Detection of quantitative trait loci for carcass traits in the pig by using

Mammalian Genome 13, 206–210 (2002). DOI: 10.1007/s00335-001-3052-4 Incorporating Mouse Genome

© Springer-Verlag New York Inc. 2002

Detection of quantitative trait loci for carcass traits in the pig by using AFLP Klaus Wimmers,1 Eduard Murani,1 Siriluck Ponsuksili,1 Martine Yerle,2 Karl Schellander1 1

Institute of Animal Breeding Science, University of Bonn, 53115 Bonn, Germany Laboratoire de Genetique Cellulaire, INRA, 31326 Castanet Tolosan, France

2

Received: 20 June 2001 / Accepted: 3 January 2002

Abstract. For evaluation of the suitability of Amplified Fragment Length Polymorphism (AFLP) for detection of quantitative trait loci in farm animals, a combination of AFLP and selective genotyping has been applied as a rapid screening method for marker– QTL associations. Focusing on loci affecting eye muscle area, six extreme discordant sib pairs were selected from a Duroc × Berlin Miniature Pig F2 experimental cross and examined by using 48 AFLP primer combinations. Two prominent AFLP markers were converted into simple codominant PCR markers (STS-Bo1 and STS-Bo3) and assigned to Sscr4 by physical and linkage mapping. Single marker analysis indicated association of the STS markers with a putative QTL influencing eye muscle area. Interval mapping confirmed the presence of a significant QTL for eye muscle area (Pgenomewide < 0.01) on the Sscr4, with STS-Bo1 being the closer marker. At the same location, significant effects (Pgenomewide < 0.01) on carcass length and backfat thickness were also detected. Our results demonstrate the capability of the combination of AFLP analysis and selective genotyping as a method for detection of genome regions containing QTL in livestock.

The majority of economically important traits in farm animals are quantitative traits. Detection, isolation, and characterization of Quantitative Trait Loci (QTL) underlying production traits in livestock are of major interest in animal genetics. In pigs, genetic mapping of QTL in experimental crosses between divergent lines proves to be an efficient method for identification of genome regions containing genes affecting traits of interest (Andersson et al. 1994). However, QTL identified in experimental crosses may not necessarily be those contributing to phenotypic variation in commercial pigs. Recently, a combination of selective DNA pooling and Amplified Fragment Length Polymorphism (AFLP) technique (Vos et al. 1995) has been proposed by Plastow et al. (1998) for detection of QTL in commercial pig populations. AFLP is a DNA fingerprinting technique based on restriction of genomic DNA and subsequent selective PCR amplification of the restriction fragments. Important advantages of AFLP over other marker systems are their suitability to simultaneously screen the whole genome and to produce a large number of markers that can be converted to simple codominant locus-specific markers without prior knowledge of specific sequences. AFLP-screening for fragments with different distribution between phenotypic extremes of a population via analysis of pooled DNA (selective DNA pooling; Darvasi and Soller 1994) or individual genotyping of selected extreme individuals (selective genotyping; Lander and Botstein 1989) provides a fast genome-wide association analysis.

Correspondence to: Klaus Wimmers; E-mail: [email protected]

This approach to QTL analysis does not require building of a genetic map and generation of specialized pedigrees and is, therefore, suitable for detection of QTL directly in commercial populations. We attempted to use AFLP in combination with selective genotyping for detection of loci influencing eye muscle area in the pig. We have first evaluated the potential of this strategy in an F2 experimental population, where linkage disequilibrium extends over larger distances, and hence the QTL are more likely to be detected than in commercial populations. We derived codominant, locus-specific PCR-tests that facilitate genotyping of a large number of animals for evaluation of marker association to QTL in experimental as well as commercial populations. Materials and methods Source of animals and experimental design. The animals used for the QTL analysis were from our DUMI resource population founded by reciprocal crossing of Berlin Miniature Pig and Duroc at the Institute of Animal Science of the Humboldt University of Berlin (Hardge et al., 1999). Animals were kept and performance tested at our research farm Frankenforst. The experimental design to elucidate genomic regions affecting the trait eye muscle area was essentially as described previously (Ponsuksili et al. 2000). In brief, data about eye muscle area of 438 F2 animals were adjusted for carcass weight, and six animals from each of the upper and the lower 10% of the trait distribution were selected for primary AFLP analysis. To decrease the probability of finding differences due to genetic background, animals in the low-performing group had sibs of the same sex in the high-performing group, but no full sibs in the same group. Fragments markedly differing in the frequency distribution were checked on another 20 low- and 20 high-performing individuals to avoid false positives. Potential markers were converted into codominant Sequence Tagged Site (STS) markers and genotyped in the whole resource population. AFLP analysis. Genomic DNA (500 ng) was digested with 10 U TaqI (Promega, Mannheim, Germany) for 3 h at 65°C and subsequently with 12 U EcoRI (Promega) at 37°C for 3 h. Adapters were ligated to the restriction fragments by addition of a ligation mixture containing 1 U T4 DNA ligase (Promega), 10 pmol of double-stranded (ds) EcoRI adapter, 100 pmol of ds TaqI adapter, and 0.5 × ligase buffer (Promega). The reaction was incubated at 20°C for 3 h and at 4°C overnight. Restriction fragments were amplified in two consecutive PCR rounds (preamplification and selective amplification). Both PCR reactions were performed in a MJR 100 (Biozym, Hess. Oldendorf, Germany) thermal cycler. Sequences of adapters and primers used in AFLP analysis were according to Ajmone-Marsan et al. (1997). The preamplification was carried out in 25 ␮l containing 5 ␮l of 1:10 diluted ligation product as template, 0.4 ␮M EcoRI-N primer (E+A), 0.4 ␮M TaqI-N (T+A or T+C), 50 ␮M of each dNTP, 0.5 U Taq-polymerase (Amersham PharmaciaBiotech, Braunschweig, Germany), and 1 × PCR buffer. The temperature profile was as follows: 30 s at 94°C, 60 s at 60°C, 60 s at 72°C for 2 cycles; 30 s at 94°C, 60 s at 58°C, 60 s at 72°C for 2 cycles; and 30 s at 94°C, 60 s at 56°C, 60 s at 72°C for 20 cycles. An aliquot of the preamplification

K. Wimmers et al.: AFLP for QTL detection in pigs was diluted 1:20 with double-distilled H2O and served as template of the selective amplification. This was performed in 12.5 ␮l containing 2.5 ␮l of the template, 0.4 ␮M EcoRI-NNN primer (E+ACN, E+AGN), 0.4 ␮M TaqI-NNN primer (T+AAC, T+ACT, T+CAC, T+CAG, T+CAT, T+CCA), 50 ␮M of each dNTP, 0.25 U Taq-polymerase (Amersham PharmaciaBiotech), and 1 × PCR buffer. A stepdown-PCR was performed, starting with 3 cycles of 30 s at 94°C, 60 s at 66°C, and 60 s at 72°C, reducing annealing temperature by 2°C in four steps of 3 cycles each. The PCR proceeded with 20 cycles of 30 s at 94°C, 60 s at 56°C, and 60 s at 72°C. The reaction was stopped by adding 6 ␮l of formamide-containing loading buffer. Denatured products (3.5 ␮l) were loaded on 5% sequencing polyacrylamide gels and electrophoresed at constant power (100 W) for 3 h. Bands were visualized by silver staining.

Cloning of AFLP fragments. Bands of interest were excised from dried gels and eluted in 20 ␮l of 2 × PCR buffer at 4°C overnight. The eluate was boiled 15 min at 95°C before reamplification. Five ␮l of the solution served as template of a PCR, employing the same conditions as in the preamplification. The products were gel purified and cloned into p-GEM T vector (Promega). A PCR using the original AFLP primer combination was carried out with plasmid DNA as template, and the products were compared on 6% PAA gel with the original AFLP reaction in order to identify clones containing correct inserts. Two clones with inserts of the same size as the original AFLP marker were sequenced on a LICOR 4200 automated sequencer by using SequiTherm EXCEL II cycle sequencing kit (Biozym). The sequences obtained were screened for homology to known sequences in public databases with BLAST software (Altschul et al. 1997). Regional assignment and conversion of AFLP markers into codominant STS markers. Primers amplifying a major part of the AFLP fragment were designed in order to perform regional assignment. For this purpose the INRA somatic cell hybrid panel (Yerle et al. 1996) and the IMpRH radiation hybrid panel (Yerle et al. 1998) were used. DNA of the hybrid cell clones was used as a template of a stepdown PCR, and the products were resolved on 2% agarose gels or 6% native PAA gels. The results were analyzed by using computer programs available on the WWW site of INRA (http://www.toulouse.inra.fr). Fragments obtained from animals of both extremes of the trait distribution were sequenced comparatively in order to screen for polymorphisms. In order to obtain flanking sequences and to identify polymorphisms in the restriction sites and selective nucleotides, externally oriented primers were designed and used in vectorette PCR (VectoretteII system, Sigma, Taufkirchen, Germany). Cloning and sequencing of the products was performed as described above. After identification of the initial AFLP polymorphisms, simple codominant markers (STS-Bo1 and STS-Bo3) were derived. The amplification of marker STS-Bo1 was performed in 10 ␮l containing 100 ng of genomic DNA, 0.5 ␮M forward primer (5⬘gagcagactccaactactctcactccac), 1 ␮M reverse primer (5⬘tcagaaggatgatttagagtgtctgttcag), 62.5 ␮M of each dNTP, 0.25 U Taqpolymerase (GeneCraft, Muenster, Germany), and 1 × PCR buffer. Marker STS-Bo3 was amplified in 20 ␮l reaction mixture containing 100 ng of genomic DNA, 0.25 ␮M forward primer (5⬘-ctatctgcaagggagcatgc), 0.25 ␮M reverse primer (5⬘-aggatgaaggcaactgcttg), 62.5 ␮M of each dNTP, 0.5 U Taq-polymerase (GeneCraft), and 1 × PCR buffer. Temperature profiles were as follows: 3 min at 94°C, followed by 36 cycles of 5 s at 94°C, 30 s at 62°C (for STS-Bo1) or 15 s at 60°C (for STS-Bo3), 15 s at 72°C, and a final extension at 72°C for 5 min. One ␮l of the STS-Bo1 PCR product was diluted with 19 ␮l of formamide-containing loading buffer, and 1 ␮l of the dilution was loaded on a 6% denaturing polyacrylamide gel. Bands (331bp/326bp) were visualized by silver staining. Ten ␮l of the STS-Bo3 PCR product was digested with 6U TthHB8I overnight under conditions recommended by the manufacturer (Amersham PharmaciaBiotech). The restriction fragments (479bp/279bp, 200bp) were analyzed on 2% agarose gels.

Statistical analysis. QTL analyses were carried out by single-marker analysis and interval mapping. In addition to eye muscle area (EA), carcass length (CL) and backfat thickness (BFT) were analyzed (Table 1). Singlemarker analysis was performed using a general linear model (PROC GLM; SAS 1996). For all traits the model included marker genotype, sex and family as fixed effects and carcass weight as covariate. For eye muscle area the model included also parity as fixed effect. In order to estimate position of the STS markers relative to the most

207 Table 1. Analyzed traits with their means, standard deviations, correlation with eye muscle area, and number of F2 animals with phenotypic records. Trait 2

Eye muscle area (cm ) Carcass length (cm) Backfat thickness (cm)

Mean

SD

Correlation

No.

24.42 81.23 4.43

4.56 4.47 0.89

0.36 −0.43

438 438 438

likely position of the putative QTL, we employed interval mapping. Multipoint linkage map was established by using the BUILD and FLIPS2 options of CRI-MAP 2.4 package (Green et al. 1990). The STS markers were mapped against four Sscr4 markers from whole-genome scan of the DUMI resource population (Hardge et al. 1999; Wimmers et al. in preparation). In addition, a polymorphic microsatellite designated as STS-Bo4, which was identified within the scope of our AFLP work and assigned to Sscr4 by physical mapping (data not shown), was also included in the linkage map. The sex-averaged map was used for regression interval mapping according to a method proposed by Haley et al. (1994) for mapping QTL in crosses between outbred lines. For each F2 animal, marker genotypes were used to calculate probabilities of the four assumed QTL genotypes in 1-centiMorgan (cM) intervals. Additive and dominance coefficients for the putative QTL were calculated conditionally on these probabilities. For each interval, a model, including the fixed effects and covariates as given above and the additive and dominance coefficients, was tested against a model omitting these two coefficients. The corresponding F statistic was computed, and the position with the highest F-value was considered to be the position of the QTL. A model fitting two QTL was also tested. Significance thresholds for the QTL analysis in the experimental population were computed by using the equation proposed by Lander and Kruglyak (1995). The values used to calculate the thresholds were set as follows: the number of chromosomes C ⳱ 19, length of swine genome in Morgans G ⳱ 25, crossover rate ␳ ⳱ 1.5, LOD ⳱ 2.8 for suggestive and LOD ⳱ 4.3 for significant linkage (Lander and Kruglyak 1995). The resulting suggestive and significant levels correspond to F-values of 7.0 (␣ ⱕ 1.0 × 10−3) and 11.0 (␣ ⱕ 3.3 × 10−5) respectively. Expected proportion of false negatives was estimated by using the equation as mentioned above and described by Rohrer and Keele (1998a). The significance threshold used for the test of two vs. one QTL was that used for the test of one vs. no QTL, following Knott et al. (1998).

Results AFLP analysis. In total, 48 AFLP primer combinations were employed in the primary analysis of six low- and six high-performing animals of the DUMI resource population. Each primer combination generated about 12–90 clearly scorable bands (bands counted in a range of 100–700 bp). Four polymorphic fragments with the most striking difference in distribution between the extreme individuals were evaluated in the second group of extreme animals prior to conversion. After this check, two markers were found to be suggestively associated with eye muscle area. For the marker obtained with the primer combination E+AGT/T+CAC, a band of 392 bp and a shorter band (387 bp) that showed consistently inverse distribution between the animals of both extremes were observed, indicating that this AFLP marker was codominant. Both bands were analyzed further. The primer combination E+AGT/ T+AAC delivered a fragment of 353 bp with different abundance in both groups of phenotypic extreme animals. Marker conversion and chromosomal assignment. Sequencing of the two inversely distributed bands of the marker amplified with the E+AGT/T+CAC primer combination revealed that they actually represent two alleles of the same AFLP fragment, which differed in size by 5 bp insertion/deletion. Primers flanking the insertion/deletion were designed in order to transform the AFLP marker in a simple PCR test. Genotyping of individuals used in the AFLP analysis confirmed that the correct AFLP marker was transformed. The converted marker was designated as STS-Bo1. Physi-

208

K. Wimmers et al.: AFLP for QTL detection in pigs

Table 2. Summary of results of interval mapping from fitting one QTL.

Trait

F ratio

Positiona

Pgenomewideb

Additive effect (SE)

Dominance effect (SE)

EA (cm2) CL (cm) BFT (cm)

15.7 35.2 24.4

63 63 63

6.6 × 10−04 4.8 × 10−11 3.9 × 10−07

1.5 (±0.27) 1.81 (±0.22) −0.33 (±0.05)

0.57 (±0.37) −0.23 (±0.3) 0.06 (±0.07)

commercial herds (n ⳱ 245 and n ⳱ 67) for STS-Bo1 revealed 258 animals that were homozygous DD, 53 were heterozygous, and one animal was homozygous MM. The statistical analysis revealed weak association of STS-Bo1 with eye muscle area, but no association with carcass length and backfat thickness (results not shown).

a

Position in cM with the highest F-value, considered as the position of the QTL. Genomewide significance is given as the expected number of false positives per genome scan. Results with one expected false positive are considered as suggestive, and results with 0.05 expected false positives are considered as significant genomewide.

b

cal mapping by using the INRA somatic cell hybrid panel assigned STS-Bo1 to Sscr4, but the assignment to particular regions was ambiguous (results not presented). To refine the chromosomal localization, the IMpRH panel was employed. The best location found was S0107–(9 cR)–STS-Bo1(57 cR)–SW1089 on the Sscr4 with S0107 (LOD ⳱ 23.67) being the most significantly linked marker. The sequence of the AFLP marker and flanking sequences obtained by vectorette PCR (1785 bp in total, accession no. AF450117) showed no homology with coding sequences in public databases; however, a homology with human genomic sequence (84% in 105 bp) on HSA8q12.3 (Homo sapiens genome view build 22) was found. The AFLP fragment obtained with the E+AGT/T+AAC primer combination was sequenced and assigned to Sscr4 q1.5-q1.6 (P ⳱ 0.88) by using the INRA somatic cell hybrid panel. Vectorette walking was employed in order to isolate the restriction sites and selective nucleotides. About 0.23 kbp and 0.66 kbp new sequence from both, upstream and downstream directions, including selective nucleotides and adjacent restriction, were successfully isolated. Sequencing of the vectorette fragments revealed a single nucleotide polymorphism (SNP) in the TaqI recognition site. Similar to E+AGT/T+CAC fragment, the sequence of the E+AGT/ T+AAC fragment and the adjacent sequences (1221 bp in total, accession no. AF450118) showed no homology to known coding sequences but a homology with human genomic sequence (83% in 106 bp) on HSA8q21.13 (Homo sapiens genome view build 22) was found. A PCR-RFLP test for the TaqI SNP was designed and applied in genotyping of animals used in the AFLP analysis. Results confirmed that the PCR-RFLP marker, designated as STSBo3, identifies the original AFLP polymorphism. Statistical analyses. Genotyping of the F0 generation of the DUMI resource population revealed that for both STS markers the Duroc and Miniature pig founders were homozygous for alternative alleles (assigned D for Duroc founders and M for Miniature pig founders). In the F2 generation no significant deviation from the expected 1:1 ratio was observed. Single-marker analysis of 369 F2 offspring indicated significant association of the markers with putative QTL for all analyzed traits (results not shown). The most likely order of loci on the DUMI population Chromosome (Chr) 4 linkage map was (sex averaged distances are given in Kosambi centiMorgan): S0227–(43.6)–S0001–(14.4)–STS-Bo3–(5.2)–STSBo1–(1.4)–STS-Bo4–(18.0)–S0214–(41.2)–S0097. The map is similar to the maps published by Marklund et al. (1996) and Walling et al. (1998). Interval mapping confirmed the presence of significant QTL indicated by the single-marker analysis. Results from fitting one QTL are presented in Table 2 and Figure 1. The most likely position of the QTL is between the two STS markers, close to STSBo1. When testing two QTL vs. one QTL, none of the test statistics reached the suggestive level set for the test of one vs. no QTL (results not presented). Because of tight linkage of STS-Bo1 with the QTL, it was of interest to test it for association with carcass traits in commercial herds. Genotyping of purebred German Landrace pigs from two

Discussion The aim of the present study was to evaluate the usefulness of AFLP for QTL detection in livestock. Because of the high heritability of carcass traits like eye muscle area (0.4–0.6; Sellier 1994), this provides a valuable model trait for this purpose. The selective genotyping by means of AFLP, focusing on the identification of fragments with different frequencies between two groups built from extreme performing individuals, represent a case-control (i.e., association) study. Six extreme discordant sib pairs from different full sib families were used as cases/controls. This sampling strategy, proposed originally for linkage analysis, provides also a powerful design for association analysis (Risch and Zhang 1995). We have shown, that this experimental design is also suitable to identify functional candidate genes based on the detection of differences in the expression profiles by means of differential display RT-PCR analysis (Ponsuksili et al. 2000). However, the relatively small size of the sample limited the power of the design, especially for QTL with smaller effects. The power of the combination of selective genotyping and AFLP depends on the number of animals examined and their phenotypic and genetic differentiation. In our study we analyzed small groups of the most extreme discordant sibs with a larger number of AFLP-primer combinations first, and used larger groups of consequently less extreme animals for confirmation in only those primer combinations providing fragments markedly differing in the frequency distribution. An alternative approach to selective genotyping that was proposed earlier (Plotsky et al. 1993; