-Serz4 (Fig. 1,arrow 1 ). To combine the intracellular and

Human Factor X and X a Expression

13728

489aa

179aa 183aa 235aa Chaln

rX

Llght

PrePro

t3 t4

2

1

I aa

rX a

Llght

t3

2

6

489aa

I

RKRRKR-

t

1

t

5

I

PrePro

t

t

Ls-s 1-

41aa I

Chaln

Heavy Chaln

A.P.

! 5

Chaln

Heavy

t 7

t6

FIG. 1. Recombinant human factor X constructs. Deletion mutagenesis of the human factor X activation peptide was performed as described under "Experimental Procedures." rX and rXa refer to the relevant domain arrangement of the recombinant human factor X and Xa precursors. The prepro leader sequence (PrePro),light chain, activation peptide( A . P . ) ,and heavy chain are shown. The sequence modifications to the activation peptide of recombinant human factor Xa are denoted. Amino acid ( a a ) positions are designated. Arrows denote positions of the known proteolytic cleavage sites.

1

2

3

w

-

kDa

- 97 - 68 - 43 -29

d

- 18.4 FIG. 2. SDS-PAGE analysis of recombinant human factors X and Xa. Factors rX and rXawere purified by anion-exchange and immunoaffinity chromatography. Analysis was made under reducing conditions. Lone 1, 1 pg of plasma factor X; lane 2, 1 pg of RVVderived plasma factor Xa; lane 3, 1 p g of factor rX; lane 4 , 1 pg of lactor rXa.

vascular processing events that lead to factor X activation into one step, we attempted to express factor X cDNA constructs based on: 1) deletion of the activation peptide and2) joining of the light andheavy chains by minor modifications of the Arg'"'-Ser'':' intrapeptide cleavage sites. This report details the expression and enzymatic characterizationof factor rX anda novel factor, rXa, derived by cellular processing of a unique monomeric precursor. Human factor X cDNA constructs were transfected into CHO cells, subcloned, and selected for G418-neomycinresistance (Fig. 1).Factor X antigen produced by the transfected stable producingclones was determined byenzyme-linked immunosorbent assay and immunoblotting.Antigen levels averaged -1 pg/ml for 24-h cultures for both factors rX and rXa. Factors rX and rXa were purified as described above (see"Experimental Procedures").Homogeneity of purified factors rX and rXa was determined by SDS-PAGE (Fig. 2). Factor rX(Fig. 2, lune 3 ) under reducing conditions had three polypeptides, a t 75, 45, and 22 kDa. The 45- and 22-kDa species corresponded in migration distance to plasma factor X heavy and light chains (Fig. 2, lune I), and the 75-kDa species is similar in size to the putativesingle chain factor X observed previously in transfected COS-1 cells (8), HepG2 human hepatoma cells (27), and plasma (27). The factor rX precursor monomer content was estimatedto be26% by scanning autoradiographs of immunoblots (data not shown). Purified factor rXa had a more complex pattern, with polypeptides at 43, 35, 31, and 22 kDa. Additional silver-stained peptides were observed a t -17 kDa (Fig. 2, lune 4 ) . The 35and 31-kDa species corresponded to factorXa,, and Xa,+heavy

