Detection and characterization of viruses of ...

Detection and characterization of viruses of sweetpotatoes (Ipomoea batatas L.) from Guatemala and Honduras

Muhammad Kashif Master’s thesis University of Helsinki Department of Applied Biology Plant Pathology / Virology October, 2009

ii HELSINGIN YLIOPISTO Tiedekunta/Osasto

Fakultet/Sektion

HELSINGFORS UNIVERSITET Faculty

Laitos

Faculty of Agriculture and Forestry Tekijä

Författare

Institution

UNIVERSITY OF HELSINKI Department

Department of Applied Biology

Author

MUHAMMAD Kashif Työn nimi

Arbetets titel

Title

Detection and characterization of viruses of sweetpotatoes (Ipomoea batatas L.) from Guatemala and Honduras Oppiaine

Läroämne

Subject

Plant Pathology (Plant Virology) Työn laji

Arbetets art

Level

Aika

MSc Thesis iivistelmä

Referat

Datum

Month and year

October, 2009

Sivumäärä pages

Sidoantal

Number of

69 + 3

Abstract

Sweetpotato is a subsistence crop for many thousands of families across the globe. The present studies in the thesis provide basic knowledge about Sweet potato chlorotic stunt virus (SPCSV) and Sweet potato feathery mottle virus (SPFMV) that were detected and characterized from sweetpotatoes in Guatemala and Honduras. Sweetpotato plants from Central American countries were showing typical virus-like symptoms. Different strategies were adopted for virus detection. SPCSV and SPFMV were found to be infecting sweetpotato plants. SPFMV was detected only in sweetpotato plants from Honduras. SPFMV infection was detected serologically and results were confirmed by RT-PCR and sequencing. A recently developed detection method, based on restrictotypes of PCR products by two different endonucleases, revealed co-infection of SPFMV strains C and RC in a sweetpotato plant from Honduras which was corroborated by sequencing 3'proximal end (1.8 kb) of the genome and the coat protein (CP) ~940 nt based phylogenetic analysis. SPCSV was detected by double-stranded RNA extraction, confirmed by RT-PCR and subsequent sequencing of the partial HSP70h gene of genomic RNA2 gene of SPCSV. Phylogenetic analysis was done by constructing neighbour-joining tree of aligned nucleotide sequences, including SPCSV-EA isolates and SPCSV-WA isolates from database that clearly differentiated SPCSV isolates of Central American countries. These isolates from Guatemala and Honduras were grouped together with SPCSV-WA isolates from Argentina, United States, Spain, Israel, Nigeria and Egypt. Additionally, the RNase3 gene with UTR at 3´ end of genomic RNA1 gene of SPCSV was sequenced (1264 nt) and aligned against other WA isolates. It was found that the gene for the silencing suppressor protein p22 (676nt) was missing, reflecting intraspecific variation in the genomic structure of SPCSV. These findings revealed the two most important sweetpotato viruses in Guatemala, Honduras, and Central America for the first time and urge further studies of sweetpotato viruses in the region. Avainsanat

Nyckelord

Keywords

Keywords: Detection, Sweet potato chlorotic stunt virus, Sweet potato feathery mottle virus, heat shock protein 70 homologue, intraspecific variability, Restriction analysis, common and russet crack strains of SPFMV, West African strain of SPCSV, Ipomoea batatas, sweetpotato. Säilytyspaikka

Förvaringsställe

Where deposited

Helsinki Muita tietoja

Övriga uppgifter

Further information

Supervised by: MSc Tugume Kajungu Arthur and Professor Jari P.T. Valkonen

iii

TABLE OF CONTENTS 1 INTRODUCTION ............................................................................................. 1 1.1 Sweetpotato ............................................................................................. 1 1.2 Viruses ..................................................................................................... 3 1.3 Sweetpotato infecting viruses ................................................................ 6 1.4 Detection of viruses .............................................................................. 10 2 OBJECTIVES OF THIS STUDY .................................................................... 12 3 MATERIALS AND METHODS ...................................................................... 13 3.1 Plant material ......................................................................................... 13 3.2 Serological tests .................................................................................... 13 3.3 Biological indexing................................................................................ 15 3.4 Total RNA extraction and RT-PCR ....................................................... 15 3.5 Detection method based on restriction analysis ................................ 17 3.6 Methods of sequence analysis/alignments ......................................... 18 3.7 Double-stranded RNA extraction method ........................................... 18 4 RESULTS ...................................................................................................... 20 4.1 Disease symptoms ................................................................................ 20 4.1.1 Record of general symptoms ............................................................ 20 4.1.2 Virus-like symptoms in sweetpotato ................................................21 4.1.3 Symptoms in grafted I. setosa........................................................... 22 4.1.4 Appearance of mild symptoms ......................................................... 25 4.2 Serological detection by ELISA............................................................ 26 4.3 Total RNA extraction and reverse transcription ................................. 27 4.3.1 SPFMV amplification and cloning ..................................................... 27 4.3.2 Analysis of restrictotypes to detect genetic variability................... 28 4.3.3 Phylogenetic analysis of SPFMV ...................................................... 30 4.4 Double-stranded RNA extraction and reverse transcription ............. 31 4.4.1 SPCSV amplification and cloning ..................................................... 31 4.4.2 SPCSV RNase3 protein region amplification ................................... 32 4.4.3 Study of genomic structure of SPCSV RNA1 ..................................... 33 4.4.4 Phylogenetic analysis of SPCSV....................................................... 34 5 DISCUSSION ................................................................................................. 35 6 CONCLUSION AND FUTURE PROSPECTS ................................................ 41 7 REFERENCES .............................................................................................. 42 8 ACKNOWLEDGEMENTS.............................................................................. 50 9 APPENDICES ................................................................................................ 51

1

1. Introduction 1.1 Sweetpotato

Sweetpotato (Ipomoea batatas L.) is a dicotyledonous, perennial plant that is grouped in the "morning glory" family (Convolvulaceae). It is the only Ipomoea species out of 500 species of genus Ipomoea that produces edible tuberous roots, therefore, it is grown as a subsistence food crop and is also of economical importance (Woolfe, 1992, 1994; Onwueme & Charles., 1994). Sweetpotato crop is supposed to be originated 5000 years ago from Central America (Huang & Sun, 2000). The crop has great capacity of improvement because of its high level of diversity (Zhang et al., 2000, 2004). There is some evidence about the primitive history of sweetpotato. The discovery of actual remains of cultivated sweetpotato dated 2000 B.C from Casma valley of Peru, provided archaeological evidence for the origin of crop (Ugent et al., 1982). Austin (1988) suggested the origin of sweetpotato in the region surrounded by the Yucatan Peninsula of Mexico to the north and Orinoco River to the south, and also Guatemala and southern Peru as secondary centers of origin with high diversity. The crop had already existed in the Central or South America before Europeans first arrived, which was followed by spread of sweetpotato in other areas of world (Woolfe, 1992). In 1492, during his first voyage, Columbus discovered sweetpotato and introduced it to Western Europe, from where it was further spread to Africa and Asia (Yen, 1982; Woolfe, 1992). Sweetpotato plays an important role in farming and food systems in developing countries. Sweetpotato has a short growing period, is usually applied in crop rotations, helps in famine as a reserve crop, and grows well in marginal soils producing high yield per unit area per unit time (Woolfe, 1992), and in some areas crop can produce up to three harvests per year (Karyeija et al., 1998). Moreover, the crop can be cultivated in a wide range of agro-ecological zones because of its hardiness and flexible adaptability (Jana, 1982). Storage roots of sweetpotato are valuable sources of food due their nutritional components like dietary fibres (pectin, cellulose, hemi-cellulose and lignin), proteins, vitamins ( -Carotene, Vitamin B1 and B2, Vitamin C and Vitamin E), mineral contents (mainly K, Fe and Ca), energy and carbohydrates (Woolfe, 1992), and are used as staple food, animal feed and provide raw materials for alcohol production. The orange flesh cultivars of sweetpotato have high concentration of -carotene and it is the cheapest means of dietary vitamin A available to poor families in Africa (CIP, 1999). Sweetpotato has higher anthocyanin content in combination with pigments of high

2 stability which makes the crop a healthier substitute to synthetic colouring elements in food and provides more opportunities to farmers and rural households to get involved in economical activities (Bovell-Benjamin, 2007). It is also a source of many processed products like candy, noodles, snacks, starch, liquor, flour and a variety of other industrial products. These qualities of sweetpotato have enhanced global efforts with collaboration of the International Potato Centre (CIP, Lima, Peru) to promote the crop as a source of food, feed, processed food and a good source of earning for millions of poor-resource farmers in developing countries. CIP has an international mandate for research on sweetpotatoes to improve agronomical qualities of sweetpotato in developing countries. This has resulted in high production of output in China and Africa after years of decline (CIP, 200a). The research has been concentrated in most part of East African countries due to the significance of the sweetpotato crop in the continent. There is also an urgent need to conduct studies of other neglected sweetpotato producing areas of the world like Central American countries. According to FAOSTAT (2007), sweetpotato is the 3rd most important vegetatively propagated crop in the world after potato and cassava with annual production 126, 322 and 228 million tons, respectively. The sweetpotato crop producing areas with high production include East Asia, the Caribbean and tropical Africa, with massive production (88%) in China (Hijmans et al., 2001). Uganda and Nigeria are the leading sweetpotato producing countries in Africa (Karyeija et al., 1998; Hijmans et al., 2001; FAOSTAT, 2006). In 2007, an annual production of 63725 tons has been estimated in Central America of which annual production of 1050 tons in Honduras on the harvested area of 170 ha and data for sweetpotato production is unavailable for Guatemala. Collectively the production has been estimated as 1.9 million tons per annum for the whole continent of Latin America (FAOSTAT, 2007). Production of sweetpotato is restricted by biotic constraints. The damage made by weevils and viruses are amongst the major constraints that resulted in more serious problems causing massive losses worldwide (CIP, 2000b). Sweet Potato Virus Disease (SPVD) caused by co-infection of Sweet potato feathery mottle virus (SPFMV; genus Potyvirus; Potyviridae) and Sweet potato chlorotic stunt virus (SPCSV; genus Crivirus; Closteroviridae) is the most devastating viral disease in sweetpotato (Karyeija et al., 2000a; Mukasa et al., 2003a; Gibson & Aritua, 2002; Cuellar et al., 2008).

3 The combination of diagnostic host range, antisera and data of nucleotide sequences for common viruses have been used for detection and characterization of the viral components responsible for the main diseases in sweetpotato (Moyer & Salazar, 1989; Alicai et al., 1999; Mukasa et al., 2003a; Tairo et al., 2005, 2006; Untiveros et al., 2008). However, there is also need to develop more diagnostic methods for detection of viruses showing variability.

1.2 Viruses: devastating disease causing agents

In the process of viral infection, viruses must cope with responses of host defence under which they must replicate and result in gene expression by using the host metabolic system. The biological study of virus strategies to disrupt the host metabolism has unravelled important genetic and biochemical phenomena common to all living organisms (Hull, 2002). Viruses are linked with all major groups of organisms showing their ecological importance in environment (Breitbart & Rohwer, 2005). Historically, the viruses were found to be responsible for abnormal development, which was observed in infected plants and animals, and their damaging effects cause losses to human directly or indirectly when they infect livestock and crops (Agrios, 1997; Hull, 2002).The physiology, metabolic activity or even anatomy of the plants is affected by viruses and any of these changes may affect the ease with which the host will respond to virus activity (Hull, 2002). The huge losses to crops have been estimated as 500 billion dollars each year (Fermin et al., 2000). Most viruses cause mild or no symptoms to plants as single infections (Valverde et al., 2007), whereas viruses causing double or mixed infection to plants often lead to assistance of one virus to the second one and coinfection of viruses resulting into increased titres and severe symptoms, a phenomenon known as synergism (Hull, 2002). Matthews (1991) defined a virus as "a set of one or more nucleic acid template molecules normally encased in a protective coat or coats of protein or lipoprotein that is able to organize its own replication only within suitable host cells. Within such cells, virus replication is (i) dependent on the host's protein-synthesizing machinery, (ii) organized from pools of the required materials rather than by binary fission, (iii) located at sites that are not separated from the host cell contents by a lipoprotein bilayer membrane, and (iv) continually giving rise to variants through various kinds of changes in viral nucleic acid". This definition clearly differentiates viruses from other pathogens.

4 The extreme evolutionary capacity of viruses influence their prevalence by allowing them to adapt and parasitize all known groups of organisms and quickly adapt to numerous host species within a kingdom (Schneider & Roossinck., 2001). The efficient use of the limited amount of genome nucleic acids possessed by viruses is one of their adaptive strategies, so that they manage to cope with the large size of their host more advantageously. Viruses have devised their gene products to adapt multifunctional roles, e.g., HC-Pro and CP proteins for potyviruses (Hull, 2002). Also they show an important biological characteristic by existing as quasispecies that are reservoirs of biologically relevant viruses, and continuous variations within the infected organisms support the random emergence of viruses with altered biological properties (Domingo, 1996; Domingo et al., 1997). The variability affects their adaptability within host in spite of environmental variations, probably providing them freedom of movement from one host to another (Kikkert et al., 1999). Some of viruses in the Closteroviridae family are believed to co-evolve with their hosts and some of important genes (RNaseIII) may have taken up by viruses to strengthen their counter-defence system (Kreuze et al., 2005).

Classification of viruses

The viruses are classified into six major groups (van Regenmortel et al., 2000), based on the nature of the genome: (i) Double-stranded DNA (dsDNA); viruses that replicate without a phase of RNA intermediate. Viruses of largest genome (up to about 400 kb) are also included in this group and there is only one genome component, which may be linear or circular. Wellknown viruses in this group include the harpes and pox viruses. There are no plant viruses in this group. The viruses of Adenoviridae family involves replication within the nucleus of host by requiring host cell polymerases to replicate their genome, whereas, vertebrates infecting smallpox viruses do not replicate within the nucleus (Dimmock et al., 2007).

