Detection of Anaplasma platys and other pathogens in ... - Parasitaria

Rev. Ibero-Latinoam. Parasitol. (2011); 70 (1): 42-48

Artículo Original

Detection of Anaplasma platys and other pathogens in ectoparasites from urban hosts in Northeast Argentine OSCHEROV E. B.1, MILANO A. M. F.1, LOBO B.2, ANDA P.2, ESCUDERO R.2

1

2

Laboratory of Biologia de los Parasitos, Facultad de Ciencias Exactas y Naturales y Agrimensura, Universidad Nacional del Nordeste, Corrientes, Argentine. Laboratory of Espiroquetas y Patógenos Especiales, Servicio de Bacteriología, Centro Nacional de Microbiología, Instituto de Salud Carlos III, Madrid, Spain.

ABSTRACT The main aim of the present study was to assess the rate of arthropod-borne bacteria in ticks and fleas collected from domestic dogs in an urban area of Corrientes, Northeastern Argentina. For the molecular analyses we selected a total of 79 Rhipicephalus sanguineus, one Amblyomma tigrinum and 15 Ctenocephalides felis. Three sets of duplex PCR were used, one targeting Anaplasma/Ehrlichia and Coxiella, another one Bartonella and Francisella, and a third one targeting Borrelia and Rickettsia. Positive samples were confirmed by hybridization using reverse line blotting and/or automated sequencing. Anaplasma platys, A. phagocytophilum, Borrelia sp. and the spotted fever group of Rickettsias were detected in R. sanguineus and Francisella-like endosymbionts in A. tigrinum. Two specimens of C. felis were positive for R. felis and Bartonella spp., respectively. It has to be highlighted that the arthropod specimens tested were collected form dogs in a human environment and they are well known as agents of severe human zoonoses. Key words: arthropod vectors, zoonoses, Anaplasma platys, Rickettsia felis, Bartonella. RESUMEN El objetivo del presente estudio fue detectar la presencia de patógenos en garrapatas y pulgas de canes domésticos en un área urbana de Corrientes, Nordeste de Argentina. Para el análisis molecular fueron seleccionados 79 ejemplares de Rhipicephalus sanguineus, uno de Amblyomma tigrinum y 15 de Ctenocephalides felis. Fueron utilizados tres sets duplex de PCR, dirigidos contra el genoma de Anaplasma/ Ehrlichia y Coxiella, Bartonella y Francisella, y Borrelia y Rickettsia, respectivamente. Las muestras positivas fueron confirmadas por hibridación utilizando un soporte de línea reversa y/o secuenciación. Anaplasma platys, A. phagocytophilum, Borrelia sp. y el grupo de las fiebres manchadas Rickettsia fueron detectados en R. sanguineus y Francisella como endosimbiontes en A. tigrinum. Dos ejemplares de C. felis fueron positivos para R. felis y Bartonella spp., respectivamente. Se destaca que los artrópodos evaluados Recibido: 25 de Febrero de 2011. Aprobado 12 de Mayo de 2011. Correponding: Elena Beatriz Oscherov, Laboratorio de Biología de los Parásitos, Departamento de Biología, Facultad de Ciencias Exactas y Naturales y Agrimensura, Universidad Nacional del Nordeste. Campus Universitario. Avenida Libertad 5470. 3400 Corrientes, Argentina. E-mail: [email protected]

42

ANAPLASMA PLATYS, RICKETTSIA FELIS, ARGENTINE

fueron colectados de perros domésticos, conviviendo con humanos y los patógenos detectados son bien conocidos como agentes de zoonosis graves. Palabras clave: Artrópodos vectores, zoonosis, Anaplasma platys, Rickettsia felis, Bartonella

INTRODUCTION

MATERIAL AND METHODS

The Public Health importance of the haematophagous ectoparasites, ticks (Arachnida: Parasitiformes) and fleas (Insecta: Siphonaptera), stems from that they parasitize both wild and domestic reservoirs and humans and have become one of the most important vectors of human pathogens worldwide, including viruses, bacteria, protozoa, cestods and nematodes (Guglielmone & Nava, 2006; Labruna et al, 2007). The rickettsiosis caused by Rickettsia felis is considered an emerging zoonosis. In Argentina, R. felis has been recently detected in fleas (Ctenocephalides felis) from domestic dogs (Nava et al, 2007). Also, a serological study performed in Jujuy, Northwest Argentina, found antibodies against spotted fever and typhus groups (using R. rickettsii and R. typhi antigens), whose possible vector would be Amblyomma cajennense (Ripoll et al, 1999); more recently, R. parkeri has been detected in 7.6% of A. triste specimens collected in the lower Paraná River Delta (Nava et al, 2008), and R. rickettsii in A. cajennense in the province of Jujuy and in a patient retrospectively studied (Paddock et al, 2008); finally, R. massiliae has been detected in the area both in vectors (Ciccutin et al, 2004) and in a patient (García-García et al, 2010). Ehrlichia chaffeensis has been recently detected in Argentinian A. parvum (Tomassone et al, 2008). Canine ehrlichiosis, transmitted by Rhipicephalus sanguineus, was previously described in Chile and, recently, Anaplasma platys was identified as its causative agent in the area (Abarca et al, 2007). Finally, previous serological surveys in humans in Brazil and Argentina found anti-anaplasma/ehrlichia antibodies (Ripoll et al, 1999; Calic et al, 2004). Taking into account all these antecedents, the objective of the present study was to assess the occurrence of arthropod-borne pathogens in ticks and fleas collected from domestic dogs in an urban area of the province of Corrientes, Northeast Argentina.

This study was performed in Santa Ana de los Guacaras, Corrientes, Argentina (27º 27’ S, 58º 45’ W). It is a village characterized by unpaved streets and extensive areas covered in autochthonous vegetation. It has 1497 permanent residents. There is little variation between summer (mean: 27º C) and fall (mean: 16º C) temperatures in the area, with 5-6 days below freezing, determining a mesothermal climate. The pluviosity is of up to 1500 mm per year, with frequent rainfalls in fall and scarce in January (Carnevalli, 1994). Seventy four dogs (Canis familiaris) from 45 houses were included in the study. Ticks and fleas were collected with tweezers and preserved in 96º ethanol at room temperature until use; from heavily parasitized animals, only 1 sample of ectoparasites was collected, following a humane protocol ethically approved by our institution. Specimens were sent to the Laboratorio de Biología de los Parásitos, Facultad de Ciencias Exactas y Naturales y Agrimensura, of the Universidad Nacional del Nordeste. Specimens were studied under magnification with a Leica Zoom 2000 stereomicroscope, identified at the species level using taxonomic keys, and counted and classified by sex and stage. For the molecular analyses, only one or two non-engorged ticks were selected from each animal, making a total of 79 R. sanguineus and a female specimen of A. tigrinum. Adults were tested individually and nymphs from the same host were pooled in groups of 6 and tested together. Fifteen specimens of C. felis, collected from 15 dogs were also studied. The methodology used consisted of 3 sets of duplex PCR, targeting Anaplasma/Ehrlichia and Coxiella (16S rRNA and IS1111, respectively), Bartonella and Francisella (16S-23S rRNA ITS and lpnA), and Borrelia and Rickettsia (16S rRNA and 5S-23S rRNA ITS), respectively, as described elsewhere (Barandika et al, 2008; Toledo et al, 2009a; Toledo et al, 2009b) (Table 1). Positive


43

E.B. OSCHEROV et al.

samples were confirmed by hybridization using reverse line blotting (RLB) and/or sequencing, as described (Gil et al, 2005; Anda et al, 2006; Jado et al, 2006; Escudero et al, 2008; García-Esteban et al, 2008). Sequences obtained in this study have been submitted to GenBank under the following accession numbers: HM222602 for A. platys ApArg1, HM222603 for R. felis RfArg1, and HM222604 for FLEs EFlArg1. RESULTS Sixty seven dogs were found parasitized by ticks (prevalence of 90.5%), R. sanguineus being found on 63.5% of dogs (47/74) and A. tigrinum on 8.1% (6/74). Fourty two dogs were found parasitized by fleas (42/74; 56.8%). One hundred and six C. felis were collected. The biological material in conditions to be

examined consisted of 64 ticks and 15 fleas. The overall prevalence of infection in ixodids was of 21.9-37.5%, depending on whether a minimum of 1 or a maximum of 6 positive nymphs in each pool of 6 analyzed were positive. Detected pathogens in R. sanguineus were A. platys (5 adult and 2 nymph pools), A. phagocytophilum (2 males), Borrelia sp. (1 male and 1 female) and spotted fever group (SFG) Rickettsia (3 males) (Figure 1). For the latter two agents, no sequence data were available due to the lack of samples for confirmation. HERE FIGURE Table 2 shows the frequency of appearance of the pathogens identified in R. sanguineus, sorted by the developmental stage of the specimens. In a female specimen of A. tigrinum a Francisella-like endosymbiont (FLE) was detected. From the 15 specimens of C. felis tested, 1 was positive for R. felis and a second for Bartonella spp. Sequence data from the latter were not available due to the lack of samples.

Figure 1. RLB results of different samples as in Table 2. The name of the probes used is shown on the left of each image. Panel A: C. burnetii, specific probe for this agent; S-BART 16S: generic probe for Bartonella spp.; P-16S-BOR: generic probe for Borrelia sp.; P-FRAG: generic probe for Francisella spp.; GP-RICK: generic probe for Rickettsia spp. Panel B: P-PHA, specific probe for A. phagocytophilum; P-PLA, specific probe for A. platys; P-CHA, specific probe for E. chaffeensis; P-EWI, specific probe for E. ewingii. Panel A: Lane 1, C. burnetii positive control; lane 2, negative sample; lane 3, B. burgdorferi sensu stricto positive control; lane 4, Borrelia sp. positive sample; lane 5, B. henselae positive control; lane 6, Bartonella spp. positive sample; lane 7, negative control (water); lane 8, F. tularensis positive control; lane 9, Francisella-like endosymbiont positive sample; lane 10, R. conorii positive control; lane 11, Rickettsia spp. positive sample. Panel B: Lane 1, A. phagocytophilum positive control; lane 2, A. platys positive control; lane 3, E. chaffensis positive control; lane 4, E. ewingii positive control; lane 5, A. phagocytophilum positive sample; lane 6, A. platys positive sample; lane 7, negative control (water).

44


ANAPLASMA PLATYS, RICKETTSIA FELIS, ARGENTINE

Table 1. Sequences of primers and probes used in this study. Bacterium

Oligonucleotide

Target gene

Sequence (5´-3’)a

Reference

Primers A. phagocytophilum

16S/AEFmod

16S rRNA

CAGAACGAACGCTRGCGGYARG

(Anda et al., 2006)

Ehrlichia spp.

16S/AE-Rmod

16S rRNA

b-GCRTTACKCACCCGTCTGCCAC

(Anda et al., 2006)

Bartonella

P24Emod

16S rRNA

CCTTCAGTTMGGCTGGATC

(García-Esteban et al., 2008)

16S-R

16S rRNA

b-GCCYCCTTGCGGTTAGCACAGCA


BORF

16S rRNA

CGCTGGCAGTGCGTCTTAA

(Gil et al., 2005)

16S3B

16S rRNA

b-GCGGCTGCTGGCACGTAATTAGC

(Gil et al., 2005)

Trans 1

htpAB

TATGTATCCACCGTAGCCAGTC

(Bandarika et al., 2008)

Trans 2

htpAB

b-CCCAACAACACCTCCTTATTC


FT593

lpnA

GYAGGTTTAGCKAGCTGTTCTAC

(Escudero et al., 2008)

FT825

lpnA

b-GGAGCYTGCCATTGTAATCTTAC


RCK/23-5-F

23S-5S rRNA

GATAGGTCRGRTGTGGAAGCAC

(Jado et al., 2006)

RCK/23-5-R

23S-5S rRNA

b-TCGGGAYGGGATCGTGTGTTTC

(Jado et al., 2006)

A. phagocytophilum

P-PHA

16S rRNA

a-GGMTTATTCTTTATAGCTTGCT

(Anda et al., 2006)

E. chaffeensis

P-CHA

16S rRNA

a-ATTGCTTATAACCTTTTGGTT

(Anda et al., 2006)

E. ewingii

P-EWI

16S rRNA

a-GAACAATTCCTAAATAGTCTC

(Anda et al., 2006)

A. platys

P-PLA

16S rRNA

a-GATTTTTGTCGTAGCTTGCTATG

(Anda et al., 2006)

Bartonella

S-BART16S

16S rRNA

a-CTCGCCCTTAGTTGCCAGCATT


Borrelia

P-16S-BOR

16S rRNA

a-GAGGAATAAGCTTTGTAGGAAATGACA

(Gil et al., 2005)

F. tularensis

P-FRAG

lpnA

a-TAAAATAAAAGCAACTGTATATACARC


Coxiella burnetii

C. burnetii

htpAB

a-GCAAGAATACGGACTCACGA


Rickettsia spp.

GP-RICK

23S-5S rRNA

a-TAGCTCGATTGRTTTACTTTG

(Jado et al., 2006)

SFG Rickettsia

GP-SFG

23S-5S rRNA

a-ACTCACAARGTTATCAGGT

(Jado et al., 2006)

R. felis

P-FEL

23S-5S rRNA

a-TAATGTTATACCGTGGTCCCGC

(Jado et al., 2006)

Borrelia Coxiella burnetii

Francisella spp.

Rickettsia Probes

a: b: biotin modification; a: C6 aminolink modification

DISCUSSION In Argentina, the study of tick-borne pathogens has intensified during the last decade, detecting antibodies against spotted fever group rickettsiae in patients (Ripoll et al, 1999; Seijo et al, 2007), as


well as R. rickettsii and R. typhi in A. cajennense (Ripoll et al, 1999), R. massiliae in R. sanguineus (Cicuttin et al, 2004), E. chaffeensis en A. parvum and A. cajennense (Tomassone et al, 2008) and R. parkeri in A. triste (Nava et al, 2008). In this study we added A. platys, A. phagocytophilum, Borrelia

45

E.B. OSCHEROV et al.

Table 2. Arthropod-borne bacteria detected in Rhipicephalus sanguineus sorted by stage Pathogens

Nymphs n = 40

Male n = 17

Female n=7

Total Positive (%)

Anaplasma platys

2 pools (2-12a)

4

1

7-17 (10.9-26.6)a

A. phagocytophilum

0

2

0

2 (3.1)

Borrelia sp.

0

1

1

2 (3.1)

SFG Rickettsia

0

3

0

3 (4.7)

Total

2 pools (2-12 a)

10

2

14-24 (21.9-37.5)a

a: Maximum number of positive and percentages would correspond to the case in which all the six nymphs from each pool were positive

sp. and SFG Rickettsia found in R. sanguineus. We were unable to confirm whether the Borrelia detected in 1 specimen belongs to B. burgdorferi sensu lato or not. Further studies will be performed to confirm this point. Also, the vectorial role of R. sanguineus for this Borrelia could not be directly inferred from these data and it needs to be further assessed, although these findings confirm that Borrelia sp. is circulating in Argentina. A. platys is the causative agent of canine anaplasmosis, infecting platelets with the subsequent production of thrombocytopenia (Dumler et al, 2001). Evidence of the zoonotic potential of A. platys is scarce, although some authors suggest a hypothetical pathogenic role for A. platys in humans, based on serological results (Abarca et al, 2008). However, this has not been further confirmed. A. phagocytophilum infects granulocytes, causing human granulocytic anaplasmosis (Abarca et al, 2008). In consultations made at health primary assistance and veterinarian centers of the study area, no information about suspected cases of the diseases studied here was obtained; serological studies would be needed to assess their impact on human and veterinarian health. The detection of R. felis in C. felis is the second citation for this agent in Argentina and the first in the Corrientes province. This pathogen was found by Nava et al, (2007) in fleas collected from dogs in the Santa Fe province. Also, in México, Brazil and Uruguay C. felis specimens were found infected by R. felis (Zavala-Velázquez et al, 2002; Horta et al, 2005; Venzal et al, 2006). The distribution of this rickettsiosis is wide, with human cases reported in different continents (Nava et al, 2007; Horta et al, 2005; Pérez-Arellano et al, 2005). However, there

46

have been no reports of human cases in Argentina, probably due to underdiagnosis. No previous reports were found regarding Bartonella spp. in C. felis in Argentina. Its detection together with R. felis in C. felis has been previously described in Spain and the Democratic Republic of the Congo (Blanco et al, 2006; Sackal et al, 2008), highlighting the risk of a possible simultaneous transmission of both pathogens by the same bite. Finally, based on 16S rRNA sequences, several organisms have been classified as probable members of the Francisellaceae family, including the so-called Francisella-like endosymbionts (FLEs) (Sun et al, 2000; Scoles, 2004). There are no published data regarding the pathogenic role of FLEs to humans, although their pathogenicity to guinea pigs and hamsters was demonstrated earlier (Burgdorfer et al, 1973). These data provide the first description of a member of the Francisellaceae family circulating in Argentina. It has to be highlighted that the arthropod specimens tested in this study were collected form dogs in a human environment and are well known as agents of severe human zoonoses such as spotted fevers, haemolytic processes and typhuslike diseases in several parts of America. Given their importance in human disease, a more through investigation is necessary, along with actions to control the vectors. REFERENCES 1.

ABARCA K, LÓPEZ J, GONZÁLEZ P, DABANCH J, TORRES M, SOLARI V, et al. 2008. Evidencia serológica de exposición humana a Anaplasma sp. en Santiago, Chile. Rev Chil Infect, 25: 358-361.


ANAPLASMA PLATYS, RICKETTSIA FELIS, ARGENTINE 2. 3.

4.

5.

6.

7.

8. 9.

10.

11.

12.

13.

14.

15.

ABARCA K, LÓPEZ J, PERRET C, GUERRERO J, GODOY P, VELOZ A, et al. 2007. Anaplasma platys in dogs, Chile. Emerg Infect Dis, 13: 1392-1395. ANDA P, ESCUDERO R, RODRÍGUEZ-MORENO I, JADO I, JIMÉNEZ-ALONSO MI. 2006. Method and kit for the detection of bacterial species by means of DNA. U.S. patent WO/2006/136639. BARANDIKA JF, HURTADO A, GARCÍA-SANMARTÍN J, JUSTE RA, ANDA P, GARCÍA-PÉREZ AL. 2008. Prevalence of tick-borne zoonotic bacteria in questing adult ticks from northern Spain. Vector Borne Zoonotic Dis, 8: 829-835. BLANCO JR, PÉREZ-MARTÍNEZ L, VALLEJO M, SANTIBÁÑEZ S, PORTILLO A, OTEO JA. 2006. Prevalence of Rickettsia felis and Bartonella spp. in Ctenocephalides canis from La Rioja (Northern Spain). Ann N Y Acad Sci, 1078: 270-274. BURGDORFER W, BRINTON LP, HUGHES LE. 1973. Isolation and characterization of symbionts from the Rocky Mountain wood tick, Dermacentor andersoni. J Invertebrate Pathol, 22: 424-434. CALIC SB, GALVÃO MAM, BACELLAR F, ROCHA CM, MAFRA CL, LEITE RC, WALKER DH. 2004. Human ehrlichiosis in Brazil: First suspect cases. Braz J Infect Dis, 8: 259-262. CARNEVALLI R. 1994. Fitogeografía de la Provincia de Corrientes. Inst Nac Tec Agrop Corrientes, Argentina. CICUTTIN GL, RODRÍGUEZ VARGAS M, JADO I, ANDA P. 2004. Primera detección de Rickettsia massiliae en la ciudad de Buenos Aires. Resultados preliminares. Rev Argentina Zoonosis, 1: 8-10. DUMLER JS, BARBET AF, BEKKER CP, DASCH GA, PALMER GH, RAY SC, et al. 2001. Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: unifications of some species of Ehrlichia with Anaplasma, Cowbria with Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and HE agent’ as subjective synonyms of Ehrlichia fhagocytophila. Int J Syst Evol Microbiol, 51: 2145-2165. ESCUDERO R, TOLEDO A, GIL H, KOVÁCSOVÁ K, RODRÍGUEZ-VARGAS M, JADO I, et al. 2008. Molecular method for discrimination between Francisella tularensis and Francisella-like endosymbionts. J Clin Microbiol, 46: 3139-3143. GARCÍA-ESTEBAN C, GIL H, RODRÍGUEZVARGAS M, GERRIKAGOITIA X, BARANDIKA JF, ESCUDERO R, et al. 2008. Molecular method for Bartonella species identification in clinical and environmental samples. Appl Environ Microbiol, 46: 776-779. GARCÍA-GARCÍA JC, PORTILLO A, NÚÑEZ MJ, SANTIBÁÑEZ S, CASTRO B, OTEO JA. 2010. A patient from Argentina infected with Rickettsia massiliae. Am J Trop Med Hyg, 82: 691-692. GIL H, BARRAL M, ESCUDERO R, GARCÍAPÉREZ AL, ANDA P. 2005. Identification of a new Borrelia species among small mammals in endemic Lyme disease areas in northern Spain. Appl Environ Microbiol, 71: 1336-1345. GUGLIELMONE AA, NAVA S. 2006. Las garrapatas


16.

17.

18.

19.

20.

21.

22.

23.

24.

25. 26.

27. 28.

29.

del género Amblyomma como parásitos de humanos en la Argentina. In: Temas de Zoonosis III. Buenos Aires: Asociación Argentina de Zoonosis, 269-277. HORTA MC, PINTER A, CORTÉZ A, SOARES RM, GENNARI SM, SCHUMAKER TTS, et al. 2005. Rickettsia felis (Rickettsiales: Rickettsiaceae) in Ctenocephalides felis felis (Siphonaptera: Pulicidae) in the States of São Paulo, Brazil. Arq Bras Med Vet Zootec, 57: 321- 325. JADO I, ESCUDERO R, GIL H, JIMÉNEZ-ALONSO MI, SOUSA R, GARCÍA-PÉREZ AL, et al. 2006. A molecular method for the identification of Rickettsia species in clinical and environmental samples. J Clin Microbiol, 44: 4572-4576. LABRUNA MB, MCBRIDE JW, CAMARGO LMA, AGUIAR DM, YABSLEY MJ, DAVIDSON WR, et al. 2007. A preliminary investigation of Ehrlichia species in ticks, humans, dogs and capybaras from Brazil. Vet Parasitol, 143: 189-195. NAVA S, ELSHENAWY Y, EREMEEVA ME, SUMNER JW, MASTROPAOLO M, PADDOCK CD. 2008. Rickettsia parkeri in Argentina. Emerg Infect Dis, 14: 1894-1897. NAVA S, PÉREZ-MARTÍNEZ L, VENZAL JM, PORTILLO A, SANTIBÁÑEZ S, OTEO JA. 2007. Rickettsia felis in Ctenocephalides felis from Argentina. Vector Borne Zoonotic Dis, 8: 465-466. PADDOCK CD, FERNÁNDEZ S, ECHENIQUE GA, SUMNER JW, REEVES WK, ZAKI SR, et al. 2008. Rocky Mountain spotted fever in Argentina. Am J Trop Med Hyg, 78: 687-692. PÉREZ-ARELLANO JL, FENOLLAR F, ANGELMORENO A, BOLAÑOS M, HERNÁNDEZ M, SANTANA E, et al. 2005. Human Rickettsia felis infection, Canary Islands, Spain. Emerg Infect Dis, 11: 1961-1964. RIPOLL CM, REMONDEGUI CE, ORDONEZ G, ARAZMENDI R, FUSARO H, HYMAN, et al. 1999. Evidence of rickettsial spotted fever and ehrlichial infections in a subtropical territory of Jujuy, Argentina. Am J Trop Med Hyg, 6: 350-354. SACKAL C, LAUDISOIT A, KOSOY M, MASSUNG R, EREMEEVA ME, KARPATHY SE, et al. 2008. Bartonella spp. and Rickettsia felis in fleas, Democratic Republic of Congo. Emerg Infect Dis, 14: 1972-1974. SCOLES GA. 2004. Phylogenetic analysis of the Francisella-like endosymbionts of Dermacentor ticks. J Med Entomol, 41: 277-286. SEIJO A., PICOLLO M., NICHOLSON W., PADDOCK C. 2007. Rickettsial spotted fever in the Paraná Delta. An emerging disease. Medicina (Buenos Aires), 67: 723-726. SUN LV, SCOLES GA, FISH D, O’NEILL SL. 2000. Francisella-like endosymbionts of ticks. J Invertebr Pathol, 76: 301-303. TOLEDO A, JADO I, OLMEDA AS, CASADONISTAL MA, GIL H, ESCUDERO R, ANDA P. 2009a. Detection of Coxiella burnetii in ticks collected from Central Spain. Vector Borne Zoonotic Dis, 9: 465-468. TOLEDO A, OLMEDA AS, ESCUDERO R, JADO I, VALCÁRCEL F, CASADO-NISTAL MA, RODRÍGUEZ-VARGAS M, GIL H, ANDA P. 2009b Tickborne zoonotic bacteria in ticks collected from central

47