chains (Fig. 2, lunes 2 and 4 ) , and the species at 22 kDa corresponds to the light chainof factor X (3, 26). Amino-terminal sequence analysis of the polypeptides was performed following electrotransfer to nylon filters (20). For factor rX, the sequence of the 45- and 22-kDa species corresponded to theexpected factor X heavy and light chain amino acid sequences (8). The light chain sequence was heterogenous, with27% initiating a t Val:" and 73% initiating at Ala"'. The 75-kDa species gave the expected sequence forthe factor X light chain, confirming its identity as theuncleaved single chain factor X precursor, with 41% initiating a t Val'' and 59% initiating a t Ala"'. The data suggest that single chain factor rX is correctly cleaved a t Arg1x'2-Ser1x:' during processing. However, sequencing of the carboxyl terminus of the light chain was not performed, and the accuracy of cleavage at ArgIi"Arg180 could not be confirmed. In the factor rXa preparation, sequences for the 35- and 31-kDa species corresponded to the activated plasma factor X heavy chain amino-terminal sequence, and thesequence of the 22-kDa species was comparable to that of the factor rX light chain sequence, with 29% initiating a t Val:'' and 71% initiating a t Ala"'. The 43-kDa species did not give reliable amino acid sequence by this procedure. The minorsequences (17 kDa) suggested that proteolytic cleavages had occurred at Ar~"-Gln:":{ and Lys:'7X-Met''i"(Fig. 1, arrow 7). Protease inhibitors such as benzamidine or soybean trypsin inhibitor were not used during purification. This could account, inpart, for the observed endopeptidic cleavage of the heavy chain by factor Xa andpossibly by secreted CHOproteases. The enzymatic activity of factor rX following activation with RVV was compared with that of RVV-activated plasma factor X (Table I). SDS-PAGE and immunoblot analysis of RVV-activated factor rX demonstrated that thesingle chain precursorcontent did notchange significantly (datanot shown). Thereduced RVV sensitivity of the factor rX single chain precursor suggests that its participation in the enzymatic activity of factor X in vitro as well as its possible role in vivo are minimal. The catalyticefficiency ( kcal/K,,,)of factor rX was 50% of that of plasma factor X in the amidolytic assay. This was due to a decrease in kc,, and only a slight difference in K,, for recombinant versus plasmafactor X. Factor rXa, generated by activation of factor rX with the venom activator and assayed directly without further purification, cleaved prothrombin in the presence of factor Va, phosphatidylcholine/phosphatidylserine vesicles, and Ca'+

13729

Human Factor X and X a Expression TABLEI

of factors rX and rXa are comparable to plasma factors and Xa.

Factor X-dependent enzymatic activity Factor

kcat

K"?

k,st/Krn

.s"

PM

s"/pM

X

DISCUSSION

This report describes the expression and characterization of CHO-derived human factors X and Xa. The method chosen to express factor rXa entaileddeletion of the activation peptide and duplication of the tripeptide cleavage site (Fig. 1). 0.6 The modification did not significantly affect the biosynthesis or post-translational processing of the novel precursor. Since 17.4 factor rXa is capableof being processed in other mammalian 14.8 35.2 cell lines (data not shown), it seems likely that proteolytic 22.6 cleavage sites, based on minor modifications of native seFactor 2PT' activity APTT activity PT activity quences, canbe engineered into proteins with some degree of specificity ( 2 8 ) . % % % Clotting assay The novel factor Xa hexapeptide cleavage site shares simrX 43 & 3 9&3 50 f 10 ilarity with the intracellular peptidase endopeptidaseKex2p rXa 48 & 7 and carboxypeptidase Kexlp cleavage sites (30, 31) and the " 2PT, two-stage prothrombin time assay; APTT, activated partial recently characterized mammalian FUR gene product (32), thromboplastin time assay; PT, prothrombin time assay. which cleaves after paired basic amino acids (PACE) ( 3 3 ) . Although it is not known whether these particular proteases (Table I). The kinetic constants (k,,, and K,) for prothrombin are directly involved in the processing of the novel factor Xa activation were 43 and 45%, respectively, of the activity of monomer precursor, the possibility remains that the unique plasma factor Xactivated in an identical manner. Comparison processing site may be of some utility in other systems. of k,,,/K,,, ratios demonstrated85% activity for factor rX.The Attempts to secrete fully active vitamin K-dependent proobserved kinetic constants for plasma factor Xa were within teins in CHO cellshave met withvariablesuccess (2, 34). experimental error compared with thevalues reported previ- Although prothrombin is expressed in a fully y-carboxylated ously for human prothrombin activation(7). and biologically active form, factor IX, protein C, and protein In three plasma-based clotting assays, factor rX had 43% S have beenreportedtobesecreted withincomplete ythe specific activity of plasma factor X in a two-stage pro- carboxylation(y-carboxyglutamicacid)and low functional thrombin timeassay, 9% thespecific activity of plasma factor activity. In agreement with CHO-based prothrombin expresX in an activated partial thromboplastin time assay, and 50% sion, both factors rX and rXa were found to be secreted in the activity of plasma factor X in a prothrombin time assay biologically active forms (2). However, preliminary y-carbox(Table I). The reduced activated partial thromboplastin activ- ylation estimations based onanion-exchangefractionation ity could reflect unique processing or conformational differ- suggest a mixture of fully and partially y-carboxylatedforms. ences between humanfactor X andfactorrXthatalter Work is in progress to further characterize the process and association with the factor IXa-VIIIa intrinsic pathway comextent of y-carboxylation in these particularcell lines (29). plex. These modifications may suggest possible differences in Relative to the plasma factors, the lower active enzyme factor X association with the extrinsic and intrinsic factor X contents of the recombinant factors, 47% for factor rX and activating complexes. 64% for factor rXa, were partially due to a reduction in RVV The expressed factor rXa was catalytically active toward activation andproteolysis. The reduced RVV conversion could both small synthetic substrates and prothrombin (Table I). be caused by differing conformations andpossible post-transIncubation with the venom activator had no effect on factor lational modifications of factor rX, affecting both the rate rXa activity. In amidolytic assays factor rXa had a catalytic and extent of RVV activation. As mentioned before, factors efficiency that was 32% of purifiedplasma factor Xa activated rX and rXa were not prepared in the presence of protease by thevenom activator. Thisdifference in catalytic efficiency inhibitors. We have noted that unlike factor rX, factor rXa is a lower kc,, than thatof RVV-derived plasma factor was due to less stable in CHO media and is prone to autoproteolysis in Xa. The K , values were comparable. In prothrombin activapurified form. Accordingly, expression of proteolytic inactition assays, the kc,, values of factor rXa were 55%, and K, vated forms of factor rXa is also subject to heavy chain a / @ values were 85% of RVV-derived plasma factor Xa. Factor conversion (data not shown). Modifications in cell culture rXa in a two-stage prothrombin time clotting assay had48% methodologies, purification, and RVV activation should imthe activityof purified RVV-derived plasma factor Xa (Table prove the overall specific activities of the recombinant proI). teins. To better characterize thespecific activities of the various Thisisthefirst example of thedirect expression and plasma and recombinant factor X preparations, antithrombin characterization of biologically active human factors X and 111-based active-site titration was performed (22-24). Active Xa in CHO cells. The ability to express both zymogen and enzyme contents of RVV-treated plasma factor X and factor proteolytically active forms of factor X will greatly facilitate r X were 78 and 37%, respectively. Values of 92 and 59% for the characterization of functional domains important for acplasmafactorXaandfactorrXa, respectively, were also tivation, complex assembly, substrate association, and catalderived. The lower content of activefactorsrXandrXa suggests that RVV activation was less efficient and that the ysis during coagulation. One outcome of this analysismay be of novel coagulation inhibitors useful preparations contain an inactive population of proteins com- the further development as antithrombotic agents( 2 5 ) . posed of single chainprecursors, proteolyticallydegraded species, and possibly improperly folded forms due to abnormal Acknowledgments-We thankJack Rose, Mary Ann Hsu,and disulfide pairing (Fig. 2 and Table I). Therefore, based only Robert Scarborough for protein sequencing; George Chisolm and on estimatesof active-site quantitation, therelative activities Veronica Gutierrez for help with tissue culture of the recombinant Amidolytic assay 150.6 k 7.0 X 205.8 f 2.3 183.7 k 8.2 rX 136.6 k 1.7 k 9.6 163.71.9 Xa 306.6 & 7.7 154.0 f 5.5 rXa 95.1 & 1.4 Prothrombinase complex assay 1.1 k 0.5 X 17.6 k 5.0 0.5 k 0.27 rX 7.5 f 1.1 0.27 & 0.1 Xa 9.5 & 0.4 0.23 f 0.1 rXa 5.2 & 0.4

