Detection of precursor Th cells in mesenteric lymph nodes ... - CiteSeerX

International Immunology, Vol. 9, No. 10, pp. 1555–1562

© 1997 Oxford University Press

Detection of precursor Th cells in mesenteric lymph nodes after oral immunization with protein antigen and cholera toxin Michael P. Schaffeler, Jennifer S. Brokenshire and Denis P. Snider Department of Pathology, Intestinal Disease Research Programme, HSC-3N26, McMaster University, 1200 Main Street West, Hamilton, Ontario L8N 3Z5, Canada Keywords: cholera toxin, IL-4, IFN-γ, mucosal immunity, T helper cell, T cell precursor

Abstract We have characterized the earliest antigen-specific Th cells in murine mesenteric lymph nodes (MLN), following oral immunization with the hen egg lysozyme (HEL) as antigen and cholera toxin (CT) as adjuvant. We did this by analyzing in vitro proliferation and cytokine production in response to HEL by the MLN T cells. MLN cells taken 5 days after a single oral immunization with HEL and CT provided the earliest source of proliferating HEL-specific T cells. This proliferation was completely inhibited by anti-IL-2, but not inhibited by anti-IL-4 antibody. IL-2 protein was detected in culture supernatants but not IL-4 using ELISA or bioassays. IL-4 mRNA was not found in responding cells using RT-PCR. Some of the day 5 MLN cultures produced IFN-γ in response to HEL, but isolated T cells from the same MLN did not. Exogenous IL-4 alone did not stimulate day 5 MLN T cells, but IL-4 did synergize with HEL to induce a large proliferative response. The data indicate that the HEL-specific CD4 T cell pool in MLN 5 days after oral immunization is composed of undifferentiated precursor Th cells. These cells have the potential for IL-2 production and IL-4R expression upon re-stimulation in vitro. Introduction Cholera toxin (CT) is a potent adjuvant for induction of mucosal IgA responses when given orally with protein antigens (1,2). Recent work has indicated that IgE and IgG1 antibody responses are elevated, together with allergic sensitization, in mice immunized orally with CT (3,4). The preferential expansion of antigen-specific Th2 cells has been argued as an explanation for the oral adjuvant function of CT (5,6). Both the identification of IL-4-producing, antigen-specific Th2 cells (5,6), and the lack of response in IL-4-deficient mice (7), are consistent with the Th2 hypothesis. However, other studies showed contrasting data that indicated a mixed phenotype of Th cell response induced by CT (8,9). Both IL-4 and IFN-γ were produced by antigen-specific T cells, isolated from mesenteric lymph node (MLN) or Peyer’s patches of mice in these studies. One of the interpretive problems in all of the preceding work is that nearly all experiments have used repeat immunization (at 7–10 day intervals), in order to maximize response. Response under those conditions must involve overlap of CT effects on both naive and differentiated antigen-specific Th cells. In addition, the effect(s) of repeat

antigen stimulation in vivo on the developing Th response were also not defined. This is an important consideration, because in vitro evidence indicates that repeat antigenic exposure results in preferential Th2 differentiation from naive Th cells (10). Examination of the primary Th response to antigen can give a clearer interpretation of the effects of CT on Th cell differentiation in vivo. In the current paradigm, the cytokine microenviroment in the initial stage(s) of Th cell differentiation determines the functional fate of the Th cells (11–14). The balance of activities by IL-2, IL-4, IFN-γ and IL-12 seems to determine the production of Th1 or Th2 effector cells (15). The murine precursor Th cell (pTh), when stimulated by antigen or other TCR ligation, will produce IL-2 that drives its own proliferation (16,17). If under the same conditions pTh cells are exposed to IL-12 and/or IFN-γ in the presence of appropriate co-stimulators, they will differentiate preferentially into Th1-type cells, producing IFN-γ and IL-2 upon re-stimulation (18,19). When exposed to IL-4, in the absence of IFN-γ, the pTh cells will proliferate and differentiate into Th2-type cells (10,20). These Th2 cells

Correspondence to: D. Snider Transmitting editor: J. W. Schrader

Received 10 October 1997, accepted 30 June 1997

1556 Precursor Th cells in MLN after oral immunization make their own IL-4 for proliferation, and other cytokines such as IL-10 and IL-5. It is significant that along either differentiation pathway, one of two cytokines (IL-2 or IL-4) is primarily responsible for ongoing proliferation. These particular characteristics of the early cytokine response by pTh cells, contrasted with those of differentiated Th subsets, allowed us to identify pTh cells in MLN, following oral immunization. We decided to examine the earliest proliferative response of hen egg lysozyme (HEL)-specific T cells in MLN, after a single oral immunization with HEL and CT. We focused on T cells in the MLN rather than the Peyer’s patch for two reasons. First, it is known that CD4 T cells move to and are re-stimulated in the MLN, after intestinal antigen exposure (21,22). Thus, we presumed that the initial pTh cells or their immediate descendants (possibly differentiated) would be detected in MLN soon after oral immunization. Second, while the activities of CT on Th cell generation have been argued to occur primarily in the Peyer’s patches (23), there has been no formal exclusion of the ability of CT to alter Th cell activity by influencing other areas of the intestinal mucosa. For instance, CT could alter cells in the lamina propria, such as antigenpresenting cells (APC) or regulatory T cells. These cells could then migrate to the MLN and modify the subsequent differentiation of antigen-specific Th cells. If CT directly alters the inductive environment of the Peyer’s patch to bias the response to Th2 (5), then within our model we would expect production of IL-4 and possibly an autocrine proliferative response to IL-4 by HEL-specific cells in the MLN. If, on the other hand, pTh are induced in the Peyer’s patch but do not differentiate, then these pTh would arrive at the MLN where their differentiation fate may be determined by conditions in the MLN. If T cells in the MLN respond with both IL-4 and IFN-γ, then differentiation would have begun, but the cells could be Th0, or mixtures of Th0, Th1 and Th2. Alternatively, if the early MLN Th cells had not begun to differentiate to any Th lineage, then there would be no IL-4 or IFN-γ production. Production of IL-2 alone would indicate that HEL-specific undifferentiated pTh cells were responding. The key question is whether the earliest HEL-specific T cells in the MLN are predominantly of the precursor type or have already begun to differentiate. The results of our studies indicate that the earliest antigen-specific T cells to reach the MLN have not differentiated into Th0, Th1 or Th2 cells, but appear still to be in the pTh stage. Methods Mice and oral immunizations Female C3H/He mice (Charles River, Montreal, Canada), were purchased at 5–7 weeks of age and housed in the central animal facility at McMaster Health Science Centre. For oral immunization, mice were given a single dose of 300 µg of HEL (Sigma, St Louis, MO) mixed with 10 µg of CT (List Biological, Campbell, CA), in 400 µl of 0.2 M sodium bicarbonate solution. Mice were deprived of food for 4 h prior to inoculation. The solution of CT and HEL was administered intra-gastrically, using a blunted 16 gauge needle. Isolation of MLN, spleen and T cells MLN or spleen were isolated from two to three mice by a sterile technique and placed in 10 ml HBSS at 4°C. Cell

suspensions from spleen or MLN were prepared by mechanically disrupting each tissue between two sterile glass slides, filtering the release cells through 60 µm sterile nylon mesh and centrifugation at 4°C. The cell pellets were resuspended in 1 ml of erythrocyte lysis solution (0.15M NH4Cl, 10 mM KHCO3, 0.1 mM EDTA) for 1 min and then washed in HBSS. Spleen cells were irradiated at 3000 rad (137Cs source) when used as a source of APC. Single-cell suspensions from MLN or spleen were stained with Trypan blue and viable cells counted using a hemocytometer. Purified T cells from MLN were prepared by treating MLN cells with J11.d mAb (24) in HBSS at 4°C, followed by LowTox rabbit complement (Cedarlane, Hornby, Ontario, Canada) and incubation at 37°C in order to deplete B cells. Adherent APC were then removed by a 2 h incubation (37°C) of the B cell-depleted cells on a Sephadex G10 (Pharmacia, Uppsala, Sweden) column equilibrated with complete medium, RPMI5 (RPMI 1640 with 2 mM of L-glutamine, 16 µg/ml of gentamicin, 50 µM 2-mercaptoethanol, 1% penicillin–streptomycin, 2 mM sodium pyruvate and 5% heat-inactivated FCS). Cells were eluted with RPMI-5 at 37°C. The T cell preparations were routinely .98% CD31 and ,1% B2201, and contained 80–85% CD4 T cells, together with 10–15% CD8αβ T cells (flow cytometry data, not shown). In vitro HEL-specific proliferation and inhibition by anti-IL-2 or anti-IL-4 mAb MLN or MLN T cells were cultured in RPMI-5 for 72 h, with or without HEL, to determine proliferative responses to HEL. MLN cells were seeded at 83105 cells per well. MLN T cells were seeded at 43105 cells per well, with 53105 irradiated spleen cells as APC from naive donors. Cultures were pulsed with 1 µCi of [3H]thymidine (Dupont/NEN, Mississauga, Ontario, Canada) for the final 24 h. Cells were harvested using a PHD Harvester (Cambridge Technologies, Cambridge, MA) and incorporated [3H]thymidine counted in a β-counter. In preliminary experiments, using MLN cells at day 7 postimmunization, significant proliferation was obtained using HEL in dosages of 50–400 µg/ml, but not at ,10 µg/ml (data not shown). For most experiments 200 µg/ml of HEL was used. Other preliminary experiments showed substantial [3H]thymidine uptake by 72 h of culture (but not at 24 or 48 h). Therefore, 72 h was used routinely. The anti-IL-4 mAb BVD4-1D11 (25) and the anti-IL-2 mAb S4B6 (26) were purchased from PharMingen (San Diego, CA). The anti-IL-4 mAb 11B11 (27) and anti-IFN-γ mAb R46A2 (28) were isolated from hybridoma culture supernatants in our laboratory, using cells purchased from the ATTC (Rockville, MD). For antibody inhibition of proliferation, cultures received neutralizing concentrations of anti-IL-2 (150 ng/ml), anti-IL-4 (80 ng/ml) or anti-IFN-γ (150 ng/ml) mAb. The abilities of both anti-IL-4 mAb (BVD4-1D11 or 11B11) to neutralize IL-4 was confirmed by inhibition of IL-4-dependent proliferation by the CT4.S T cell line (29). Both mAb inhibited CT4.S proliferation over a wide range of IL-4 concentrations, including those below detection by ELISA assay (see below), using either recombinant mouse IL-4 (Genzyme, Cambridge, MA) or the genomic product from the transfected LT-1 cell line.

Precursor Th cells in MLN after oral immunization ELISA assays for IL-4 and IFN-γ IL-4 and IFN-γ were assayed in culture supernatants using sandwich ELISA assays modified for high sensitivity, with a double enzyme system, Immuoselect (Gibco/BRL, Gaithersburg, MD). The enhancement resulted in a 5-fold increase in sensitivity relative to detection using the typical p-nitrophenyl phosphate substrate. Coating antibodies were BVD4-1D11 (anti-IL-4) and R4-6A2 (anti-IFN-γ). Biotinylated second antibodies were BVD2.4G2 (25) (anti-IL-4) and XMG1.2 (25) (anti-IFN-γ), both from PharMingen. Assay conditions were essentially those as described previously for detection of serum IgE antibody in mice (3). Titrated recombinant mouse IL-4 and IFN-γ (Genzyme) were used as standards in each assay to calculate quantities of cytokine in test supernatants. The IL-4 ELISA had a detection limit of 0.3 ng/ml, while the IFN-γ assay limit was 10 ng/ml at a 1/2 dilution of supernatant. Bioassay for IL-2 and IL-4 IL-2 was measured in serial dilutions of culture supernatants by testing the proliferation of the CTLL-2 cell line (30). The assay was set up essentially as described previously (31). Supernatants were diluted from 1/2 to 1/32 and incubated with 53103 CTLL-2 cells for 16 h, after which 0.5 µCi of [3H]thymidine was added to the culture, and incubation continued for an additional 24 h. Titrated quantities of standard recombinant human IL-2 (Boehringer Mannheim, Laval, Quebec, Canada) were used in each assay and U/ml of IL-2 for each test sample derived by interpolation from the IL-2 standard curve values. The assay had a detection limit of 0.1 U/ml of IL-2. In two experiments, IL-4 in culture supernatants was assayed by a sensitive bioassay using CT4.S cell proliferation (29). CT4.S cells were maintained in the presence of mouse IL-4 produced by LT-1 cells. This plasmacytoma cell line with a transfected mouse IL-4 gene produced up to 50,000 U/ml of IL-4 in culture supernatant. A standard curve of CT4.S response was obtained by culturing 5.03103 cells/ well, in a serial dilution of LT-1 supernatant. The sensitivity of that assay was 1 pg/ml of IL-4. CT4.S cells (53103 cells/ well) were cultured with dilutions (1/2 or greater) of culture supernatant for 48 h at 37°C and then the cultures pulsed with 1 µCi of [3H]thymidine for the final 18 h of culture. RT-PCR detection of IL-4 and IFN-γ mRNA Total RNA was isolated from spleen, MLN or Peyer’s patch by the GTC method (32). The RT reaction was performed on 1 µg of RNA, in a total volume of 20 µl containing 50 mM Tris–HCl, 75 mM KCl, 3 mM MgCl2, 10 mM dithiothreitol, 2.5 µM oligo(dT), 0.5 mM each of dGTP, dCTP, dATP and dTTP, and 15 U RNase inhibitor (Pharmacia). mMLV RT (Gibco/BRL, Burlington, Ontario, Canada) was added at 5 U/µl. The reaction was carried out at 37°C for 70 min and stopped by heating at 95°C for 5 min. The mixture was placed at 4°C prior to cDNA amplification by PCR. The PCR primer pairs and expected product sizes were as follows: β-actin, 59 primer, CTCTTTGATGTCACGCACGATTTC; 39 primer, GTGGGCCGCTCTAGGCACCAA (size: 540 bp); IFN-γ, 59 primer, AGCGGCTGACTGAACTCAGATTGTAG; 39 primer, GTCACAGTTTTCAGCTGTATAGGG (size: 245 bp); and IL-4, 59 primer, GTACCAGGAGCCATATCCACG; 39

1557

primer, GAGTCTCTGCAGCTCCATGAG (size: 273 bp). These are based on previous published primer sets (33,34). In each case, 80 µl of a PCR mixture containing 1 M MgCl2, 10 mM Tris–HCl, 50 mM KCl, 0.25 µM of each primer and 6.25310–3 U/µl of Taq polymerase (Boehringer Mannheim) was added to the 20 µl RT reaction. The samples were overlaid with 80 µl mineral oil and then amplified in the thermal cycler (PerkinElmer Cetus, Emeryville, CA). Each reaction was cycled 30 times, with denaturation at 94°C for 1 min, primer annealing at 55°C (β-actin), 57°C (IL-4) or 65°C (IFN-γ) for 2 min and a final extension time of 3 min at 72°C. Then 20 µl of the amplified samples was electrophoresed on a 1.5% agarose gel containing 0.5 µg/ml ethidium bromide, visualized under long-wave UV light and photographed. Flow cytometry MLN and MLN T cell preparations were examined before and after in vitro culture by flow cytometry to determine purity and proportions of T cell subsets. Anti-CD3 (145–2C11) (35), antiB220 (6B2) (36), anti-CD8α (56-7.2) (37) and anti-CD4 (GK1.5) (37) were prepared in our laboratory from culture supernatants, and labeled with FITC or biotin, for use in two-color flow cytometry. A streptavidin–phycoerythrin conjugate (Tago, Burlington, CA) was used in a second step to label bound biotinylated antibodies. The mAb 2.4G2 (38) was used to block FcγRII/III prior to primary antibody labeling. Samples were run on a FACScan (Becton Dickinson, San Jose, CA), calibrated daily with CaliBRITE beads (Becton Dickinson), and data analyzed using Lysys software (Becton Dickinson). T cell and B cell subpopulations were examined by software gating for lymphocytes based on forward versus side scatter. Individual FITC stains were accompanied by propidium iodide stain to define proportions of dead cells. In all experiments subpopulations showed ,5% staining with propidium iodide. Results Kinetics and reproducibility of HEL-specific proliferation by T cells in MLN MLN cultures were prepared on days 3, 5, 7 and 11 following a single oral immunization of mice with HEL and CT, and tested for proliferative response to HEL. Stimulation indices (SI) were calculated based on the ratio of [3H]thymidine c.p.m. incorporated in the presence of HEL to that in its absence. A SI of 2.0 was considered significant. No response was observed with MLN cultures prepared on day 3 (three of three experiments). However, in 18 of 25 experiments examining day 5 MLN, a significant proliferative response was observed, with SI values ranging from 2.0 to 15.0 (Table 1). Proliferative responses were always observed for day 7 MLN (three of three experiments) and day 11 MLN (Table 1). However, no response was observed for spleen or peripheral lymph node cultures in the presence of HEL on day 5 or 11 (Table 1). Similar results were obtained using isolated T cells (Table 1). The frequency of responsive T cell cultures was approximately the same as with whole MLN cultures at 67% (12 of 18 experiments). When cultures of MLN and T cells isolated on day 5 from the same MLN were compared, response by isolated T cells always occurred

1558 Precursor Th cells in MLN after oral immunization

Fig. 1. Antigen-specific proliferation of day 5 MLN cells. Data are from one representative experiment of two. Whole MLN were taken from C3H mice orally immunized with HEL plus CT (A) or CT alone (B). HEL or an equimolar amount of pigeon cytochrome C (PcC) were added to some cultures, while others received no antigen (no HEL). Values (y-axis) are mean 6 SEM c.p.m. for triplicate cultures. Dashed line indicates mean c.p.m. from cultures of MLN taken from normal unimmunized mice.

Table 1. HEL-specific proliferation of MLN T cells at day 5 and 11 after oral immunization with HEL and CT Tissue tested

MLN MLN T cells Peripheral lymph node Spleen

Mean SIa 6 SEM Day 5

Day 11

3.8 6 0.5 (18/25)b 6.3 6 1.8 (12/18) 1.4 6 0.2 (0/3) ND

3.4 6 1.5 (3/3) ND 1.2 6 0.1 (0/3) 2.2 6 0.8 (1/3)

aSI calculated from quotient of [3H]thymidine incorporated in the presence or absence of HEL (see Methods). Background c.p.m. in MLN cultures not pulsed with HEL ranged from 500 to 4000 c.p.m. bFrequency of experiments where SI in response to HEL was .2. ND, not determined.

when response by MLN was found (n 5 5). Viable cells, recovered form MLN or MLN T cell cultures with HEL, were .95% CD4-expressing T cells (flow cytometry, data not shown). Thus, we concluded that CD4 T cells were the proliferating cells that respond to HEL, in the whole MLN and T cell cultures. The lack of response at day 3 and the high frequency (but not 100%) of responses by day 5 indicated that day 5 MLN contained the earliest wave of HEL-specific CD4 T cells. The specificity of the proliferative response for HEL was investigated. Data in Fig. 1(A) indicate that MLN cultures from mice immunized 5 days previously with CT plus HEL proliferated in response to HEL, but not a control antigen, pigeon cytochrome c. MLN cultures from mice immunized with CT alone did not respond to either antigen (Fig. 1B). There was no proliferative response by day 5 MLN from mice given HEL alone orally, in the absence of CT (data not shown).

The HEL-specific proliferation of day 5 MLN and MLN T cell cultures were both inhibited by the addition of anti-class II MHC antibodies (Fig. 2). Individually, the anti-I-Ak and anti-IEk mAb inhibited HEL-specific proliferation by MLN T cells by 50–55%. In combination, they inhibited proliferation by 96% (Fig. 2B). The data showed that day 5 MLN contained HEL-specific T cells whose proliferation was MHC class II restricted, consistent with the proliferative response of HELspecific CD4 Th cells. Anti-MHC-II mAb did not inhibit the background [3H]thymidine incorporation by MLN cells, in the absence of HEL (not shown). Thus, the background proliferation was not a function of MHC class II-restricted antigen presentation. Proliferation of day 5 MLN and MLN T cell cultures was inhibited by anti-IL-2 but not anti-IL-4 antibodies As a functional test for the presence of the two critical cytokines that could drive the HEL-specific proliferation, we treated MLN and MLN T cell cultures with large quantities of neutralizing anti-IL-2 and anti-IL-4 mAb. Data in Fig. 3 and Table 2 show that the HEL-specific proliferation of MLN T cell cultures was inhibited substantially (80–86%) by anti-IL-2 mAb, but not by anti-IL-4. If the anti-IL-4 mAb was used at 100 times the required dosage to inhibit proliferation of CT4.S cells (see Methods), there still was no inhibition of HELspecific proliferation by day 5 MLN T cells (Fig. 3). The combination of anti-IL-2 and anti-IL-4 did not result in inhibition greater than that produced by anti-IL-2 alone (Fig. 3). AntiIL-2 treatment in the absence of HEL had no effect on the background proliferation of MLN cultures (Table 2). This indicated that there was no ongoing IL-2 production, unrelated to that induced by HEL, that contributed to the proliferative signal in these cultures. Thus, IL-2 production in response to

Precursor Th cells in MLN after oral immunization

1559

Fig. 3. The proliferative response of day 5 MLN T cells was inhibited by anti-IL-2, but not anti-IL-4 mAb. All MLN T cell cultures shown included HEL. Anti-IL-2 mAb (cross-hatched bar) or different concentrations of anti-IL-4 mAb (shaded bars) were added at the beginning of culture. One set of cultures had anti-IL-2 and anti-IL-4 mAb. Dashed line shows background proliferation (no HEL). Data are from one representative experiment of four. Values (y-axis) are mean 6 SEM c.p.m. from triplicate cultures.

Fig. 2. MHC class II restriction of the day 5 MLN T cell proliferative response to HEL. Data are from two independent experiments testing MLN (A) or MLN T cells (B). HEL was present in all cultures, which were treated (hatched bars) or not treated (solid bars) with anti-MHC class II mAb with specificities as indicated. The mAb against I-Ak and I-Ek molecules were added at the start of cell culture. Individual or mixtures of those mAb were added to the MLN T cell cultures. Dashed line indicates the mean [3H]thymidine incorporated by cultures not given HEL or mAb. Values (y-axis) are mean 6 SEM c.p.m. for triplicate cultures.

bioassay (not shown). We also utilized a very sensitive, but non-quantitative, RT-PCR to detect IL-4 mRNA. The RT-PCR failed to detect any IL-4 mRNA in day 5 MLN cells in the presence or absence of HEL, or in normal MLN from nonimmunized mice. The lack of IL-4 production but production of IFN-γ in the whole MLN cultures might have been related functionally. There is evidence that IFN-γ can prevent IL-4 production and Th2 development by blocking the effects of IL-4 on Th cell differentiation (16,40). However, when we added anti-IFN-γ mAb to HEL-pulsed day 5 MLN cultures, IL4 was still not detected by ELISA IL-4 (data not shown). Synergistic response of day 5 MLN T cells to exogenous IL-4 in the presence of HEL

HEL accounted for the proliferative response of day 5 MLN T cells, while IL-4 did not contribute to that proliferation. IL-2 and IFN-γ, but not IL-4, were produced in day 5 MLN cultures in response to HEL The critical cytokines of interest in determining the nature of the HEL-specific Th response were IL-2, IL-4 and IFN-γ. We used the CTLL-2 bioassay to measured IL-2 in culture supernatants from day 5 MLN and MLN T cell cultures. Table 3 shows that IL-2 was present in cultures (three of three experiments) of MLN and MLN T cells only if incubated with HEL for 48 to 72 h. No IL-2 was detected in 24 h cultures (not shown). IFN-γ was also detected at 72 and 96 h in some MLN cultures (two of three experiments) using the ELISA. No IFN-γ was present prior to 72 h of culture (data not shown) or if HEL was absent from the cultures. In contrast to whole MLN cultures, no IFN-γ was found in cultures of MLN T cells and splenic APC when HEL was added, even though these cells did respond with IL-2 (Table 3). IL-4 was not detected by ELISA at any time point up to 96 h (Table 3) and was also not detected in two experiments by the more sensitive CT4.S

The preceding data indicated that the early Th cell response did not include production of IL-4 and the HEL-specific proliferation was not inhibited by anti-IL-4 antibody. It was possible that these early Th cells were not responsive to IL-4. To test this, we added exogenous IL-4 in the presence or absence of HEL. IL-4 did not induce any substantial proliferation of MLN or MLN T cells in the absence of HEL (Table 4). However, with both HEL and IL-4 proliferation was dramatically increased several fold above that of HEL alone, indicating a synergistic action of IL-4 with HEL. These results indicated that functional IL-4R were apparently absent from freshly isolated day 5 MLN T cells, but response to HEL resulted in up-regulation of IL-4R by MLN T cells and proliferation to exogenous IL-4. In contrast to the IL-4 result, both whole MLN cultures and MLN T cell preparations responded to rIL-2, with substantial proliferation, in the absence of HEL (Table 4). This IL-2dependent proliferation of day 5 T cells was similar in magnitude to the proliferation induced by addition of HEL. When both rIL-2 and HEL were added, the magnitude of proliferation was higher than with rIL-2 or HEL alone, but at best the effect

1560 Precursor Th cells in MLN after oral immunization Table 2. Anti-IL-2 but not anti-IL-4 inhibits the HEL-specific proliferation of T cells from day 5 MLN SIa 6 SEM for mean experiments (mean % inhibition)

Culture typeb

no mAb 1 HEL

anti-IL-2 no HEL

anti-IL-2 1 HEL

anti-IL-4 no HEL

anti-IL-4 1 HEL

Whole MLN

4.2 6 0.3

1.0 6 0.1

1.3 6 0.1

MLN T cell

7.9 6 3.4

ND

1.4 6 0.1 (82.5) 2.9 6 0.3 (86.1)

4.8 6 0.5 (0.0) 8.4 6 3.7 (0.0)

ND

aSI were calculated as described in Methods. Controls cultures for SI calculation had all cell constituents, but no HEL and no mAb, and gave c.p.m. in the range of 800–2000. Paired data from groups of n 5 4 or 5 were tested for significance. Underlined values indicate significant difference from the no mAb 1 HEL group (P , 0.05). ND, not determined.

Table 3. Detection of IL-2 and IFN-γ, but not IL-4 in cultures of day 5 MLN and MLN T cells in response to HEL Cytokine

Time (h)

Mean U/ml or ng/mla 6 SEM MLN 1 HEL

MLN no HEL IL-2 (U/ml) IL-4 (ng/ml) IFN-γ (ng/ml)

48 72 72 96 72 96

,0.2 ,0.2 ,0.3 ,0.3 ,10 ,10

5.6 K 1.9 4.3 K 0.7 ,0.3 ,0.3 18 K 6.1 23.3 K 9.3

MLN T cell no HEL

MLN T cell 1 HEL

,0.2 ,0.2 ,0.3 ,0.3 ,10 ,10

14.3 K 4.7 6.2 K 2.3 ,0.3 ,0.3 ,10 ,10

aValues were obtained by testing culture supernatants at the designated times using ELISA for IL-4 and IFN-γ, and CTLL-2 bioassay for IL-2 (see Methods). Supernatants were tested from three independent experiments. For MLN, three of three were positive for IL-2, but only two of three for IFN-γ and none for IL-4. Bold type indicates measurable responses. Limits of detection are shown as ‘,’ values.

Table 4. IL-4 synergizes with HEL for enhanced proliferation by T cells from day 5 MLN Culture type

Mean SIa 6 SEM IL-4 experiments

Whole MLN MLN T cell

IL-2 experiments

no IL 1 HEL

rIL-4 no HEL

rIL-4 1 HEL

no IL 1 HEL

rIL-2 no HEL

rIL-2 1 HEL

3.7 6 0.5 5.9 6 2.0

1.8 6 1.2 1.7 6 0.3

8.1 6 2.3 10.7 6 3.8

2.9 6 0.5 5.9 6 2.0

4.2 6 0.8 3.8 6 0.6

4.6 6 1.5 10.4 6 1.7

aSI were calculated as described in Methods. Control cultures for SI calculation had all cell constituents, but no HEL and no IL-4 or IL-2. Their c.p.m. ranged from 600 to 2500. Paired data from groups of n 5 5 or 7 were tested for significance. Underlined values indicate significant difference from the no IL 1 HEL group (P , 0.05). ND, not determined.

was additive. These results indicated that at least some T cells in the day 5 MLN had functional IL-2R at the time of culture and these cells could respond to rIL-2. It is not clear that the exogenous rIL-2 provided additional expansion of HEL-specific T cells, or of other cells with IL-2R, or both. Discussion Our results indicate that the earliest HEL-specific T cells, that locate in the MLN after oral immunization with HEL plus CT, have a functional phenotype consistent with undifferentiated pTh cells. Purified preparations of T cells taken 5 days after oral immunization produced neither IL-4 nor IFN-γ when re-

stimulated with HEL in vitro. Lack of IL-4 and IFN-γ production by the purified T cell cultures is inconsistent with Th1, Th2 or Th0 phenotypes. The proliferation on day 5 was MHC-class II restricted and inhibitable by anti-IL-2 antibody, but not antiIL-4 antibody. The same cultures showed clear production of IL-2, but not IL-4. Thus, the HEL-specific T cells made and likely consumed IL-2 in these cultures, yet did not produce IL-4. This is clearly a phenotype attributable to pTh cells, prior to any differentiation to Th0 or Th2 cells in vitro (39,40). It is therefore clear that the antigen-specific Th cells first reach the MLN by day 5 and they are still in the pTh stage of differentiation. If, as most would agree, these cells arise from the Peyer’s patch and move to the MLN, then our results

Precursor Th cells in MLN after oral immunization imply that CT does not cause a direct shift towards Th2 within the Peyer’s patch during a primary response of antigenspecific Th cells. The contrast between IFN-γ production in the MLN cultures and the lack of IFN-γ in the T cell cultures warrants further investigation. It may be that the APC present in the whole MLN preparation differed qualitatively from those provided from naive irradiated spleen cells in their ability to present HEL to the HEL-specific T cells and to elicit IFN-γ production. For instance, the APC in the isolated MLN likely include macrophage, dendritic and B cells whose activation state is unknown, whereas only resident macrophage and dendritic cells are functional APC in irradiated spleen because B cell APC function is lost (41,42). The isolated MLN APC may produce large quantities of IL-12, which could stimulate IFNγ production by NK cells or CD8 T cells (43,44) and thereby directly affect differentiation of pTh cells into Th1-type cells (11). Others have used activated peritoneal macrophages as APC and found antigen-specific IFN-γ production from MLN T cells taken on day 7 (9). A small number of CD8 cells were present in our preparations of whole MLN or T cells and NK cells may also have been. Further experimentation is required to determine the nature of the IFN-γ-producing cell within the whole MLN culture. An appropriate procedure would be flow cytometric analysis of intracellular cytokines within cells having defined surface phenotype. Ho¨rnquist and Lycke examined MLN T cell responses 7 days after a single immunization and found a mixed Th1/Th2 phenotype (9). Several aspects of that study are worth noting in comparison with our results. First, we focused 2 days earlier in the MLN response, a time when differentiation appears to be minimal. Second, the previous work used relatively large dosages (milligram quantities) of antigen, much larger than ours. Our dosage of HEL was chosen because it does illicit IgE antibody with repeat immunization (3), so if Th differentiation were evident it would likely be Th2 type, consistent with IL-4 response and IgE antibody production. It may also be that larger doses of antigen could drive more rapid differentiation of Th subtypes, in the context of CT. Higher antigen dosage may also explain the previous report of proliferative response from spleen T cells at day 7 (9), whereas we observed no such response at day 5 or 11. Greater numbers of stimulated T cells and/or antigen may move to the circulation and reach the spleen, when higher amounts of antigen are administered. Examination of the effects of oral antigen dosage on rapid development of Th cell subsets or their spread to perenteral lymphoid tissues will be the subject of future investigations in our laboratory. Finally, the previous work reported IFN-γ and IL-4 production from isolated T cells, when activated peritoneal macrophages were a source of APC. As stated above, different APC may provide alternate signals to pTh for differentiation and cytokine production. The key to resolving this issue seems to be a closer examination of the whole MLN culture, where the source of APC is clearly relevant to the in vivo conditions of Th cell differentiation, and both the Th and APC could be examined functionally. Our studies here indicated that these early HEL-specific Th cells in the MLN did not express IL-4R until stimulated with HEL in vitro. We found a synergistic proliferative response with the combination of HEL and IL-4, consistent with IL-4R

1561

expression by activated HEL-specific cells. A source of IL-4 would be required in vivo in order for these cells to proliferate and then differentiate into Th2. This IL-4 could come from bystander production by CD4 cells, CD8 cells (45) or the recently described CD41NK1.1 cells (46,47). Our data suggest that none of these cells were present in our T cell or whole MLN isolates since no IL-4 was detected in the presence or absence of HEL. One hypothesis consistent with all available data is that re-exposure to antigen by secondary and tertiary immunization drives development of Th2 in vivo similar to that described in vitro (10). Alternatively, a cellular source of IL-4 may develop after repeat immunization to help drive the Th2 differentiation observed by others (5,6,8). Questions concerning the potential IL-4 source, the effects of repeat antigen administration and the nature of the IFN-γ production in the day 5 MLN are central to further experiments in this area. Acknowledgements The authors thank Ms Hong Liang for expert technical assistance. This work is supported by the MRC of Canada

Abbreviations APC CT HEL MLN pTh SI

antigen-presenting cell cholera toxin hen egg lysozyme mesenteric lymph node precursor T helper cell stimulation index

References 1 Elson, C. O. and Ealding, W. 1984. Generalized systemic and mucosal immunity in mice after mucosal stimulation with cholera toxin. J. Immunol. 132:2736. 2 Lycke, N. and Holmgren, J. 1986. Strong adjuvant properties of cholera toxin on gut mucosal immune reponses to orally presented antigens. Immunology 59:301. 3 Snider, D. P., Marshall, J. S., Perdue, M. H. and Liang, H. 1994. Production of IgE antibody and allergic sensitization of intestinal and peripheral tissues following oral immunization with protein antigen and cholera toxin. J. Immunol. 153:647. 4 Marinaro, M., Staats, H. F., Hiroi, T. Jackson, R. J., Coste, M., Boyaka, P. N., Okohashi, N., Yamamoto, M., Kiyono, H., Bluethmann, H., Fujihashi, K. and McGhee, J. R. 1995. Mucosal adjuvant effect of cholera toxin in mice results from induction of T helper 2 (Th2) cells and IL-4. J. Immunol. 155:4621. 5 Xu-Amano, J., Aicher, W. K., Taguchi, T., Kiyono, H. and McGhee, J. R. 1992. Selective induction of Th2 cells in murine Peyer’s patches by oral immunization. Int. Immunol. 4:433. 6 Xu-Amano, J., Kiyono, H., Jackson, R. J., Staats, H. F., Fujihashi, K., Burrows, P. D., Elson, C. O., Pillai, S. and McGhee, J. R. 1993. Helper T cell subsets for immunoglobulin A responses: oral immunization with tetanus toxoid and cholera toxin as adjuvant selectively induces Th2 cells in mucosa associated tissues. J. Exp. Med. 178:1309. 7 Vajdy, M., Kosco-Vilbois, M. H., Kopf, M., Ko¨hler, G. and Lycke, N. 1995. Impaired mucosal immune responses in interleukin 4targeted mice. J. Exp. Med. 181:41. 8 Wilson, A. D., Bailey, M., Williams, N. A. and Stokes, C. R. 1991. The in vitro production of cytokines by mucosal lymphocytes immunized by oral administration of keyhole limpet hemocyanin using cholera toxin as an adjuvant. Eur. J. Immunol. 21:2333. 9 Ho¨rnquist, E. and Lycke, N. 1993. Cholera toxin adjuvant greatly promotes antigen priming of T cells. Eur. J. Immunol. 23:2136. 10 Demeure, C. E., Yang, L.-P., Byun, D. G., Ishihara, H., Vezzio, N.

1562 Precursor Th cells in MLN after oral immunization

11

12 13

14

15

16 17

18

19

20

21

22 23

24

25

26

27

and Delespesse, G. 1995. Human naive CD4 T cells produce interleukin-4 at priming and acquire a Th2 phenotype upon repetitive stimulations in neutral conditions. Eur. J. Immunol. 25. Seder, R. A., Gasinelli, R., Sher, A. and Paul, W. E. 1993. Interleukin 12 acts directly on CD41 T cells to enhance priming for interferon γ production and diminishes interleukin 4 inhibition of such priming. Proc. Natl Acad. Sci. USA 90:10188. McKnight, A. J., Zimmer, G. J., Fogelman, I., Wolf, S. F. and Abbas, A. K. 1994. Effects of IL-12 on helper T cell-dependent immune response in vivo. J. Immunol. 152:2172. Kennedy, M. K., Picha, K. S., Shanebeck, K. D., Anderson, D. M. and Grabstein, K. H. 1994. Interleukin-12 regulates the proliferation of Th1, but not Th2 or Th0, clones. Eur. J. Immunol. 24:2271. Gately, M. K., Warrier, R. R., Honasoge, S., Carvajal, D. M., Faherty, D. A., Connaughton, S. E., Anderson, T. D., Sarmiento, U., Hubbard, B. R. and Murphy, M. 1994. Administration of recombinant IL-12 to normal mice enhances cytolytic lymphocyte activity and induces production of IFN-γ in vivo. Int. Immunol. 6:157. Wu, C. Y., Demeure, C. E., Gately, M., Podlaski, F., Yssel, H., Kiniwa, M. and Delespesse, G. 1995. In vitro maturation of human neonatal CD4 T lymphocytes. I. Induction of IL-4-producing cells after long-term culture in the presence of IL-4 plus either IL-2 or IL-12. J. Immunol. 152:1141. Paul, W. E. and Seder, R. A. 1994. Lymphocyte responses and cytokines. Cell 76:241. Croft, M. and Swain, S. L. 1995. Recently activated naive CD4 T cells can help resting B cells, and can produce sufficient autocrine IL-4 to drive differentiation to secretion of T helper 2-type cytokines. J. Immunol. 154:4269. Seder, R. A. and Paul, W. E. 1994. Acquisition of lymphokineproducing phenotype by CD41 T cells. Annu. Rev. Immunol. 12:635. Shu, U., Demeure, C. E., Byun, D., Podlaski, F., Stern, A. S. and Delespesse, G. 1994. Interleukin 12 exerts a differential effect on the maturation of neonatal and adult human CD45R0– CD4 T cells. J. Clin. Invest. 94:1352. Bradley, L. M., Yoshimoto, K. and Swain, S. L. 1995. The cytokines IL-4, IFN-γ, and IL-12 regulate the development of subsets of memory effector helper T cells in vitro. J. Immunol. 155:1713. Phillips-Quagliata, J. M. and Lamm, M. E. 1994. Lymphocyte homing to mucosal effector sites. In Ogra, P. L., Lamm, M. E., McGhee, J. R., Mestecky, J., Strober, W. and Bienenstock, J., eds, Handbook of Mucosal Immunology, p. 225. Academic Press, San Diego. Issekutz, T. B. 1984. The response of gut-associated T lymphocytes to intestinal viral immunization. J. Immunol. 133:2955. Kiyono, H. and McGhee, J. R. 1994. T helper cells for mucosal immune response. In Ogra, P. L., Lamm, M. E., McGhee, J. R., Mestecky, J., Strober, W. and Bienenstock, J., eds, Handbook of Mucosal Immunology, p. 263. Academic Press, San Diego. Alterman, L. A., Crispe, I. N. and Kinnon, C. 1990. Characterization of the murine heat-stable antigen: an hematolymphoid differentiation antigen defined by the J11d, M1/69 and B2A2 antibodies. Eur. J. Immunol. 20:1597. Sander, B., Hoeiden, I., Andersson, U., Moeller, E. and Abrams, J. S. 1993. Similar frequencies and kinetics of cytokine producing cells in murine peripheral blood and spleen. Cytokine detection by immunoassay and intracellular immunostaining. J. Immunol. Methods 166:201. Mosmann, T. R., Cherwinski, H., Bond, M. W., Giedlin, M. A. and Coffman, R. L. 1986. Two types of murine helper T cell clone I. Definition according to lymphokine activities and secreted proteins. J. Immunol. 136:2348. Ohara, J. and Paul, W. E. 1985. Production of a monoclonal

28 29

30 31

32 33

34 35 36 37 38 39 40 41 42 43

44 45

46

47

antibody to and molecular characterization of B-cell stimulatory factor-1. Nature 315:333. Spitalny, G. and Havell, E. 1984. Monoclonal antibody to murine gamma interferon inhibits lymphokine-induced antiviral and macrophage tumoricidal activities. J. Exp. Med. 159:1560. Hu-Li, J., Ohara, J., Watson, C., Tsang, W. and Paul, W. E. 1989. Derivation of a T cell line that is highly responsive to IL-4 and IL-2 (CT4.R) and of an IL-2 hyporesponsive mutant cell line (CT4.S). J. Immunol. 142:800. Gillis, S. and Smith, K. A. 1977. Long-term culture of tumorspecific cytotoxic cells. Nature 268:154. Snider, D. P. and Segal, D. M. 1989. Efficiency of antigen presentation following antigen targeting to surface IgD, IgM, MHC, FcγRII, and B220 molecules on murine splenic B cells. J. Immunol. 143:59. Chomczynski, P. and Sacchi, N. 1987. Single step method for RNA isolation by acid guanidium thiocyanate–phenol–chloroform extraction. Anal. Biochem. 162:156. Kennedy, M. K., Mohler, K. M., Shanebeck, K. D., Baum, P. R., Picha, K. S., Otten-Evans, C. A., Janeway, C. A., Jr and Grabstein, K. H. 1994. Induction of B cell costimulatory function by recombinant murine CD40 ligand. Eur. J. Immunol. 24:116. Miralles, G. D., Stoeckle, M. Y., McDermott, D. F., Finkelman, F. D. and Murray, H. W. 1994. Th1 and Th2 cell associated cytokines in experimental visceral leishmaniasis. Infect. Immun. 62:1058. Leo, O., Foo, M., Sachs, D. H., Samelson, L. E. and Bluestone, J. A. 1987. Identification of a monoclonal antibody specific for a murine T3 polypeptide. Proc. Natl Acad. Sci. USA 84:1374. Coffman, R. L. and Weissman, I. L. 1981. B220: a B cell-specific member of the T200 glycoprotein family. Nature 289:681. Yoshimoto, T. and Paul, W. E. 1994. CD4pos, NK1.1pos T cells promptly produce interleukin 4 in response to in vivo challenge with anti-CD3. J. Exp. Med. 179:1285. Vicari, A. P. and Zlotnik, A. 1996. Mouse NK1.11 T cells: a new family of T cells. Immunol. Today 17:71. Ledbetter, J. A. and Herzenberg, L. A. 1979. Xenogeneic monoclonal antibodies to mouse lymphoid differentiation antigens. Immunol. Rev. 47:63. Unkeless, J. C. 1979. Characterization of a monoclonal antibody directed against mouse macrophage and lymphocyte Fc receptors. J. Exp. Med. 150:580. Sad, S. and Mosmann, T. R. 1994. Single IL-2-secreting precursor CD4 T cell can develop into either Th1 or Th2 cytokine secretion phenotype. J. Immunol. 153:3514. Reiner, S. L. and Seder, R. A. 1995. T helper cell differentiation in immune response. Curr. Opin. Immunol. 7:360. Ashwell, J. D., DeFranco, A. L., Paul, W. E. and Schwartz, R. H. 1984. Antigen presentation by resting B cells. Radiosensitivity of the antigen-presenting function and two distinct pathways of T cell activation. J. Exp. Med. 158:881. Snider, D. P. and Segal, D. M. 1987. Targeted antigen presentation using crosslinked antibody heteroaggregates. J. Immunol. 139:1609. Chan, S. H., Perussia, B., Gupta, J. W., Kobayashi, M., Pospisil, M., Young, H. A., Wolf, S. F., Young, D., Clark, S. C. and Trinchieri, G. 1991. Induction of interferon γ production by natural killer cell stimulatory factor: characterization of the responding cells and synergy with other inducers. J. Exp. Med. 173:869. Croft, M., Carter, L., Swain, S. L. and Dutton, R. W. 1994. Generation of polarized antigen-specific CD8 effector populations: reciprocal action of interleukin (IL)-4 and IL-12 in promoting type 2 versus type 1 cytokine profiles. J. Exp. Med. 180:1715. Lagoo, A. S., Eldridge, J. H., Lagoo-Deenadaylan, S., Black, C. A., Ridwan, B. U., Hardy, K. J., McGhee, J. R. and Beagley, K. W. 1994. Peyer’s patch CD81 memory T cells secrete T helper type 1 and type 2 cytokines and provide help for immunoglobulin secretion. Eur. J. Immunol. 24:3087.