(ii) Single-stranded DNA (ssDNA); two families of plant viruses (Geminiviridae and Nanoviridae) are placed in this group and both of these consist of small circular genome components, often with two or more segments. In case of Geminiviridae, their replication occurs within the nucleus of an infected plant cell and during replication

5 single-stranded circular DNA is converted to a double-stranded circular intermediate by the process of coiling (Mankertz et al., 1997). (iii) Reverse-transcribing viruses; these have dsDNA or ssRNA genomes whose replication is facilitated by the enzyme reverse transcriptase. Many integrate into their host genome. The retroviruses are included in this group e.g., HIV. A single family of plant viruses (Caulimoviridae) is also placed in this group that is characterized by a single component of circular dsDNA that replicates via an RNA intermediate. (iv) Double-stranded RNA (dsRNA); some plant viruses (e.g. Partiviridae and Reoviridae) and many of the mycoviruses are included in this group. Replication, for instance in Reoviridae, occurs in cytoplasm and viruses do not fully uncoat and each negative strand of dsRNA produces many copies of positive strand followed by synthesis of mRNA (Tyler & Fields, 1996). (v) Negative sense single-stranded RNA (ssRNA); in this group, there is translation of some or all of the genes into protein from an RNA strand complementary to that of the genome. Some of plant viruses (e.g. Rhabdoviridae and Bunyaviridae) are placed in this group and it also includes the viruses that cause measles, influenza and rabies. In case of Rhabdoviridae, viruses replicate within cytoplasm by the formation of positive sense intermediate with the help of polymerase (Fu, 1997). (vi) Positive sense single-stranded RNA (ssRNA+); many viruses that cause respiratory diseases (e.g. SARS Coronavirus), and the causal agents of polio and footand-mouth disease have been included in this group. The majority of plant virus families are placed in this group e.g. Bromoviridae, Closteriviridae, Flexiviridae, Comoviridae, Potyviridae, Sequiviridae and Tombusviridae. Replication, for example in Potyvirus, genome replicate inside cytoplasm with the help of different proteins in its genome (Urcuqui-Inchima et al., 2001). Many different characteristics are used to classify the viruses into families, genera and species within each of these virus groups. The International Committee on Taxonomy of Viruses (ICTV) classifies viruses based primarily on their chemical characteristics, genomic type, nucleic acid replication, diseases, vectors, and geographical distribution among other characteristics.

6 1.3 Sweetpotato-infecting viruses

Since the early reports of suspected sweetpotato viral diseases in USA (Moyer & Salazar, 1989) and Eastern Africa (Hansford, 1944), today more than 20 viruses have been identified to infect sweetpotato crops worldwide (Loebenstein et al., 2003). Conventionally, bioassays that include host range, symptoms and vector transmission have been used to explain the etiology of the various diseases which is time consuming and challenging since vast knowledge of taxonomy is required. Advanced tools of visualization and molecular biology such as electron microscopy, serology and molecular techniques have improved detection and characterization of viruses worldwide (Moyer & Salazar, 1989; Alicai et al., 1999; Mukasa et al., 2003a; Tairo et al., 2005).

Potyviruses

Potyvirus constitutes the largest genus among the six genera of the family Potyviridae, the other includes Macluravirus, Bymovirus, Rymovirus, Tritimovirus and Ipomovirus. These viruses consist of monopartitie genomes, with an exception of the bipartite bymoviruses (van Regenmortel et al., 2000). The members of genus Potyvirus are transmitted by aphids in a non-persistent manner. The virus is taken by aphid in its stylet where it remains infectious only for a short period of time (Maia et al., 1996; Ng & Falk, 2006). Transmission of rymoviruses and tritimoviruses is done by mites of genus Abacarus or Aceria, respectively (van Regenmortel et al., 2000). Ipomoviruses such as Sweet potato mild mottle virus (SPMMV) may be transmitted by whiteflies to sweetpotato (Hollings et al., 1976). Potyviruses include probably more than 200 members and comprise the largest and economically most important group of plant viruses constituting nearly 25% of the known plant viruses (Khan & Dijkstra, 2002). They have virions of flexous, nonenveloped, filamentous particles, 680-900 nm long and 11-15 nm wide (UrcuquiInchima, et al., 2001). Formation of virus encoded cytoplasmic cylindrical inclusion (CI) bodies in cytoplasm is their distinguished characteristic (Van Regermortel et al., 2000). Sweet potato feathery mottle virus (SPFMV) has been detected and studied during this research work.

7

SPFMV

SPFMV (genus Potyvirus, family Potyviridae) is the most common sweetpotato virus around the world (Moyer & Salazar, 1989). SPFMV genomes constitute a positivesense single stranded linear ssRNA of about 10.8 kb with a poly(A) region at the 3' end (SPFMV-S; Sakai et al., 1997). The genome is larger than the average 9.7 kb of a potyvirus genome (Shukla et al., 1994). SPFMV coat protein (CP) is exceptionally large (38 kDa) in comparison with other potyviruses (Abad et al., 1992). Like other potyviruses, the genome has a single ORF, flanked by an un-transcribed region (UTR) at both the 5'-end and 3'-end encoding a large polyprotein.

Figure 1. The genome of potyviruses including SPFMV contains one open reading frame. The final protein products (boxes labelled) separated by border lines which indicate the putative cleavage sites of the polyprotein are shown. The 5'- and 3'untranslated regions are also indicated (single thick lines at both ends) and encodes a large polyprotein that is processed into ten mature proteins by virus-encoded proteases including : P1, HC-Pro and NIa-Pro (Reichmann et al., 1992). The fully processed proteins are P1 proteinase (P1-Pro), helper component proteinase (Hc-Pro), third protein (P3), 6kDa protein 1 (6K1), cylindrical inclusion protein that is an RNA helicase (CI), 6kDa protein 2 (6K2), nuclear inclusion protein a (NIa), which can be further processed into the viral protein genome-linked (VPg) and NIa proteinase (Pro). The last two proteins are the nuclear inclusion protein b (NIb) which acts as the RNA-dependent RNA polymerase (replicase) and the (CP). .

SPFMV gains entry into host cell via a stylet of several aphid species (e.g. Aphis gossypii) in a non-persistent manner. This transmission by aphids depends on the HCPro and an N-terminal amino acid motif Asp-Ala-Gly in the CP (DAG; Atreya et al., 1992). SPFMV has a narrow host range that is limited to plants of the family Convolvulaceae and some strains have been reported to infect Nicotiana benthamiana and Chenopodium amaranticolor (Moyer et al., 1980). Recently, 22 wild species of Ipomoea, Lepistemon and Hewittia have been found to be infected naturally with SPFMV in Uganda (Tugume et al., 2008). The diagnosis of SPFMV can routinely be carried out by indexing on a sensitive indicator host I. setosa (Frison & Ng, 1981;

8 Moyer & Salazar, 1989), serological tests with available antibodies from CIP, Lima, Peru and further confirmation by RT-PCR. Moreover, some strains show no detection during ELISA, probably due to the sequence variability of the N-terminus of CP. The lost of CP N-terminal amino acids occurs, may be due to proteolysis during virus extraction from plant tissues and has been reported in SPFMV (Shukla et al., 1994). The analysis based on comparisons of nucleic acid sequences specifically 3'-end of UTR and CP gene sequences (Shukla et al., 1994; Berger et al., 1997; Van Regenmortel et al., 2000) has become a powerful tool not only for studying the taxonomy but also to differentiate closely related strains or isolates of the viruses belonging to genus potyvirus (Berger et al., 1997). The common strain (SPFMV-C) and russet crack srain (SPFMV-RC) of SPFMV have primarily been characterized based on serological differences and various kinds of symptoms induced in sweetpotato (Moyer et al., 1980). Generally, there is only minor damage to sweetpotato cultivars due to SPFMV alone. The RC strain is associated with russet cracking of the tuberous roots in certain cultivars and has been reported from Peru (Untiveros et al., 2008), Korea (Ryu et al., 1998), Australia (Tairo et al., 2005) and Egypt (IsHak et al., 2003). Isolates of strain C deviate from RC by 82% within the CPencoding region and have been reported from Italy (Parrella et al., 2006), Australia (Tairo et al., 2005, 2006), Uganda (Mukasa et al., 2003b), Peru (Untiveros et al., 2008). There is additional molecular data on SPFMV isolates (Kreuze et al., 2000) that further revealed two additional phylogenetic lineages: ordinary strain (O) and the East African strain (EA) relatively closely related to RC group which are clearly distinct from C strain 75%-78.3% nt identity at the CP-encoding region. The isolates of O strain have been found from Niger, Nigeria, Japan, Korea, China and Argentina whereas the EA strain isolates have been reported from Uganda and Tanzania (Tairo et al., 2005).

Crinivirus SPCSV

SPCSV is a member of the genus Crinivirus placed in the family Closteroviridae (Kreuze et al., 2002). The largest genomes of all plant (+)ssRNA viruses have been found among members of the Closteroviridae appoaching up to 20 kb (Martelli et al., 2002).

9 SPCSV is an agriculturally significant pathogen of sweetpotato transmitted by whiteflies (e.g. Bemisia tabaci) in a semi-persistent manner (Sim et al., 2000). SPCSV has a limited host range including mainly the genus Ipomoea and some species of Nicotiana and Amaranthus palmeri (Cohen et al., 1992). SPCSV is phloem-limited virus (Karyeija et al., 2000; Nome et al., 2007). It has a flexuous particle of 850-950 nm in length and 12 nm in diameter. It has a bipartite genome with two RNA molecules as RNA1 (9407 nt) and RNA2 (8223 nt), where RNA1 includes five putative ORFs for replication-related proteins and RNA2 contains seven putative ORFs (Fig. 2). The RNA1 expressed prior to those of RNA2 during SPCSV replication, and the proteins at 3'-proximal gene of RNA1 enhance RNA replication and cause accumulation of RNA2 (Kreuze et al., 2002). The virus encodes two types of CP proteins. These proteins are analogous to other Criniviruses (Dolja et al., 2006).

Figure 2. Schematic representation of the genome organisation of SPCSV RNA1 and RNA2 in top and lowest lanes, respectively (Kreuze et al., 2002). Genetic variation in RNA1 is shown in the middle lane exemplified by isolates Is and Unj2 which lack the p22 gene (Cuellar et al., 2008). The boxes and arrows correspond to ORFs and putative proteins and their functions: (RNA1) P-Pro, putative papain-like cysteine proteinase; MTR, methyltransferase domain; HEL, helicase domain; RdRp, RNA-dependent RNA polymerase; (RNA2) Hsp 70h: heat shock 70 family protein homologue; CP: coat protein, CPm: coat protein minor. Additional two ORFs absent from other members of crinivirus: RNAseIII; dsRNA specific endonuclease; and p22, a silencing suppressor protein. The extraordinary characteristic of the genus Crinivirus is its significant divergence in ORFs downstream of the replication proteins. Unlike Potyviridae that has similar genome organisation, the crinivirus genome organisation shows variability among its members. For example, the occurrence of ORFs that encode an RNase III-like protein, a small hydrophobic protein (p7) and a 3'-terminal protein (p22) have only been described downstream of RdRp of SPCSV RNA1 (tope lane in Fig. 2) (Kreuze et al., 2002; Wintermantel et al., 2005). Later Cuellar et al. (2008) found that RNA1 lacks the ORF for p22 gene (767 nt) in some isolates like Is and Unj2.

10 1.4 Detection of viruses

Biological methods are of high significance for the assay, detection and diagnosis of viruses, however, these methods are time-consuming as compared to other methods (Matthews, 1991). The detection and identification of sweetpotato viruses have been difficult and challenging. This is complicated by frequent occurrence of mixed infections (Moyer & Kennedy, 1978). Generally, the methods of symptom diagnosis based on biological indexing, serology and PCR are mostly used regardless of their limited reliability and sensitivity. Consequently, several tests are required to identify and confirm the viral strains present in a diseased plant. Biological indexing of sweetpotato for viruses can be done by employing susceptible indicator host plants, which involves grafting of sweetpotato shoots on to indicator host I. setosa (Frison & Ng, 1981; Moyer & Salazar, 1989) as a widely used assay. This indicator plant shows symptoms, which may be difficult to detect in original sweetpotato plants due to low titres of virus. The identification of the virus strain requires further confirmation by assays based on serology and/or reverse transcription polymerase chain reaction (RT-PCR). Serological tests demonstrate a more practical method in routine procedures of viral diagnosis due to its convenience and possibly can be standardised. CIP has recently developed a kit containing antibodies for sweetpotato viruses with a standardised NCMELISA (enzyme-linked immunosorbent assay on nitrocellulose membrane) protocol. Enzyme linked immuno sorbent assay (ELISA) techniques show specificity and sensitivity for viruses using specific antisera. For instance, two serotypes S EA1 and SEA2 of SPCSV (Alicia et al., 1999) can be detected by triple-antibody sandwich ELISA (TAS-ELISA) using specific monoclonal antibodies (IsHak et al., 2003). However, serology may not work due to presence of interfering phenolic substances and inhibitors (Abad & Moyer, 1992) and the accuracy of serology may also be hampered by multiple infections of different viral strains because the specificity of antibodies is lost due to genetic variability of viral strains during synergism (Tairo et al., 2006). Thus, subsequent confirmatory tests are needed to validate the results. This is specifically important for the potyviruses due to the nature of close serological relationship (Shukla et al., 1994).

11 Molecular techniques like reverse transcription with subsequent PCR using universal degenerate primers (Gibbs et al., 1997) followed by cloning and sequencing, has provided sequence information of many new or uncharacterized viruses that cause infection in sweetpotato (Colinet et al., 1998). The specific primers and probes can easily be designed based on available sequence information that enables specific detection of viruses and virus strains (Abad & Moyer, 1992; Colinet et al., 1998). Recently, a simple and sensitive diagnostic method to differentiate mixed infection with more than one strain of a sweetpotato virus has been developed that involves restriction analysis of PCR amplicons by using endonucleases (Tairo et al., 2006). Availability of CP-encoding nucleotides sequences has been useful to clarify the taxonomy and to establish related groups of virus isolates/strains of potyviruses (Berger et al., 1997; Kreuze et al., 2000) and Closteroviridae member (Dolja et al., 2006). Isolation of double-stranded RNA (dsRNA) is another approach for the detection of unknown viruses. This diagnostic strategy is based on an idea that the plants which are not infected with viruses or virus-like agents do not have readily detectable amounts of high molecular weight dsRNA. The presence of dsRNA in a plant is an evidence of RNA virus or virus-like agent because dsRNA forms during replication of positive- and ambisense-RNA viruses (Dodds et al., 1984; Tzanetakis et al., 2008). Many viruses have been detected and characterized via dsRNA isolation instead of doing purification of virus particles (Thompson et al., 2002). The dsRNA molecule is highly stable and resistant to RNase degradation, which makes dsRNA extraction a powerful tool for virus characterization when viruses are not detectable via virus purification due to low titres, unstable particles or presence of inhibitors (Tzanetakis et al., 2008). However, different methods have been developed for dsRNA extraction, it is still challenging because of possible loss of dsRNA due to imbalance of salt concentration during DNase treatments (Dodds et al., 1984) and the presence of polysaccharides also affect yield of dsRNA (Benthack et al., 2005).