1.4 0.7

13730

Human Factor X and X a Expression

16. Church, W. R., and Mann, K. G. (1985) Thromb. Res. 38, 417424 17. Discipio, R. G . , Hermodson, M.A., Yates, S. G., and Davie, E. W. (1977) Biochemistry 1 6 , 698-706 REFERENCES 18. Discipio, R. G., Hermodson, M. A., and Davie, E. W. (1977) 1. Mann, K., Nesheim, M. E., Church, W. R., Haley, P., and KrishBiochemistry 16,5253-5260 naswamy, S. (1990) Blood 76, 1-16 19. Laemmli, U. K. (1970) Nature 2 2 7 , 680-685 2. Furie, B., and Furie, B. C. (1990) Blood 76,1753-1762 20. Matsudaira, P. (1987) J. Biol. Chem. 262, 10035-10038 3. Steinberg, M., and Nemerson, Y. (1987) Hemostasis and Throm- 21. Bloom, J. W., Nesheim, M. E., and Mann,K. G . (1979) Biochembosis, pp. 112-119, J. B. Lippincott, Philadelphia istry 18,4419-4425 4. Creighton, T. E. (1984) Protein Structures and Molecular Prop- 22. Chase, T., and Shaw, E. (1970) Methods Enzymol. 19, 20-27 erties, pp. 427-456, W. H. Freeman & Co., New York 23. Owen, C. M., Brennan, S. O., Lewis, J. H., and Carrel, R.W. 5. Broze, G. J., Jr., Warren, L. A., Novotny, W. F., Higuchi, D. A., (1983) N . Engl. J.Med. 309,694-698 Girard, J. J., and Miletich, J. P. (1988) Blood 71, 335-343 24. Salvesen, G., and Nagase, H. (1984) in Proteolytic Enzymes 6. Rapaport, S. I. (1989) Blood 73, 359-365 (Beyon, R. J., and Bundt, J. S., eds) IRL Press, New York 7. Krishnaswamy, S., Church, W.R., Nesheim, M. E., and Mann, 25. Girard, T. J., MacPhail, L. A., Likert, K. M., Novotny, W. F., Miletich, J. P., and Broze, G. J. (1990) Science 248,1421-1424 K. G. (1987) J. Biol. Chem. 262,3291-3299 8. Messier, T. L., Pittman, D. D., Long, G., Kaufman, R. J., and 26. Mertens, K., and Bertina, R. M. (1980) Biochem. J. 185, 647658 Church, W. R. (1991) Gene (Amst.), inpress 9. Kunkel, T.A., Roberts, J. D., and Zakour, R. A. (1987) Methods 27. Fair, D. S., and Bahnak, B. R. (1984) Blood 6 4 , 194-204 28. Ehrlich, H. J., Jaskunas, S. R., Grinnell, B. W., Yan, S. B., and Enzymol. 154,367-382 Bang, N. U. (1989) J. Biol. Chem. 264,14298-14304 10. Sanger, F., Necklen, S., and Coulson, A. R. (1977) Proc. Natl. 29. Malhotra, 0.P., Nesheim, M. E., and Mann,K. G. (1985) J. Biol. Acad. Sci. U. S. A. 74, 5463-5467 Chem. 260,279-287 11. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) Molecular Thomas, G., Thorne, F. A., Thomas, L., Allen, R. G., Hrubgy, D. 30. Cloning:A Laboratory Manual, Cold Spring Harbor Laboratory, E., Fuller, R., and Thorner, J. (1988) Science 241, 226-229 Cold Spring Harbor, NY 31. Thomas, L., Cooper, A., Bussey, H., and Thomas, G. (1990) J. 12. Takebe, Y., Seiki, M., Fujisawa, J . I., Joy, P., Yolota, K., Arai, K. Biol. Chem. 2 6 5 , 10821-10824 I., Yoshia, M., and Arai, N. (1988) Mol. Cell Biol. 8, 466-472 32. van den Ouweland, A. M. W., Van Duijnhoven, H. L. P., Keizer, 13. Lin, A., DeVaux, B., Green, A., Sagerstrom, C., Elliott, G . F., and G.D., Dorsers, L. C. J., and Van de Ven, W. J. M. (1990) Davis, M. M. (1990) Science 249,677-679 Nucleic Acids Res. 1 8 , 664 14. Felgner, P. L., Gadek, T. R., Holm, M., Roman, R., Chan, H. W., 33. Wise, R. J., Barr, P. J., Wong, P. A., Kiefer, M. C., Brake, A. J., Wenz, M., Northrop, J. P., Ringold, G. M., and Danielsen, M. and Kaufman, R. J. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 7413-7417 9378-9382 15. Harlow, E., and Lane, D. (1988)Antibodies:A Laboratory Manual, 34. Grinnell, B. W., Walls, J . D., Marks, C., Glasebrook, A. L., Berg, D. T., Yan, S. B., and Bang, N. U. (1990) Blood 76,2546-2554 Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

cell lines; and David R. Phillips forhelpful discussions and thoughtful guidance of the project.