12 2. Objectives of the study

The main objective of this study was to detect viruses in sweetpotatoes from Guatemala and Honduras. Sweetpotatoes were suspected to be virus-infected due to expression of distinctive viral symptoms. Specific aims are as follows:

1. Identification of viruses of the sweetpotato plants by employing different detection methods based on bioassays, serology and molecular tests. 2. Molecular characterization of viruses to reveal the strains of infection-causing viruses using different molecular techniques.

13

3. Materials and methods 3.1 Plant Material

Sweetpotato plants were kindly provided by Dr. Roger A.C. Jones. All tuberous roots were obtained from markets in Honduras and Guatemala in February 2008. Materials labelled HN (Honduras) were purchased from a market stall in the town of Copan by Dr. Jones. The name of the variety is not known. Numbers HN1-HN5 refer to five tuberous roots of the same variety, probably grown in the same place in San Pedro Sula. The other plant materials labelled GT are from Guatemala and all obtained in Guatemala City. Samples A and B were purchased from two different market stalls, and samples C and D were purchased from supermarkets by Dr. Jones. The names of varieties are unknown (as in Honduras, the sellers did not know the names). Material B was from Antigua but the cultivation places of others are not known. Numbers after letters A-D refer to individual tuberous roots were purchased from the same place. Storage roots were then shipped to University of Helsinki, Finland where they were grown under control conditions stipulated by the Finnish quarantine authorities (Evira). The plants were grown and established in an insect-proof greenhouse at 25-30°C with relative humidity 60% (day & night), 13 hours light with light intensity of 240W/m2 at University of Helsinki. Plants were propagated by rooting stem cuttings.

3.2 Serological Tests

Serological tests were conducted using antibodies provided by the International Potato Center (CIP; Lima, Peru).

3.2.1 Nitrocellulose membrane based ELISA (NCM-ELISA)

NCM ELISA was performed according to the protocol developed by Gibb & Padovan (1993). Generally, the method involved the first step as the grinding of leaf material in extraction buffer Tris Buffered Saline (TBS; pH 7.5) in the ELISA bag (100mg leafmaterial/1ml buffer) by macerating with the help of glass tube followed by blotting of supernatant (10 µl) onto NCM (5×10 cm). The dried NCM was then treated with blocking buffer (pH 7.5) with subsequent step of washing with T-TBS (Tween-20 in TBS) buffer (pH 7.5).The NCM was placed in antibody buffer (25ml) containing

14 polyclonal (pAb) virus specific coat protein rabbit antibodies followed by washing with T-TBS buffer (pH 7.5) and again incubated in 2nd monoclonal (mAb) antibody as goat anti-rabbit (1gG) conjugated with enzyme (Alkaline phosphatase) and followed by washing in the same way as mentioned above. The membrane was then incubated in substrate-chromogen solution BCIP/NBT (5-Bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium chloride; pH 9.5) for ±30 minutes until the colour (purple/blue) develops as virus signals. The process involves visualization of complex constituting enzyme linked to secondary antibody (1gG) in the presence of substrate solution to develop a characteristic colour for positive serotypes. The following antibodies (used as first antibody) with recommended concentrations were used: SPFMV-C (1:5000), Sweet potato virus 2 (SPV2; 1:300), Sweet potato caulimolike virus (SPCaLV; 1:300), Sweet potato chlorotic fleck virus (SPCFV; 1:300), Sweet potato mild speckling virus (SPMSV; 1:300), Sweet potato latent virus (SwPLV; 1:300), C-6 (1:300), Sweet potato mild mottle virus (SPMMV; 1:300), Sweet potato virus G (SPVG; 1:1000). Goat anti-rabbit 1g G alkaline phosphatase conjugate (1:500)

3.2.2 Triple-antibody sandwich ELISA (TAS-ELISA)

The TAS-ELISA was done for sweetpotato samples as described by Gibson et al. (1998). In this procedure, first step involved the coating of wells of micro-titre plate with anti-SPCSV polyclonal (pAb) Ky-SPCSV antibodies (diluted in coating buffer as 1:1000; 100 µl in each well) at 4°C for overnight. Next day, plate was washed with Phosphate Buffered Saline Tween (PBS-T; 200 µl/well, 3 times washing/3min each). Leaf is then ground as described above and supernatant (100 µl) is pipetted into wells (34 well/each replicates; 2 replicates), next step followed by washing as done before (PBS-T). The anti-virus antibody (SPCSV; mAb) diluted in antibody buffer (1:150) was applied to each well (100 µl/well) and incubated at 4ºC overnight followed by washing with PBS-T in the similar way as described above. Second polyclonal anti-mouse antibodies (Alkaline phosphatase conjugated) diluted in antibody buffer (1:1000) were pipetted into wells (100 µl/well) in the same conditions as described above followed by washing as done before and then application of substrate buffer (p-nitrophenyl phosphate; pH 9.8) in the wells for development of characteristic colour for 10-20

15 minutes based on visual observation. Absorbance at 405nm was recorded repeatedly each after half an hour. The following antibodies and their recommended dilutions were used: First antibody; PAb Ky-SPCSV (1:1000), PAR-SPCSV (1:150) 2nd antibody; mAb Mix 1 (SPCSV.EA) and mAb Mix 2 (SPCSV.WA) with dilution factor 1:100. 3rd antibody; Anti-mouse (1:5000)

3.3 Biological Indexing

The seeds of I. setosa (kindly provided by Arthur Tugume) were grown in pots and 2-3 weeks old plants were grafted by scions of I. batatas as by following previously described procedure for virus indexing (Frison & Ng, 1981; Moyer & Salazar, 1989). The stem cuttings or scions (shoots/twigs) of I. batatas plants were grafted onto stems of young I. setosa plants.

3.4 Total RNA extraction and RT-PCR

Total RNA was isolated from 100-200 mg fresh Ipomoea leaves using Trizol (Invitrogen) according to manufacturer instructions (protocol in appendix II). RNA was dissolved in 50 µl sterile Milli-Q water (Sigma-Aldrich). The quantity and quality of the RNA were checked using spectrophotometer (GeneQuant™ 1300, GE Healthcare Life Sciences) by making assessment of the purity of RNA by an A260/A280 (most values for RNA samples ranged from 1.8 to 2.0) and subsequently RNA was observed by agarose gel electrophoresis. The RNA samples were reverse-transcribed in reaction mixture of 25 µl containing 100 ng random hexamer primers, 0.5 mM dNTPs, 20 U RNasin (Promega) and 400 U Moloney murine leukemia virus reverse transcriptase (Promega) at 37°C for one hour following manufacturer instructions. The cDNA of RNA samples were proceeded to PCR and a fragment of ~ 446 nt of the Hsp70h gene was amplified using specific primers

CL43L

(5´-GCAGCAGAAGGCTCGTTTAT-3´)

and

CL43U

(5´-

ATCGGCGTATGTTGGTGGTA-3´) as described by IsHak et al. (2003) at 52°C annealing temperature using Taq DNA Polymerase (Fermentas) according to manufacturer instructions.

16 For the isolate HN1, RT-PCR was performed to amplify RNase3 region of SPCSV (RNA1) using forward primer WAF1 (5´-GAAAATTCTGTCCCATATTTC-3´) and reverse primer WAR1 (5´-CTCTAGGATACAAACATTAAT-´3) annealing genomic positions 7,205 to 7,226 and 9230 to 9251, respectively at 50°C annealing temperature with DyNAzyme™ II DNA Polymerase (Finnzymes) as instructed by manufacturer. The primers WAF1 and WAR1 were designed based on sequences of the WA strain Is isolate (Cuellar et al., 2008) available in the database. The PCR products were purified from gel using E.Z.N.A.TM Gel Extraction Kit (Omega Bio-tech, inc.) in which fragment of interest was excised from gel of specific size by cutting under UV light in the first step that was then dissolved in an equal amount of binding buffer (volume/weight) at 55-60°C for 7 minutes with frequent mixing by vortexing followed by transfer of this solution into mini-column (HiBind® DNA Mini-Column) placed into 2 ml collection tubes which was then centrifuged (13000 rpm for 1 min), the flow was discarded then. The binding buffer XP2 (300 µl) was again added into HiBind® DNA Mini-Column placed on 2 ml tubes and then centrifuged similarly subjected by two times washing of columns with SPW Wash Buffer diluted with absolute ethanol (700 µl) and centrifuged as described before. The flow was discarded at each step. The last step involved elution of DNA by adding Nuclease free water (50 µl) into mini-column placed into new 1.5 ml microcentrifuge tubes and centrifuged at maximum speed for 1 min. The DNA concentration was measured by using spectrophotometer with appropriate dilution factor (50%).The DNA concentration was raised by reducing volume using Savant Speed Vac Plus Model SC110A Concentrator (Savant Instruments, Inc) for cloning. The purified DNA fragment was then cloned using the pGEM®-T and pGEM®-T Easy Vector Systems (Promega) in Escherichia coli DH5a cells according to manufacturer instructions. The cloning was done in two main steps as ligation and transformation (appendix III). Control reactions (control-insert DNA provided by cloning kit) were performed in parallel to make an analysis of efficiency of reactions as cloning for positive control-insert DNA was much better producing more colony growth on LB media plate (ampicillin) as compare to colony growth of ligated DNA (amplicons) which was expected. Two or more amplicons obtained in independent PCRs were sequenced from each isolate at the Haartman institute DNA sequencing unit (University of Helsinki, Finland). Sequence alignments showing genomic regions were completed and visually compared using Clustal X 2.0.

17 For seropositive SPFMV isolates, coat protein genomic region was amplified by RTPCR

using

potyvirus

specific

(degenerate)

forward

primer

PVD-2

(5´-

GGBAAYAAYAGYGGDCARCC-3´) against NIb region (Gibbs et al., 1997) and a reverse primer 10820R (5´-GGCTCGATCACGAACCAA-3´) complementary to 3´-end of the non-transcribed region (NTR) as described by Tairo et al. (2005) using Phusion® DNA Polymerase (Finnzymes) at 54°C annealing temperature for primers and the PCR products were poly(A) tailed using DyNAzyme™ II DNA Polymerase (Finnzymes) according to manufacturer's instructions. A-tailing (appendix III) was done to follow more convenient TA cloning as described above.

3.5 Detection method based on restriction analysis

The SPFMV (C/RC) strains were detected and differentiated by using restriction analysis based simple and sensitive diagnostic method developed by Tairo et al. (2006). PCR amplicons were purified from gel with E.Z.N.A.TM Gel Extraction Kit and were subjected to restriction with two different endonucleases HindIII and PvuII at 37°C overnight (See flow chart in appendix II). The restriction pattern was observed by gel electrophoresis in 1% agarose gel. TA cloning was followed as before and colony PCR was performed using degenerate primers PVD-2/10820R and Taq DNA polymerase (Fermentas) with annealing temperature 52°C. The fragments of expected size (1.8 kb) were purified from gel using E.Z.N.A.TM Gel Extraction Kit. Subsequently, the purified fragments were treated with HindIII and PvuII at 37°C overnight. The fragments that were showing expected restriction pattern for certain SPFMV C/RC strains were followed by purification of corresponding plasmids from the minipreps and were sequenced.

18 3.6 Methods of sequence alignments/analysis

The sequence were aligned by employing software programmes such as Clustal X, Jalview and Gene-doc were used. Also to change orientation of sequences, translation tool in the following website was used, http://www.bioinformatics.org/SMS/rev_comp.html Phylogenetic analyses were conducted using MEGA version 4 (Tamura et al., 2007) and the phylogenetic neighbour-joining trees were constructed using Kimura twoparameter based on Clustal-X alignments.

3.7 Double-stranded RNA (dsRNA) extraction

The following protocol was adopted with certain changes, developed by Tzanetakis et al. (2008) and using dsRNA extraction protocol from the Samuel Roberts Noble Foundation (http://bioinfosu.okstate.edu/pvbe/TGPMarvelli.pdf).

1. Fresh leaf tissue (5 g) from young branches of sweetpotato was collected. 2. Leaf tissue was ground in liquid nitrogen using mortar and pestle and ground powder was transferred into 50 ml tube containing 10 ml extraction buffer and 10 ml of Phenol:Chloroform (1:1) 3. Tubes were placed on shaker at 400 rpm for 20 min; subsequently mixture was transferred to 15 ml tubes in equal volumes and centrifuged at 12000 rpm for 10 min. 4. Aqueous phase was removed into 40 ml tube containing CF-11 cellulose power (0.5 g) and was shaked at 400 rpm for 30 min with following centrifugation in centrifuge (Sorval ss-34) at 15000×g for 15 min. 5. Supernatant was poured off and cellulose pellet was suspended in 20.5 ml Sodium Chloride-Tris-EDTA (STE), shaked at 400 rpm for 3 min and 4.5 ml absolute ethanol (18% ethanol/STE) with subsequent shaking at 400 rpm for 3-5 min. 6. The mixture was transferred to 2.5 cm diameter column (Glass Econo-Column Cat # 737-1517), allowed to drain completely and then washed with 25 ml 18% ethanol/STE two times. 7. STE buffer (4 ml) was poured down through column to elute dsRNA.

19 8. The collected dsRNA in 15 ml tubes was precipitated by adding 2.5 volume of absolute ethanol and 10% NaOAc, overnight at -20°C. 9. Next day, the precipitate mixture was centrifuged at 13000 rpm for 5 min and ethanol was poured off. The pellet was resuspended in 70% ethanol and washed by centrifugation at 13500 rpm for 5 min. 10. Ethanol was taken out after brief centrifugation by pipetting and the pellet was let dry for 10-15 min. 11. Dried pellet was dissolved in 70 µl water (nuclease free) followed by treatments with RNase T1 and DNase I, separately with appropriate buffers at 37ºC for one hour each. 12. dsRNA (24 µl) sample was run on the gel (1%) using loading dye (6×) in TAE buffer. Following changes were made in dsRNA extraction method developed by Tzanetakis et al. (2008), 1. Leaf tissue was reduced from 10 g to 5 g. 2. Chromatography was done once as compared to two rounds in method by Tzanetakis et al. (2008). 3. Phenol/chloroform was used due to the presence of increased level of polysaccharides in sweetpotato plant material. 4. Comparatively expensive chemicals including Lithium Dodicyle Sulphate (LDS), Deoxycholic acid, Tergitol, Potassium acetate were replaced by commonly used chemicals like NaCl, Tris, ethylenediaminetetraacetic acid (EDTA), sodium dodecyl sulfate (SDS), 2-mercaptoethanol and Polyvinylpyrrolidone (PVP) powder in the extraction buffer.

3.7.1 Reverse transcription of dsRNA

The dsRNA was reverse-transcribed using random primers with 400 U Moloney murine leukemia virus reverse transcriptase (Promega) at 37°C for 1 h following manufacturer's instructions. The RT-PCR for the gene HSP70h using specific primers CL43L (5´-GC AGCAGAAGGCTCGTTTAT-3´) and CL43U (5´-ATCGGCGTATGTTGG TGGTA3´) was performed, was cloned and the sequences were analysed visually, and based on phylogenetic analysis in the same way as mentioned before.

20

4. Results 4.1 Disease symptoms 4.1.1 Record of general symptoms

The following symptoms were recorded in sweetpotato plants (Ipomoea batatas) from Honduras (HN) and Guatemala (GT). Symptom severity was graded as follow: Grading System: Grade 5: Severe symptoms on more than 90% leaves; Grade 4: Apparent symptoms on more than 70% leaves; Grade 3: Apparent symptoms on more than 50% leaves; Grade 2: Few symptoms on more than 30%; Grade 1: Mild symptoms on few leaves; grade 0: No symptoms Table 1: Description of general symptoms in the leaves of sweetpotato plants (HN and GT). Sr#

Plant

Symptom description

1

HN1

Grade: 5. older leaves at middle & lower branches show symptoms as mottling, curling, chlorotic spots, vein clearing and yellowing.

2

HN2

Grade: 2. older leaves show mild symptoms with few chlorotic spots.

3

HN3

Grade: 0. No distinctive symptoms.

4

HN5

Grade: 2. No or fewer symptoms of chlorotic spots on old leaves.

5

B3GT

Grade: 4. most older leaves show mottling, leaf bending, chlorotic spots and curling, young leaves show few symptoms of chlorotic spots.

6

B2GT

Grade: 4. symptom expression in older leaves with few chlorotic spots.

7

B1GT

Grade: 4. older leaves show leaf bending, curling, mosaic, purpling, mottling, and pattern of light brown and yellow streaks.

8

A1GT

Grade: 5. older and a few young leaves with severe symptoms of mosaic, mottling, curling, also few leaves showing lesions and leaf bending.

9

A3GT

Grade: 3. few older leaves with stunting, purpling, chlorotic spots, mottling. While new leaves showing deformation and curling.

10

C1GT

Grade: 3. most of old leaves show mottling, chlorotic spots, leaf bending. In addition there was also appearance of dark brown streaks on few leaves.

11

C2GT

Grade: 1. No distinctive symptoms or minor chlorotic spots on leaves.

21 Symptoms descriptions in the above mentioned table are based on analysis made during 9 to 10 month period of plant growth.

4.1.2 Virus-like symptoms in sweetpotatoes

Virus like disease symptoms were observed in sweetpotatoes from Honduras and Guatemala. It was noticed that disease severity increased with the age of stems and leaves by the expression of more obvious virus associated symptoms. (Fig. 3).

Figure 3. Symptoms in sweet potato cultivars from Guatemala and Honduras. A. (C2GT) No distinctive symptoms and no virus detected; B. (A1GT) vein banding, vein chlorosis and severe leaf deformation at margins; C. (A3GT) lesions, mottling, purpling at borders; D. (B1GT) vein clearing, chlorosis along veins, leaf deformation; E. (B2GT) vein chlorosis, lesions and leaf curling; F. (C1GT) mottling, purpling and chlorosis; G. (B3GT) yellowing and purpling in older leaf;; H. (HN1) clear symptoms of blotches of chlorosis, vein clearing, mottling and leaf deformation.

22 4.1.3 Symptoms in grafted Ipomoea setosa

The scions of sweetpotato plants (Ipomoea batatas) were grafted on to the indicator host I. setosa. Disease symptoms were observed two to four weeks after grafting (Fig. 4/table 3).

Figure 4. Symptoms in leaves of I. setosa plants grafted with scions from sweetpotato plants as observed 2-4 weeks after grafting. A. (A1GT) vein clearing, blotches of chlorosis and some necrotic spots; B. (A3GT) lesions with purple borders, chlorosis and necrosis; C. (B1GT) lesions, chlorosis along veins and leaf curling at margins; D. (B2GT) chlorosis, necrosis, yellowing and curling at borders of leaf; E. (B3GT) lesions, necrotic spots, chlorosis and mottling and leaf deformation; F. (C1GT) chlorosis, necrotic spots and severe epinasty in the form of outward curling; G (HN1) lesions, vein clearing and severe epinasty with curling of leaf tips.

23 Table 2. Virus-like symptoms in the indicator host I. setosa after grafted with scions from sweetpotato plants.

Symptom Plants

Symptoms on grafted I. setosa

observation-time after grafting

AIGT

Chlorotic, necrotic spots and lesions on some leaves.

two weeks

Young leaves initiated wilting after necrosis. Older

three weeks

leaves also wilted afterwards with big necrotic lesion along the midrib.

B1GT

Young leaves died, whereas old leaves were wilting.

five week

Chlorotic spots on the older leaves.

two weeks

Younger leaves showed deformation with cholorotic

three weeks

spots. Deformation of leaves is in the form of curling and rolling mostly on young leaves and few older leaves with necrotic spots. Severe symptoms of deformation on younger leaves.

five weeks

Old leaves showed necrotic lesions along the veins and lesions on some leaves. Few young leaves wilted and necrosis started on older leaves. C2GT

No distinctive symptoms.

two weeks

No symptoms or only few chlorotic spots in some of

three weeks

older leaves.

B3GT

Few chlorotic spots in some older leaves.

five weeks

Few old leaves were showing chlorotic spots.

two weeks

Younger leaves were wilting and dying after necrotic

three weeks

lesion with chlorotic spots. Young leaves were dead due to wilting, whereas the

five weeks

older leaves showed chlorotic and necrotic spots. Some leaves wilted and died. Continue.

24

Symptom Plants

Symptoms on grafted I. setosa

observationtime after grafting

C1GT

No symptoms or few chlorotic spots.

two weeks

Some chlorotic spots appeared on old leaves and curling three weeks in some young leaves. Severe curling or epinasty in young leaves and chlorosis five weeks in older ones. B2GT

Chlorotic spots on a few of leaves.

two weeks

Younger and few older leaves showed curling and

three weeks

chlorotic spots. Younger and older leaves showed curling with chlorosis

five weeks

and yellowing. HN1

Chlorotic spots on a few leaves.

two weeks

Young and a few older leaves showed curling and rolling three weeks with chlorotic spots. Severe symptoms of leaf-deformation as curling or five weeks epinasty and rolling of young leaves with chlorotic spots. A3GT

Chlorotic spots on old leaves.

two weeks

Young leaves were wilting along with chlorosis and three weeks necrosis. Few older leaves were also wilting with chlorotic spots. Most leaves were dead after wilting as a result of five weeks chlorosis and necrosis

Sweetpotato plants HN1, B1GT and B2GT showed almost similar symptoms of deformation on the young leaves and chlorotic spots on older leaves. The plants B3GT and A3GT also expressed almost similar symptoms. The young and older leaves were dying after wilting with chlorotic spots.

25 4.1.4 Appearance of mild symptoms in two sweetpotato plants from Honduras

The two sweetpotato plants HN2 and HN5 from Honduras showed mild symptoms of chlorotic spots or no symptoms (Fig. 3). One plant HN3 was observed as asymptomatic and found to be negative for serological and molecular tests.

Figure 5. Sweetpotato cultivars from Honduras. A. (HN2) and B. (HN5) plants showed mild chlorotic spots or no symptoms on their leaves, whereas C. the HN3 was observed without any visual symptom on the leaves.

26 4.2 Serological detection of viruses by enzyme-linked immunosorbent assay 4.2.1 Nitro-cellulose membrane ELISA (NCM ELISA)

Detection by NCM ELISA was employed by using virus specific antiserum to test all the sweetpotato plants. SPFMV was detected in plants HN2 and HN5 (Fig. 6). Other plant samples found to be negative for SPFMV. Positive controls were not available for five of antibodies (SPV2, SPCaLV, SPVG, SPMSV, SwPLV and C-6). However, the results can easily be confused with false signals of antibodies can be seen on the left and can also be compared with repeated NCM-ELISA for the same samples after being cross absorbed with healthy plant sap as shown on the right in the fig 6.

Figure 6. NCM-ELISA shows cross reaction of antibodies with plant protiens on left and antibodies after absorbed with healthy plant sap on the right. Arrows on the right point out 4 spots on the top as healthy control on each membrane, uncircled spots (shown on SPFMV membranes) are the only positive controls available for SPFMV, encircled HN2 and HN5 were seropositive for SPFMV. All other samples were observed as seronegative.

27 4.2.2 Triple antibody sandwich ELISA (TAS ELISA)

Plants were underwent to another serological test TAS ELISA using polyclonal antiserum for SPCSV-KyCP and MAb mixes 1 and 2, available for SPCSV EA and WA strains, respectively. All experimental sweetpotato plant samples were found to be negative for both SPCSV strains.

4.3 Total RNA extraction and reverse transcription

Total RNA extraction was done for all the experimental plants expressing virus-like symptoms. To characterize viruses, RNA was proceeded to RT-PCR using virus specific primers followed by cloning and sequencing.

4.3.1 SPFMV amplification and cloning

The presence of SPFMV in sweetpotato plants HN2 and HN5 from Honduras confirmed by more reliable molecular test RT-PCR. The extracted RNA samples HN2 and HN5 were first run on the gel to analyze the quality (Fig. 7a) and further quantification by spectrophotometer. RNA was reverse transcribed using poly-T primers and amplified by PCR (Fig. 7b). The fragment of expected size (1.8kb) was purified and cloned (Fig. 7c).

Figure 7. RNA extraction from sweetpotato leaves, RT-PCR and cloning. (a) Extracted total RNA of HN2 and HN5 isolates shows clear bands with good quality; (b) amplification of a fragment (1.8kb) of SPFMV genome using primers PVD2/10820R and additional bands of 1 kb are non-specific and unexpected that might be from plant DNA; (c) Restriction analysis of the plasmids shows presence of an insert of the expected size (1.8 kb).

28 4.3.2 Analysis of restrictotypes to detect genetic variability of SPFMV

The strategy of restriction analysis was used to detect whether more than one strain of SPFMV co-infected plants in the form of complex of strains. The PCR amplicons of 3'proximal 1.8 kb fragment of SPFMV genome produced by RT-PCR was then followed by restriction analysis using two different restriction enzymes, HindIII and PvuII, applied separately for each sample. These enzymes have restriction sites in SPFMV RC-strain (russet crack) and C-strain (common) sequences and produce fragments of 1.3kb and 0.5kb; and 1.4kb and 0.4kb, respectively (Fig. 8b). The RT-PCR was run (Fig. 8a) and the gel purified fragments (1.8 kb) for HN2, HN5 and HOM12 were separately treated by each of the restriction enzymes. After successful restriction as shown in the gel, the purified fragment for HN5 was cloned (Fig. 9a), further verified by restriction analysis of gel purified fragments of colony PCR (Fig. 9b) and were sequenced for further confirmation of SPFMV-RC strain.

Figure 8. The analysis of restrictotypes by two different endonucleases HindIII and PvuII. (a) Amplicons obtained (1.8 kb) by RT-PCR from SPFMV using primers PVD2/10820R and observed in the gel after electrophoresis; (b) Restriction analysis using two endonucleases HindIII and PvuII produced 3 fragments in HN5 due to presence of complex of C and RC strains, an additional partially restricted band (1.8 kb) also observed on the top. The two fragments 1.3 kb and 0.5 kb (HindIII) were expected for RC strain. The HN2 shows 2 fragments of 1.4 kb and 0.4 kb (PvuII) as observed in positive control HOM12 for C strain. The HOM12 remains unrestricted on treatment with HindIII.

29

Figure 9. The restriction analysis of the gel purified cloned fragments. (a) Colony PCR using primers PVD-2/10820R showed amplification (1.8 kb) indicating CP of SPFMV; (b) The restriction analysis of gel-purified fragments was conducted by endonucleases HindIII and PvuII which shows the same results as described in Fig 8. HindIII produced expected fragments (SPFMV-RC; 1.3 kb and 0.5 kb) in all the samples except a1 and a6, whereas same samples treated with PvuII showed that all the samples remained unrestricted except a1 and a6 of fragment sizes (1.4 kb and 0.4 kb) which was expected for SPFMV-C strain. An additional band of 1 kb was also observed after treatment with both restriction enzymes in all the plasmid samples which indicates that there is another restriction site in the samples for both restriction enzymes. The a and b samples in the figure were derived from two ampicillin LB-plates (labelled as a and b) containing grown bacterial colonies (white and blue) which were then cultured from both plates. The colonies taken from each of plate a and b were numbered as a1 to a6 and b1 to b6, respectively.

30 4.3.3 Phylogenetic analysis of SPFMV sequences

SPFMV isolates were identified and related to particular group of strains by phylogenetic analysis based on CP sequences of SPFMV in HN2 and HN5 isolates using neighbour-joining method.

Bny

65 59

MBL

87

Kab1

98

E

Nak

80

Bag Bkb1

53

Ken115-1s Arua10a

100

O

TZ4

89

Fio

100

KmtMil SPFMV-K1 100

M2-41 HN5-RC

58

RC

Aus5 Aus2

60 92

Aus6

100 96

HN2 HN5-C

Ita1 75 100

99

Aus4c Pink-2c Aus5c

C

Sor ch4

69 100 50

c21 Spain1C

0.02

Figure 10. Phylogenetic tree constructed using the neighbour-joining method and Kimura two-parameter model based on the coat protein region placed the SPFMV isolates HN2 and HN5C (bold) grouped with the isolates of C strain. HN5RC isolate was found to correspond to the RC strain. Boot-strap values lower than 50% of 1000 replicates are not shown and the scale indicates the length of branches in the Kimura units of nucleotide substitution (Kimura, 1980).

31 4.4 Double-stranded RNA (dsRNA) extraction and reverse transcription

The strategy of dsRNA extraction was applied assuming that replicating viruses in young leaves can be detected by the extraction method. The dsRNA observed in the gel electrophoresis (Fig. 11a) was reverse transcribed using random hexamer primers followed by PCR using specific primers for the HSP70h gene of SPCSV (Fig. 11c) and a fragment (500bp) of expected size was purified from the gel, cloned (Fig. 11d) and sequenced.

Figure 11. Detection of viruses by dsRNA extraction from young leaves of sweetpotato plants was observed by gel electrophoresis and confirmed by RT-PCR (a) dsRNA extracted from plants B3GT and C1GT as observed by gel electrophoresis. A faint band detected on 1% agrose gel in TAE buffer; (b) dsRNA extraction from plants HN1, B3GT and A1GT showed a faint band on gel, and HN3 was negative (c) Reverse transcription polymerase chain reaction (RT-PCR) detection by using specific primers for HSP70h region of SPCSV showed amplification of a product of about ~500 bp from B3GT as observed by gel electrophoresis; (d) Plasmids containing the cloned fragment (~500 bp) were tested for the presence of the insert using specific restriction enzymes. (M) Gene Ruler DNA ladder Mix (Fermentas) 4.4.1 SPCSV amplification and cloning

Moreover, the identification of viruses by the characterization of viral dsRNA was further verified by using more convenient strategy of total RNA extraction. RNA was also extracted from rest of the entire virus suspected plants. RNA was found to be of good quality (Fig. 12a) and was reverse transcribed using random primers. Transcription was followed by PCR (Fig. 12b, c, d). The amplification products were cloned (Fig. 12e, f) and sequenced.

32

Figure 12. Total RNA extraction from sweetpotato leaf material, RT-PCR and cloning (a) High quality total RNA extraction was observed; (b, c and d) RT-PCR showed amplification of a fragment (~500 bp) using specific primers (CL43U/CL43L) for HSP70h region of SPCSV in A1GT, B1GT, B2GTs, B3GTs, C1GTs, HN1, HN1s, B3GT, C1GTs, A3GTs and A3GT samples, also with some unspecific fragments of low molecular weight and gel showed strong signals in HN1, HN1s and A3GTs indicating high virus titres; (e and f) Amplified fragments were purified from gel, cloned and confirmed by restriction analysis. 4.4.2 SPCSV RNase3 protein region amplification by PCR and cloning

To study other genomic region of SPCSV, primers were designed to the RNase3 gene and 3'-UTR of RNA1. RT-PCR was done (Figure 13a) and products were cloned (Figure 13b).

Figure 13. The PCR amplification of genomic region of SPCSV RNA1 of HN1 isolate and cloning. (a) RNase3 (1.2kb) was amplified using RT-PCR and cloned; (b) Restriction analysis of plasmids was done to verify the presence of inserted DNA.

33 4.4.3 Study of genomic structure of SPCSV RNA1

The amplified region (1.2 kb) from SPCSV RNA1 of isolate HN1 was sequenced and analysed by comparing with other isolates including Is, Ug, Tug2 and Unj2 from database which showed that the p22 gene was missing from the genomic region from RNase3 to the 3'-untranslated region (3'-UTR) (Fig. 14).

Figure 14. Sequence alignments of the 3'-proximal region of RNA1 showed absence of the p22 gene in isolate HN1 of SPCSV. (a) Schematic presentation of open reading frames (ORFs) in RNA1 indicated by arrows according to Kreuze et al. (2002) and Cuellar et al. (2008). (b) Sequence alignments show the absence of the ORF for p22 protein in isolates Is, Unj2 and HN1 (this study) in comparison with Ug and Tug2. PPro, putative papain-like cysteine proteinase; MTR, methyltransferase domain; HEL, helicase domain; RdRp, RNA-dependent RNA polymerase; RNase3, an RNase III endonuclease; p7 kDNA hydrophobic protein; p22 kDa RNA silencing suppressor protein.

34 4.4.4 Phylogenetic study for SPCSV sequences

SPCSV isolates were identified to particular group of strain by the phylogenetic analysis based on partial HSP70h gene sequences of isolates HN1, B3GT, A1GT, C1GT, A3GT, B1GT and B2GT (Fig. 15) using neighbour joining method was done by including 34 sequences of different isolates from the database. Consequently, SPCSV isolates from Honduras were identified to be grouped in the West African strain (WA). TZ297 Bkb1 Bongoma S2EA-41b Tug2 Kabale7d Mpigi10b Namulonge39 115-6S 84-5S TZ394 90

Hoima1c TZ3

Bag Tar2

71 89

89

Zambia1 Iganga1 15-3S

East African Strain

Kiboga3d Mis1

82

13-1S S1EA-11a Mukono5

100

m2-47 Unj2 86

45-3S

Madagascar Cordoba 53

HSP70-USA B4 Is

86

Nigeria-clone2 Egypt1 Nigeria-clone1 B3GT

99 85

HN1 A1GT C1GT

58

West African Strain

A3GT B1GT B2GT

0.02

Figure 15. Phylogenetic tree constructed by employing neighbour-joining method based on partial HSP70h gene (~ 430bp) of SPCSV showed that the seven new isolates (HN1, B3GT, A1GT, C1GT, A3GT, B1GT and B2GT) (shown bold) were characterized during this study are phylogenetically closely related with the SPCSV West African (WA) strain. Boot-strap values lower than 50% of 1000 replicates. The scale indicates length of branches in the Kimura units of nucleotide substitution (Kimura, 1980).

35

5. Discussion

The study conducted on viruses infecting sweetpotato (Ipomoea batatas Lam.) in Central American countries, Honduras and Guatemala is of high significance because of the plant's supposed historical origin in Latin America (Zhang et al. 2004). In this study, SPFMV and SPCSV were detected and characterization for the first time in Guatemala and Honduras, and also Central America. Sweetpotato plants with obvious virus-like symptoms from Guatemala and Honduras were studied. Mild chlorotic spots or no symptoms were observed in two of the plants HN2 and HN5 from Honduras and these plants were found to be positive for SPFMV by serological tests and subsequently confirmed by molecular tests. The similar symptoms were described in previous studies for SPFMV, a well known virus due its universal occurrence (Abad & Moyer., 1992; Milgram et al., 1996; Gibson et al., 1998; Karyeija et al., 1998; Gutierrez et al., 2003; Tairo et al., 2005; Kokkinos & Clark., 2006). There were also severe virus associated symptoms like chlorosis, purpling, yellowing, growth reduction and leaf curling in other plants A1GT, A3GT, B1GT, B2GT, B3GT, C1GT from Guatemala and HN1 from Honduras. Similar typical symptoms for the sweetpotato viruses have been analysed in previous studies due to single infection or co-infection with more than one viral strain (Milgram et al., 1996; Alicai et al., 1999; Karyeija et al., 2000a; Gibson & Aritua, 2002; Gutierrez et al., 2003; IsHak et al., 2003; Mukasa et al., 2003a; Tairo et al., 2004; Kokkinos & Clark, 2006). Symptoms were further observed by adopting a strategy of virus indexing that involved grafting of sweetpotato scions (I. batatas) on to indicator host I. setosa (Frison & Ng, 1981; Moyer & Salazar, 1989). The virus titres were boosted in I. setosa plants leading to severe foliar symptoms as described by previous studies (as referred to in previous paragraph) followed by death of some plants after two months. Later SPCSV was detected by molecular test from these plants. Periodic record of symptoms in I. setosa revealed that there were mild symptoms in the first week after grafting in most of the plants and severe symptoms in the fourth and fifth week after grafting. The symptoms were recorded in sweetpotato plants over the period of ten months and meanwhile plant-stems were cut down several times to avoid overgrowth and cross contamination of suspected viruses. The analysis of symptoms in plants was considered to be the first criterion to suspect the presence of viral infection.

36 During this study, the appearance of the apparent or typical symptoms of sweetpotato, as supported by previous studies, provided the evidence of occurrence of viruses, which was later confirmed. However, the symptom expression in I. setosa indicated that there were possibilities of presence of co-infection of viruses which were not detected in repeated serological and molecular tests. In this study, serological tests involved NCM-ELISA (Gibson & Padovan, 1993) and TAS-ELISA (Gibson et al., 1998; Karyeija et al., 2000b) for SPFMV and SPCSV, respectively. Initially, all the plants were repeatedly tested with NCM-ELISA using specific antibodies for nine different viruses. However, two plants HN2 and HN5 with mild or no symptoms were found seropositive only for SPFMV. NCM-ELISA tests showed cross reaction with plant proteins indicating false seropositive results that were overcome by adsorbing antibodies in healthy plant material (Gutierrez et al., 2003). The results indicated that most of the plants showing characteristic and more obvious virusassociated symptoms were found to be seronegative for SPFMV as compared to the seropositive HN2 and HN5 plants. TAS-ELISA was performed on the above mentioned seronegative sweetpotato plants using available antibodies specific for SPCSV (East and West African strain) for this serological test. Also there is no cross reaction in TAS-ELISA due to coating of antibodies before fixing plant material into wells of micro-titre plate. No positive detection for virus was observed, either due to low-virus titre that was too low to be detected serologically (Karyeija et al., 2000b; Tairo et al., 2006) or viral strains were serologically distinct or deviant (Abad et al., 1992; Mukasa et al., 2003b). The other possible explanation might be interference by phenolic compounds, latex and other inhibitors in matured sweetpotato plants during ELISA tests (Abad & Moyer, 1992, Gutierrez et al., 2003). The presence of high molecular weight dsRNA gives an indication for virus infection in plants (Dodds et al., 1984; Benthack et al., 2005). The dsRNA extraction followed by RT PCR confirmed SPCSV, thus providing first evidence of viral infection in sweetpotato plants. The dsRNA as a single band was observed in gel-electrophoresis and according to Dekker et al, (2004) the single visible band on gel after DNase treatment should be the dsRNA. The size of dsRNA for SPCSV observed in the gel was of bigger size as expected when comparing to DNA ladder used. Gast & Sänger (1994) mentioned that dsRNA migrates slower on gel than DNA marker due to lower electrophoretic mobility of

37 dsRNA. Other possibility includes the concentration of Mg+2 ions may hinder dsRNA mobility in the gel which could explain why the dsRNA appeared to migrate slower than the DNA marker (Manning and Quart, 1978). A faint band of dsRNA was visible on the gel suggesting the loss of dsRNA due to imbalanced salt concentration and other ions that were used during RNase T1 and DNase I treatment as described by Dodds et al, (1984). The expected size for potyviruses and SPCSV (RNA1 and RNA2) is ~10kb. Later, SPCSV was confirmed by subsequent testing with RT-PCR suggesting that the slower mobility of SPCSV RNAs was due to above mentioned reasons. The complementary DNA (cDNA) of dsRNA for B3GT isolate was synthesized and amplified using specific primers (CL43L/CL43U) for HSP70h gene of SPCSV on RNA2 (Alicai et al., 1999; Agranovsky et al., 1998; IsHak et al., 2003; Tairo et al., 2005). The HSP70h region of SPCSV was chosen for RT-PCR because the region is highly conserved and the plants were suspected to be infected with this virus due to virus-like severe symptoms similar as described in Peruvian isolates by Gutierrez et al, (2003). Severe symptoms could also be due to the involvement of some other possibilities like different cultivars, climatic conditions, and the co-infection of different viruses can also be suspected which was not detectable. Expectedly, RT-PCR created amplification ~500bp that was confirmed by sequence analysis. Results suggest that dsRNA observed was the indication for the infection of SPCSV that was present in replicative form in young leaves of sweetpotato plant B3GT. The two of SPFMV seropositive isolates HN2 and HN5 of Honduras origin were tested with RT-PCR using degenerate primers PVD2/10820R (Gibbs et al., 1997; Mukasa et al., 2003b; Tairo et al., 2005; Untiveros et al., 2008). The 3' proximal region (1.8 kb) of SPFMV genome for HN2 and HN5 isolates was cloned and sequenced followed by visual analysis of the sequences in the database to identify the strain showing close similarities.

The isolates were confirmed as C strain based on

phylogenetic analysis. Restriction analysis and phylogenetic studies further revealed that the HN5 isolate was co-infected with RC and C strains of SPFMV. Other plants with virus-like symptoms (A1GT, A3GT, B1GT and B2GT from Guatemala and HN1 from Honduras) were further assessed by RT-PCR amplification using specific primers (CL43U/CL43L) for HSP70h gene of SPCSV and were found to be positive. All the isolates were cloned and sequenced and the direct sequencing for most of isolates from PCR amplicons was done to confirm the SPCSV infection. The HSP70h gene showed high-sequence homology with the West African (WA) isolates of

38 SPCSV (98% maximum identities with WA isolates), when sequences were blasted against available sequences in database. The phylogenetic analysis of identified isolates along with other available WA isolates in database showed sequence similarity as low as 77% with EA isolates as similarly described by Aritua et al. (2008). Collectively, the results suggest that the presence of SPCSV in sweetpotato plants from Guatemala and Honduras is more prevalent when compared to SPFMV. The study also indicates the possibilities of presence of Sweet potato virus disease (SPVD) in these countries due to the ability of SPCSV to synergize with SPFMV (Gibson et al., 1998; Karyeija et al., 2000a; Mukasa et al., 2003a; Gibson & Aritua, 2002; Kokkinos & Clark, 2006; Nome et al., 2007; Cuellar et al., 2008; Untiveros et al., 2008). Additionally there is also the risk of synergism with other viruses since the SPCSV WA strain may synergize with Cucumber mosaic virus (CMV) or other unrelated viruses (Cohen & Loebenstein, 1991; IsHak et al., 2003). Tairo et al. (2006) developed a simple diagnostic method to differentiate complex of strains SPFMV (C and RC strains), which was adopted in this study. The restriction analysis of PCR amplicons (1.8kb) for plants HN2, HN5 and positive control (HOM12) was done using two restriction enzymes HindIII and PvuII which cut the amplicons at RC and C strains of SPFMV to fragments of 1.3/0.5 kb and 1.4/0.4 respectively. The results indicated that the plant HN5 from Honduras contained the RC strain of SPFMV, which was not detectable by serological tests. This finding was later confirmed by sequencing and their phylogenetic analysis. Unexpectedly, an additional fragment of 1 kb for HN2 and HN5 was also observed during the gel electrophoresis. The appearance of the additional band could be explained after studying the sequences of HN2 and HN5 (see appendix V). After studying the HN5 sequence (appendix V), it was found that it contains an additional cleavage site for HindIII at the central position 922 nt and that digestion with HindIII may produce two fragments of almost equal sizes at 0.922 kb and 0.887 kb. Hence, there is only one band (1 kb) visible in the gel because the two fragments (0.922 kb and 0.887 kb) lie almost at the same position. Similarly, the sequence at the C strain HN2 has a restriction site for HindIII at the same position as HN5 which is not in accordance with the previous study (Tairo et al., 2006). Moreover, HN5 and HN2 have restriction site for PvuII at position 1447 nt. Hence, the treatment with PvuII results in a restriction pattern constituting of 1.4 kb and 0.4 kb fragments, which was expected for SPFMV-C strain according to the previous work done by Tairo et al. (2006). The

39 endonuclease HindIII cleaved HN5 sequence into two fragments of 1.291 kb and 0.523 kb, which is consistent with the earlier work on RC strains done by Tairo et al. (2006). Moreover, the HN5-RC isolate has an additional restriction site for PvuII at the position 1040 nt, resulting in a 1 kb fragment observed in the gel after treatment with PvuII. In principle, according to restriction sites in sequences, the two bands of sizes 1.04 kb and 0.774 kb should be visible in the gel, however, one band (1 kb) can only be seen, possibly due to the partial digestion of the samples by PvuII. The amplicons of HOM12 remained unrestricted after treatment with HindIII in accordance with the lack of this restriction sites in the sequence. The HOM12 amplicons (SPFMV-C) are cleaved by endonuclease PvuII at the position 1447 nt. As a whole, the restriction analysis shows variability in the restriction pattern in the identified stains of SPFMV. The isolate HN1 from Honduras that was confirmed for SPCSV WA strain by phylogenetic studies based on HSP70h gene sequences, was then again followed by the RT-PCR to amplify RNase3 region of SPCSV in RNA1. The sequence analysis showed that silencing suppressor protein p22 (767 nt) was completely missing in HN1 when aligned against isolates including Is from Israel and Ug, Tug2 and Unj2 from Uganda, however, the two isolates Ug and Tug2 possess ORF for p22 agreeing with previous studies done by Kreuze et al. (2002) and Cuellar et al. (2008). This is the first report of intraspecific variation in SPCSV genomic structure of isolates from Central America after the ones described by Cuellar et al. (2008). These results suggest that there can be genetic variations in the WA isolates of SPCSV in the region of Central America. Phylogenetic analysis of coat protein (CP) encoding sequences of ~940 nucleotides (nt) showed that the isolates HN2 and HN5C from Honduras belong to SPFMV C-strain (IsHak et al., 2003; Tairo et al., 2006). The sequences of HN5 isolates are named as HN5C for C strain and HN5RC for RC strain due to presence of complex of strains in the same isolate. There is high-sequence homology amongst three strains RC, O and EA (Tairo et al., 2005) that is clearly demarcated by constructing phylogenetic tree. Phylogenetic analysis in this study shows that HN5RC is closely related to Peruvian isolate M2-41 (Untiveros et al., 2008) and Korean isolate SPFMV-K1 (Ryu et al., 1998) followed KmtMil and Fio isolates from Peru (Untiveros et al., 2008) and Australian isolates Aus5, Aus2 and Aus6 (Tairo et al., 2005). The HN2 and HN5C isolates of SPFMV are grouped with Italian isolate Ita1 (Parrella et al., 2006), Australian isolates Pink-2c (Tairo et al., 2006), Aus4c and Aus5c (Tairo et al., 2005), Ugandan isolate Sor (Mukasa et al., 2003b) and the isolates C21

40 and Ch4 from Peru (Untiveros et al., 2008) of C strain. These results indicate that the occurrence of SPFMV C and RC strains is important in relation to establish co-infection of strains and with other un-related viruses (Abad et al., 1992; Karyeija et al., 2000a; Tairo et al., 2005). Phylogenetic study for SPCSV isolates (B3GT, HN1, A1GT, C1GT, A3GT, B1GT and B2GT) was done by constructing tree based on partial HSP70h gene (~430 nt) including 27 SPCSV EA isolates and few WA isolates available in database from Argentina, United States, Spain, Israel, Nigeria and Egypt (Nome et al., 2007; Sim et al., unpublished (NCBI); Valverde et al., 2004; Cuellar et al., 2008; Fenby et al., unpublished (NCBI); IsHak et al., 2003, respectively). Phylogenetic analysis based on partial HSP70h shows that the isolates of SPCSV WA strains are phylogenetically distant from EA isolates and this also indicates the low sequence homology between two types of isolates as described by previous studies (Alicai et al., 1999; Fenby et al., 2002; Tairo et al., 2005). SPCSV WA isolates including new identified isolates during the study are clearly differentiated from EA isolates by the phylogenetic analysis suggesting that the isolates differ geographically (IsHak et al., 2003; Aritua et al., 2007) and newly identified seven isolates in this study were grouped with WA isolates. Altogether, identification and characterization of SPFMV and SPCSV from two and seven sweetpotato plants, respectively, from Guatemala and Honduras is the first report of viruses in this particular region of Central America. Moreover, these results suggest the occurrences of SPCSV and SPFMV in more areas. The study also implies that genetic variation in viruses of sweetpotatoes and their co-infection can be the potential risks in the detection and characterization of the infectious viruses.

41

6. Conclusion and future prospects This is the first study of viral infection on sweetpotato plants from Central America. The study provides basic knowledge about presence of sweetpotato viruses and makes a limited representation of viral infection on sweetpotato plants in Guatemala and Honduras. Significantly, the detection of different isolates of SPCSV and SPFMV during this study, is the first report of sweetpotato viruses in Guatemala and Honduras. Taking together, detection of sweetpotato viruses/strains during this study describe the possibilities of disease incidences in other areas of countries and even in neighbouring countries because of worldwide distribution of viruses as described in previous studies. This also implies that these viruses may be able to synergise, co-infect and show genetic variation that will hinder the efforts to control the diseases in the continent. Furthermore, the genetic variation in viruses as observed during this study can be a potential challenge for the virus diagnostics in Central America. More comprehensive study is needed to explore and characterize viruses from Central American countries. Further studies are required to find out the level of sweetpotato virus occurrences in more regions of Central American countries, so that better diagnostic methods can be introduced and better cultivars can be developed to improve crop production. More research will be needed to determine co-infection and genetic variations in sweetpotato viral strains. This study also anticipate the presence of SPFMV and SPCSV in other sweetpotato growing countries in the region and indicates an urgent need to study sweetpotato viral diseases in the region as there is no molecular data available from neighbouring countries. Findings about SPCSV WA strain during the thesis work urge the need of more study due to lack of information about SPCSV WA isolates as compare to EA isolates. Lack of knowledge about sweetpotato viruses causes high risk to sustainable control strategies of sweetpotato viruses. Altogether, the presented study opens new horizon by giving a realization about the limited knowledge of causative genetically variable viruses in the continent and encourages more studies to be conducted to avoid potential risks due to highly damaging plant pathogen.

42

7. References Abad, J.A. & Moyer, J.W. 1992. Detection and distribution of sweetpotato feathery mottle virus in sweetpotato by in vitro-transcribed RNA probes (Riboprobes), membrane immunobloting assay, and direct blotting. Journal of Phytopathology 82: 300-305. Abad, J.A., Conkling, M.A., & Moyer, J.W. 1992. Comparison of the capsid protein cistron from serologically distinct strains of sweet potato feathery mottle virus (SPFMV). Archives of Virology 126: 147-157. Agranovsky, A.A., Folimonov, A.S., Folimonova, S.Y., Morozov, S.Y., Schiemann, J., Lesemann, D. & Atabekov, J.G. 1998. Beet closterovirus HSP70-like protein mediates the cell-to-cell movement of a potexvirus transport-deficient mutant and a hordeivirus-based chimeric virus. Journal of General Virolology 79: 889-95. Agrios, G.N. 1997. Plant Pathology. 4th Edition. UK: Academic Press, Ltd. Alicai, T., Fenby, N.S., Gibson, R.W., Adipala, E., Vetten, H.J., & Froster, G.D. 1999. Occurrence of two serotypes of sweet potato chlorotic stunt virus in East Africa and their associated differences in coat protein and HSP70 homologue gene sequences. Plant Pathology 48: 718-726. Aritua, V., Barg, E., Adipala, E., Gibson, R.W. & Vetten, J.H. 2008. Further evidence for limited genetic diversity among East African isolates of sweet potato chlorotic stunt virus. Journal of Phytopathology 156(3): 181-189. Atreya, C.D., Atreya, P.L., Thornbury, D.W. & Pirone, T.P. 1992. Site-directed mutations in the potyvirus HC-PRO gene affect helper component activity, virus accumulation, and symptom expression in infected tobacco plants. Virology 191: 106-111. Austin, D.F. 1988. The taxonomy, evolution and genetic diversity of sweetpotatoes and related wild species. In: P, Gregory (ed.). Exploration, Maintenance and Utilization of Sweet Potato Genetic Resources. International Potato Center, Lima, Peru. pp. 2760. Benthack, W., Mielke, N., Buttner, C. & Muhlbach, H.P. 2005. Double-stranded RNA pattern and partial sequence data indicate plant virus infection associated with the ringspot disease of European mountain ash (Sorbus aucuparia L.). Archives of Virology 150: 37-52.

43 Berger, P.H., Wyatt, S.D., Shiel, P.J., Silbernagel, M.J., Druffel, K. & Mink, G.I. 1997. Phylogenetic analysis of the potyviridae with emphasis on Legume-infecting potyviruses. Archieves of Virology 142: 1979-1999. Bovell-Benjamin, A.C. 2007. Sweet potato: A review of its past, present and future role in human nutrition. Advances in Food and Nutrition Research 52: 1-59. Breitbart, M. & Rohwer, F. 2005. Here a virus, there a virus, everywhere the same virus? Trends in Microbiology 13: 278-284. CIP (1999) Annual Report. International Potato Centre, Lima, Peru. CIP (2000a) Annual Report. International Potato Centre, Lima, Peru. CIP (2000b) Annual Report. International Potato Centre, Lima, Peru. Cohen, J., Frank, A., Vetten, H.J., Lesemann, D.E. & Loebenstein, G. 1992. Purification and properties of closterovirus-like particles associated with a whitefly transmitted disease of sweet potato. Annals of Applied Biology 121: 257-268. Colinet, D., Nguyen, M., Kummert, J. & Lepoivre, P. 1998. Differentiation among potyviruses infecting sweet potato based on genus and virus-specific reverse transcription polymerase chain reaction. Plant Disease 82: 223-229. Cuellar, W.J., Tairo, F., Kreuze, J.F. & Valkonen, J.P.T. 2008. Analysis of gene content in sweet potato chlorotic stunt virus RNA1 reveals the presence of the p22 RNA silencing suppressor in only a few isolates: implications for viral evolution and synergism. Journal of General Virology 89: 573-582. Dekker, N.H., Abels, J.A., Veenhuizen, P.T.M. & Dekker, C. 2004. Joining of Long Double-stranded RNA Molecules through Controlled Overhangs. Nucleic Acids Research 32 (18). Dimmock, N.J., Easton, A.J. & Leppard, K.N. 2007. Introduction to Modern Virology. 6th edition. Blackwell Publishing. Dodds, A.J., Morris, T.J. & Jordan, R.L. 1984. Plant viral double-stranded RNA. Annual Review Phytopathology 22: 151-168. Dolja, V.V., Kreuze, J.F. & Valkonen, J.P.T. 2006. Comparative and functional genomics of closteroviruses. Virus Research 117: 38-51. Domingo, E. & Holland, J.J. 1997. RNA virus mutations and fitness for survival. Annual Reviews in Microbiology 51: 151-178. Domingo, E. 1996. Biological significance of viral quasispecies. Viral Hepatitis Reviews 2: 247-61. FAO. 2006. FAOstat. http://faostat.fao.org/site/567/default.aspx

44 FAO. 2007. FAOstat. http://faostat.fao.org/site/567/default.aspx Fenby, N., Seal, S., Gibson, R.W. & Foster, G.D. (unpublished). Partial characterisation of the heat shock protein 70 (HSP70) gene from sweet potato chlorotic stunt virus isolated in West Africa and Madagascar. unpublished (NCBI). Fermin-Muñoz, G.A., Meng, B., Ko, K., Mazumdar-Leighton, S., Gubba, A. & Carroll, J.E. 2000. Biotechnology: A new era for plant pathology and plant protection. APSnet Features. American Phytopathological Society. Frison, E.A. & Ng, S.Y. 1981. Elimination of sweet potato virus disease agents bymeristem culture. Tropical Pest Management 27: 452-454. Fu,Z.F., 1997. Rabies and rabies research: past, present and future. Vaccine 15 Suppl. 20-24 pp. Gast, F.U. & Sänger, H.L. 1994. Gel dependence of electrophoretic mobilities of double-stranded and viroid RNA and estimations of the contour length of a viroid by gel electrophoresis. WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim, Electrophoresis 15: 1493-1498. Gibb, K.S. & Padovan, A.C. 1993. Detection of sweet potato feathery mottle in sweet potato grown in Northern Australia using an efficient and simple assay. International Journal of Pest Management 39: 223-8. Gibbs, A. & Mackenzie, A. 1997. A primer pair for amplifying part of the genome of all potyvirids by RT-PCR. Journal of Virological Methods 63: 9-16. Gibson, R.W. & Aritua, V. 2002. The perspective of Sweet potato chlorotic stunt virus in sweetpotato production in Africa: a review. African Crop Science Journal 10: 281-310. Gibson, R.W., Mpembe, I., Alicai, T., Carey, E.E., Mwanga, R.O.M., Seal, S.E. & Vetten, H.J. 1998. Symptoms, aetiology and serological analysis of sweet potato virus disease in Uganda. Plant Pathology 47: 95-102. Gutierrez, D.L., Fuentes, S. & Salazar, L.F. 2003. Sweet potato virus disease (SPVD): distribution, incidence, and effect on sweetpotato yield in Peru. Plant Disease 87: 297-302. Hansford, C.G. 1944. A probable virus disease of sweetpotato. The East African Agricultural Journal 126-127. Hijmans, R.J., Huaccho, L. & Zhang, D.P. 2001. Global distribution of sweetpotato. CIP Programme Report, 1999–2000. Lima: International Potato Center, Peru. 323329 pp.

45 Hollings, M., Stone, O.M. & Bock, K.R. 1976. Purification and properties of sweet potato mild mottle, a whitefly born virus from sweet potato (Ipomoea batatas) in East Africa. Annals of Applied Biology 82: 511-528. Hull, R. 2002. Mathew's plant virology. fourth edition. Academic Press, U.K. IsHak, J.A., Kreuze, J.F., Johansson, A., Mukasa, S.B., Tairo, F., Abo El-Abbas, F.M. & Valkonen, J.P.T. 2003. Some molecular characteristics of three viruses from SPVD-affected sweetpotato plants in Egypt. Archives of Virology 148: 2449-2460. Jana, R.K. 1982. Status of sweetpotato cultivation in East Africa and its future. In: Villareal, R.L. & Griggs, T.D (eds.). Sweetpotato. (Proceedings of the first International Symposium 23-27, March 1981, Shanhua, Tainan, Taiwan, China). AVRDC Publication no. 82-172 pp. Karyeija, R.F., Gibson, R.W. & Valkonen, J.P.T. 1998. The significance of sweetpotato feathery mottle virus in subsistence sweetpotato production in Africa. Plant Disease 82: 4-15. Karyeija, R.F., Gibson, R.W. & Valkonen, J.P.T. 2000. Synergistic imteractions of a potyvirus and a phloem-limited crinivirus in sweetpotato cultivars. Virology 269: 26-36. Karyeija, R.F., Kreuze, J.F., Gibson, R.W. & Valkonen, J.P.T. 2000a. Synergistic interactions of a potyvirus and a phloem-limited crinivirus in sweet potato plants. Virology 269: 26-36. Karyeija, R.F., Kreuze, J.F., Gibson, R.W. & Valkonen, J.P.T. 2000b. Two serotypes of Sweetpotato feathery mottle virus in Uganda and their interaction with resistant sweetpotato cultivars. Phytopathology 90: 1250-1255. Kassanis, B. 1963. Interaction of viruses in plants. Advances in Viral Research 10: 219255. Khan, J. & Djkastra, J. 2002. Plant viruses as molecular pathogens. The Haworth Press, Inc. Kikkert, M., van Lent, J., Storms, M., Bodegom, P., Kormelink, R. & Goldbach, R. 1999. Tomato spotted wilt virus particle morphogenesis in plant cells. Journal of Virology. 73: 2288-2297. Kimura, M. 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. The Journal of Molecular Evolution 16: 111-120.

46 Kokkinos, C.D. & Clark, C.A. 2006. Interactions among sweet potato chlorotic stunt virus and different potyviruses and potyvirus strains infecting sweetpotato in the United States. Plant Disease 90: 1347-1352. Kreuze, J.F., Karyeija, R.F., Gibson, R.W. & Valkonen, J.P.T. 2000. Comparisons of coat protein gene sequences show that East African isolates of Sweet potato feathery mottle virus from a genetically distinct group. Archives of Virology 145: 567-574. Kreuze, J.F., Savenkov, E.I. & Valkonen. J.P.T. 2002. Complete genome sequence and analyses of the subgenomic RNAs of Sweet potato chlorotic stunt virus reveal new features for the genus Crinivirus. Journal of Virology 76: 9260-9270. Kreuze, J.F., Savenkov, E.I., Cuellar, W., Li, X. & Valkonen, J.P.T. 2005. Viral class 1 RNase III involved in suppression of RNA silencing. Journal of Virology 79 :72277238. Loebenstein, G., Fuentes, S., Cohen, J. & Salazar, L.F. 2003. Sweetpotato. In Viruses and Virus-like Diseases of Major Crops in Developing Countries. (G. Leobenstein and G. Thottapilly, eds.), pp. 223-248. Dortrecht, The Netherlands: Kluwer Academic Publishers. Maia, I.G., Haenni, A.L. & Bernardi, F. 1996. Potyviral HC-Pro: a mutifunctional protein. Journal of General Virology 77: 1335-1341 Mankertz, A.F., Persson, F., Mankertz, J., Blaess, G. & Buhk, H.J. 1997. Mapping and characterization of the origin of DNA replication of porcine circovirus. Journal of Virology 71: 2562-2566. Manning, G.S. 1978. The molecular theory of polyelectrolyte solutions with applications to the electrostatic properties of polynucleotides. Quarterly Review of Biophysics 11: 179-246 Martelli, G.P., Agranovasky, A.A., Bar-Joseph M, & 13 other authors. 2002. The family Closteroviridae revised. Archives of Virology 147: 2039-2044. Matthews, R.E.F. 1991. Plant virology, third edition. Academic Press, London, G.B. Milgram, M., Cohen, J. & Loebenstein, G. 1996. Effects of sweet potato feathery mottle virus and sweet potato sunken vein virus on sweet potato yields and rates of reinfection of virus-free planting material in Israel. Phytoparasitica 24: 189-193. Moyer, J.W. & Salazar, L.F. 1989. Viruses and viruslike diseases of sweet potato. Plant Disease 73: 451-455.

47 Moyer, J.W., Abad, J.A., New, S.L. & Bell, J. 2002. Isolation, identification and detection of undescribed RNA sweetpotato viruses. Acta Horticulture (ISHS) 583: 121-127. Moyer, J.W., Cali, B.B., Kennedy, G.G. & Abdou-Ghadir, M.F. 1980. Identification of two sweet potato feathery mottle virus strains in North Carolina. Plant Disease 64: 762-764. Mukasa, S.B., Rubaihayo, P.R. & Valkonen, J.P.T. 2003a. Incidence of viruses and virus-like diseases of sweet potato in Uganda. Plant Disease 87: 329-335. Mukasa, S.B., Tairo, F., Kullaya, A., Rubaihayo, P.R. & Valkonen, J.P.T. 2003b. Coat protein sequence analysis reveals occurrence of new strains of sweet potato feathery mottle virus in Uganda and Tanzania. Virus Genes 27: 49-56. Ng, J.C. & Falk, B.W. 2006. Virus-vector interactions mediating nonpersistent and semipersistent transmission of plant viruses. Annual Review of Phytopathology 44: 183-212 Nome, C.F., Nome, S.F., Guzman, F. & Conci, L. 2007. Localization of Sweet potato chlorotic stunt virus (SPCSV) in synergic infection with two potyvirus in sweet potato. Biocell 31(1): 23-31. Onwueme, I.C. & Charles, W.B. 1994. Tropical root and tuber crops. FAO Plant Production and Protection Paper 125. FAO of the UN. Rome, Italy. Parrella, G., De Stradis, A. & Giorgini, M. 2006. Sweet potato feathery mottle virus is the casual agent of sweetpotato virus disease in Italy. Plant Pathology 55(6) :818818. Pfeiffer, I., Kucsera, J. & Varga, J. 1996. Variability and inheritance of double-stranded RNA viruses in Phaffia rhodozyma. Current Genetics 30: 294-297. Ryu, K.H., Kim, S.J. & Park, W.M. 1998. Nucleotide sequence analysis of the coat protein genes of two Korean isolates of sweet potato feathery mottle potyvirus. Archives of Virology 143(3): 557-562. Schneider, W.L. & Roossinck, M.J. 2001. Genetic diversity in RNA virus Quasispecies is controlled by host-virus interaction. Journal of virology 75: 6566-6571. Shukla, D.D., Ward, C.W. & Brunt, A.A. 1994. The Potyviridae. Little Hampton, UK: CAB International. Sim, J., Valvaerde, R.A. & Clark, C.A. 2000. Whitefly transmission of sweetpotato chlorotic stunt virus. Plant Disease 84: 1250.

48 Sim, J., Valverde, R.A. & Clark, C.A. (unpublished) Sweetpotato crinivirus from Ipomoea batatas cv. White Bunch. unpublished (NCBI). Tairo, F., Jones, R.A.C. & Valkonen, J.P.T. 2006. Potyvirus complexes in sweet potato: occurrence in Australia, serological and molecular resolution, and analysis of the Sweet potato virus 2 (SPV2) component. Plant Disease 90: 1120-1128 Tairo, F., Kullaya, A. & Valkonen, J.P.T. 2004. Incidence of viruses infecting sweetpotato in Tanzania. Plant Disease 88: 916-920. Tairo, F., Mukasa, S.B., Jones, R.A., Kullaya, A., Rubaihayo, P.R. & Valkonen, J.P.T. 2005. Unravelling the genetic diversity of the three main viruses involved in sweet potato virus disease (SPVD), and its practical implications. Molecular Plant Pathology 6: 199-211. Tamura, K., Dudley, J., Nei, M. & Kumar, S. 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24: 1596-1599. Thompson, J.R., Leone, G., Lindner, J.L., Jelkmann, W. & Schoen, C.D. 2002. Characterization and complete nucleotide sequence of Strawberry mottle virus: a tentative member of a new family of bipartite plant picorna-like viruses. Journal of General Virology 83: 229-239 Tugume, A.K., Mukasa, S.B. & Valkonen, J.P.T. 2008. Natural wild hosts of Sweet potato feathery mottle virus show spatial differences in virus incidence and viruslike diseases in Uganda. Phytopathology 98: 640-652. Tyler, K.L. & Fields, B.N. 1996. Reoviruses. In B. N. Fields, D. M. Knipe, P. M. Howley, et al. (ed.), Virology, 3rd Edition. New York: Raven Press. 1597-1624 pp. Tzanetakis, I.E. & Martin, R.R. 2008. A new method for extraction of double-stranded RNA from plants. Journal of Virological Methods 149: 167-170. Ugent, D., Pozorski, S. & Pozorski, T. 1982. Archaeological potato tuber remains from the Casma Valley of Peru. Economic Botany 36: 182-192. Untiveros, M., Fuentes, S. & Kreuze, J. 2008. Molecular variability of sweet potato feathery mottle virus and other potyviruses infecting sweet potato in Peru. Archives of Virology 153(3): 473-483. Urcuqui-Inchima, S., Haenni, A. & Bernadi, F. 2001. Potyvirus proteins: a wealth of functions. Virus Research 74: 157-175.

49 Valverde, R., Lozano, G. & Navas-Castillo, J. 2004. First report of Sweet potato chlorotic stunt virus and Sweet potato feathery mottle virus infecting sweet potato in Spain. Plant Disease 88: 428. Valverde, R.A., Clark, C.A. & Valkonen, J.P.T. 2007. Viruses and virus disease complexes of sweetpotato. Plant Viruses 1(1): 116-126. Van Regenmortel, M.H.V., Fauquet, C.M., Bishop, D.H.L., Carstens, E.B., Estes, M.K., Lemon, S.M., Maniloff, J., Mayo, M.A., McGeoch, D.J., Pringle, C.R. & Wickner, R.B. 2000. Virus Taxonomy. Classification and Nomenclature of Viruses. Seventh Report of the International Committee on Taxonomy of Viruses. Academic Press, San Diego, CA. Wintermantel, W.M., Wisler, G.C., Anchieta, A.G., Liu, H.Y., Karasev, A.V. & Tzanetakis, I.E. 2005. The complete nucleotide sequence and genome organisation of tomato chlorosis virus. Archives of Virology 150: 2287-2298. Woolfe, J.A. 1992. Sweet Potato, an Untapped Food Resource. Cambridge University Press, NY. Yen, D.E. 1982. Sweetpotato in historical perspective. In: R.L. Villareal & T.D. Griggs (eds.). SweetPotato (Proceedings of First International Symposium, Tainan, Taiwan, China). AVRDC Publication No. 82-172., pp 17-30. Zhang, D., Cervates, J., Huaman, Z., Carey, E. & Ghislain, M. 2000. Assessing genetic diversity of sweet potato (Ipomoea batatas (L.) Lam.) cultivars from tropical America using AFLP. Genetic Resources Crop Evolution 47: 659-665. Zhang, D., Rossel, G., Kriegner, A. & Hijmans, R. 2004. AFLP assessment of diversity in sweetpotato from Latin America and the pacific region: its implications of the dispersal of the crop. Genetic Resources & Cop Evolution 51: 115-120.

50

8. Acknowledgements I would like to thank my supervisor Prof. Jari Valkonen for giving me opportunity, support, guidance, motivations and encouragement during the completion of project for Masters Thesis. Also thanks to my co-supervisor Tugume Arthur. I gratefully acknowledge Department of Applied Biology, University of Helsinki for providing me sponsored traineeship to complete the thesis work.

I am very thankful to Prof. Minna Pirhonen for all the consultation, kind suggestions and taking care of courses and Prof. Teemu Teeri for encouraging me and approving me to work in the lab and my traineeship for thesis work. My special thanks and appreciation to Dr. Roger A. C. Jones for kindly providing experimental plant material from Central American countries. I am also grateful to Minna Rajamäki, Shahid, Wilmer, Deus, Tuuli, Anssi, Robert, Laura, Tian, Johanna (Aura & Nykyri), Marjo (Ala-Poikela & Kilpinen), and all other people working in KPAT for supporting and guiding me while working in the lab, and my appreciations to my friends for giving me inspirations, cheering and bearing with me for not being in parties during my all working days for thesis.

Gratitude to my parents and family for their prayers, support and encouragements to make my thesis work full of inspirations. Finally, I dedicate my all of thesis work to my grand parents who are not with me anymore to appreciate my achievements.

51

9. APPENDICES APPENDICE I

NCM-ELISA buffers/solutions

TBS (pH 7.5): 0.02 M Tris Base 0.05 M NaCl Dissolve in sterile (ddH2O). Adjust pH to 7.5 with HCl. T-TBS (0.05% Tween-20 in TBS): 500 ml (TBS (pH 7.5) + 0.2 g Na2SO3 Blocking buffer: 240 ml TBS (pH 7.5) + 4.8 g skimmed powder milk + 4.8 ml Triton X-100

Antibody buffer: 240 ml TBS (pH 7.5) + 4.8 g skimmed powder milk

Conjugate buffer: 240 ml TBS (pH 7.5) + 4.8 g skimmed powder milk

AP-buffer pH 9.5 (substrate solution) 1 litre: 0.1 M Tris 0.1 M NaCl 5.0 mM MgCl2 Dissolve in sterile (ddH2O). Adjust pH to 9.5 with HCl

NBT (Nitiro Blue Tetrazolium, BIORAD): 2.5 mg BCIP / 83 µl N, N-dimethylformamide (DMF)

52 TAS-ELISA buffers/solutions

Coating Buffer (pH 9.6): 0.16 g Na2CO3 0.29 g NaHCO3 100 ml of dist, water

PBS-T (Washing buffer) 1 litre: 0.8 g NaCl 0.2 g KH2PO4 2.9 g Na2HPO4.2H2O 0.2 g KCL 1000 ml Dist. water 0.5 ml tween-20

Extraction buffer: 100 ml PBS-T 2 g PVP

Antibody buffer: PBS-T and PVP 1.25 g dried milk

Substrate buffer (pH 9.8): 9.7 ml of Diethanolamine 85 ml distilled water was added and the pH was adjusted with HCl.

53 APPENDICE II

Total RNA-extraction protocol (Invitrogen) Isolation of RNA using Trizol Reagent

1. Homogenization The weighed plant leaf tissue (100-200 mg) was taken in 2.0 ml Eppendorf tubes and immediately frozen in liquid nitrogen. The tissue was ground on liquid N2-cold block in the 2 ml Eppendorf tubes using grinding rods. TRIzol® Reagent (1000 l) was then added to the ground tissue in the tube, vortexed and left at room temperature for 10 min followed by centrifugation at 13,000 rpm for 10 min.

2. Phase Separation Supernatant was transferred to new tube to new tube with 400 l of chloroform, was shaken vigorously by hand for 15 seconds and left at room temperature for 2-15 min which was then subjected to centrifugation at 13,000 rpm for 15 min at 4°C. Afterwards, the aqueous phase (supernatant) was transferred to new tube.

3. RNA Precipitation The absolute iso-propanol (400 l) was added to the collected supernatant in 1.5 ml tube and mixed gently by inverting the tube contents, which was then allowed to stand for 20 min at room temp (RT) with occasional inversions to the tube. The next step involved the centrifugation at 13,000 rpm for 10 min at 4°C. The supernatant was discarded by pouring without disturbing the pellets at the bottom.

4. RNA Wash The pellet was washed with 1000 l of 75% Ethanol (DEPC Ethanol), was mixed by vortexing and spinning at 13,000 rpm for 5 min. The supernatant was then discarded carefully not to lose the pellet at the bottom followed by drying of pellet for 5-10 min at room temperature (over-drying was avoided that could reduce the solubility of the RNA)

5. Dissolving the RNA The pellet (RNA) was dissolved in 100 l RNase-free water. The RNA was also then warmed at 50°C to increase its solubility. The RNA was stored at -80°C.

54

Preparation of DEPC treated RNase-free H2O To prepare RNase-free, MILLI-Q water was drawn into RNAse-free bottle. The diethylpyrocarbonate (DEPC) was added to 0.01% (v/v). Let it stand overnight, then autoclaved. SDS (0.5%) solution may also be used to re-dissolve RNA but it must be prepared using DEPC-treated, autoclaved water.

Detection method using restriction enzymes

Flow chart 1. Detection method using restriction enzymes HindIII and PvuII.

55 APPENDICE III

Preparation of agarose gel (1%; 300 ml) One gram agarose was weighed and mixed in 300 ml TAE buffer (1X). The solution was boiled to dissolve the agarose very well in TAE buffer and let it cool down so that temperature of solution gains ~50°C. The appropriate amount of ethidium bromide (10 g / ml) was mixed and then poured off in the gel-tray for some time to solidify.

Preparation of Luria-Bertani (LB) media, 500 ml 12.5 gm of Luria-Bertani was weighed and MQ water was added up to the volume of 500 ml with proper mixing. The solution was then autoclaved for 20-25 min, which was then cooled down and stored at room temp.

Preparation of LB plates with ampicillin The autoclaved LB media was cooled down at room temp until the temp of LB ~50°C. The antibiotic ampicillin was then added to the final concentration of 100 µg / ml. The media (30-35 ml) was poured in 85 mm petri-dishes and let the media in plates solidify at room temp and stored at 4°C.

Cloning procedure (The pGEM®-T and pGEM®-T Easy Vector Systems) 1. Ligation 2X Rapid Ligation Buffer

5 l

pGEM®-T Easy Vector

1 l

PCR product

3 l

T4DNA Ligase (3 Weiss units/ l)

1 l

The reaction was mixed by pipetting and incubated overnight at 4°C.

2. Transformation Prepared LB plates were supplemented with 0.5 mM IPTG and 80 g / ml X-Gal and dried. High efficient competent cells (DH5a cells; 50 l) were taken out of -80°C and thawed on ice and then were transferred to ligation reaction (10 l). The mixture was gently flicked and left on ice for 20 min followed by heat-shock of cell for 45-50 seconds in a water bath exactly at 42°C and then transferred immediately to ice. The LB media (200 l) was added and shaked (~150rpm) at 37°C for 1.5 hours. The mixture

56 was then spread on LB plates (ampicillin/X-gal/IPTG) and incubated at 37°C for overnight (16-24 h). The white and blue color colonies developed. The white colonies were chosen to proceed to prepare mini-prep and plasmid extraction by considering that the white colonies contain the insert, whereas blue colonies do not have inserts due to galactosidase activity.

Procedure for adding 3' A-overhangs (Finnzymes)

Following procedure was adapted for TA cloning. A-tail was added with DyNAzyme II DNA Polymerase. 1. Reaction components: Purified PCR product 0.2 mM dATP 1X Optimized DyNAzyme™ Buffer 1 U DyNAzyme II DNA Polymerase The reaction mixture was incubated for 20 min at 72 °C. 2. Proceeded to TA cloning. For optimal ligation efficiency, fresh PCR products are recommended, since 3´A-overhangs may gradually be lost during storage.

57 APPENDICE IV

Buffer for dsRNA-extraction

Extraction buffer: 0.1 M NaCl 50 mM Tris, pH 8 1 mM EDTA, pH 8 1% SDS 1% 2-Mercaptoethanol 1% PVP powder

Application buffer: 0.1 M NaCl 50 mM Tris, pH 8 0.5 mM EDTA, pH 8 16.5% Ethanol

Elution buffer: 0.1 M NaCl 50 mM Tris, pH 8 0.5 mM EDTA, pH 8

58 APPENDICE V

SPFMV C/RC isolates (sequences)

59

60

61

62

63

64

65

66 APPENDICE VI

SPCSV isolates 1. HSP70h gene sequences Following are sequences of cDNA clones of infectious SPCSV from sweetpotao leaves, showing partial sequences of HSP70h gene.

>HN1 -------------------------------------------------- HSP70h ORF -------------------------------------TTCGAATCAACGGATCGGAATTTATCCCAACGTGTTTATCTATTACTAAGAG TGGTGATGTAATAGTCGGTGGTGCTGCACAAGTGTTAGATGCTTCTCAACTA CCGCACTGTTACTTCTACGATCTAAAACGATGGGTTGGGGTTGATAGGCTGT CTTTTGAAGAAATTAAACGTAAGATAGCTCCCCAGTATTCGGTCAAATTGGA AGGTAATGATGTTCTGATAACTGGTATTGATAAGGGGTATACTTGTACATAT ACGGTTAAACAATTAATTCTTCTTTATGTAGATACTCTTGTTAGGTTGTTTTC TAACGTTGAGAAGCTTAAGATTTTAAGTCTCAACGTGTCCGTCCCAGCAGAC TACAAAACAAAACAAAGAATGTTTATGAAGTCTGTTTGTGAATCGTTAGGTT TTCCTTTACGAAGAATA

>A3GT -------------------------------------------------- HSP70h ORF -------------------------------------TTCGAATCAACGGATCGGAATTTATCCCAACGTGTTTATCTATTACTAAGAG TGGTGATGTAATAGTCGGTGGTGCTGCACAAGTGTTAGATGCTTCTCAACTA CCGCACTGTTACTTCTACGATCTAAAACGATGGGTTGGGGTTGATAGGCTGT CTTTTGAAGAAATTAAACGTAAAATAGCTCCCCAGTATTCGGTCAAATTGGA AGGTAATGATGTTCTGATAACTGGTATTGATAAGGGGTATACTTGTACATAT ACGGTTAAACAATTAATTCTTCTTTATGTAGATACTCTTGTTAGGTTGTTTTC TAACGTTGAGAAGCTTAAGATTTTAAGTCTCAACGTGTCCGTCCCAGCAGAC TACAAAACAAAACAAAGAATGTTTATGAAGTCTGTTTGTGAATCGTTAGGTT TTCCTTTACGAAGAATA

67

>B1GT -------------------------------------------------- HSP70h ORF -------------------------------------TTCGAATCAACGGATCGGAATTTATCCCAACGTGTTTATCTATTACTAAGAG TGGTGATGTAATAGTCGGTGGTGCTGCACAAGTGTTAGATGCTTCTCAACTA CCGCACTGTTACTTCTACGATCTAAAACGATGGGTTGGGGTTGATAGGCTGT CTTTTGAAGAAATTAAACGTAAAATAGCTCCCCAGTATTCGGTCAAATTGGA AGGTAATGATGTTCTGATAACTGGTATTGATAAGGGGTATACTTGTACATAT ACGGTTAAACAATTAATTCTTCTTTATGTAGATACTCTTGTTAGGTTGTTTTC TAACGTTGAGAAGCTTAAGATTTTAAGTCTCAACGTGTCCGTCCCAGCAGAC TACAAAACAAAACAAAGAATGTTTATGAAGTCTGTTTGTGAATCGTTAGGTT TTCCTTTACGAAGAATA

>A1GT -------------------------------------------------- HSP70h ORF -------------------------------------TTCGAATCAACGGATCGGAATTTATCCCAACGTGTTTATCTATTACTAAGAG TGGTGATGTAATAGTCGGTGGTGCTGCACAAGTGTTAGATGCTTCTCAACTA CCGCACTGTTACTTCTACGATCTAAAACGATGGGTTGGGGTTGATAGGCTGT CTTTTGAAGAAATTAAACGTAAGATAGCTCCCCAGTATTCGGTCAAATTGGA AGGTAATGATGTTCTGATAACTGGTATTGATAAGGGGTATACTTGTACATAT ACGGTTAAACAATTAGTTCTTCTTTATGTAGATACTCTTGTTAGGTTGTTTTC TAACGTTGAGAAGCTTAAGATTTTAAGTCTCAACGTGTCCGTCCCAGCAGAC TACAAAACAAAACAAAGAATGTTTATGAAGTCTGTTTGTGAATCGTTAGGTT TTCCTTTACGAAGAATA

>B2GT -------------------------------------------------- HSP70h ORF -------------------------------------TTCGAATCAACGGATCGGAATTTATCCCAACGTGTTTATCTATTACTAAGAG TGGTGATGTAATAGTCGGTGGTGCTGCACAAGTGTTAGATGCTTCTCAACTA CCGCACTGTTACTTCTACGATCTAAAACGATGGGTTGGGGTTGATAGGCTGT CTTTTGAAGAAATTAAACGTAAAATAGCTCCCCAGTATTCGGTCAAATTGGA AGGTAATGATGTTCTGATAACTGGTATTGATAAGGGGTATACTTGTACATAT ACGGTTAAACAATTAATTCTTCTTTATGTAGATACTCTTGTTAGGTTGTTTTC TAACGTTGAGAAGCTTAAGATTTTAAGTCTCAACGTGTCCGTCCCAGCAGAC

68 TACAAAACAAAACAAAGAATGTTTATGAAGTCTGTTTGTGAATCGTTAGGTT TTCCTTTACGAAGAATA

>B3GT -------------------------------------------------- HSP70h ORF ------------------------------------TTCGAATCAACGGATCGGAATTTATCCCAACGTGTTTATCTATTACTAAGAG TGGTGATGTAATAGTCGGTGGTGCTGCACAAGTGTTAGATGCTTCTCAACTA CCGCACTGTTACTTCTACGATCTAAAACGATGGGTTGGGGTTGATAGGCTGT CTTTTGAAGAAATTAAACGTAAGATAGCTCCCCAGTATTCGGTCAAATTGGA AGGTAATGATGTTCTGATAACTGGTATTGATAAGGGGTATACTTGTACATAT ACGGTTAAACAATTAATTCTTCTTTATGTAGATACTCTTGTTAGGTTGTTTTC TAACGTTGAGAAGCTTAAGATTTTAAGTCTCAACGTGTCCGTCCCAGCAGAC TACAAAACAAAACAAAGAATGTTTATGAAGTCTGTTTGTGAATCGTTAGGTT TTCCTTTACGAAGAATA

>C1GT -------------------------------------------------- HSP70h ORF -------------------------------------TTCGAATCAACGGATCGGAATTTATCCCAACGTGTTTATCTATTACTAAGGG TGGTGATGTAATAGTCGGTGGTGCTGCACAAGTGTTAGATGCTTCTCAACTA CCGCACTGTTACTTCTACGATCTAAAACGATGGGTTGGGGTTGATAGGCTGT CTTTTGAAGAAATTAAACGTAAAATAGCTCCCCAGTATTCGGTCAAATTGGA AGGTAATGATGCTCTGATAACTGGTATTGGTAAGGGGTATACTTGTACATAT ACGGTTAAACAATTAATTCTTCTTTATGTAGATACTCTTGTTAGGTTGTTTTC TAACGTTGAGAAGCTTAAGATTTTAAGTCTCAACGTGTCCGTCCCTGCAGAC TACAAAACAAAACAAAGAATGTTTATGAAGTCTGTCTGTGAATCGTTAGGT TTTCCTTTACGAAGAATA

69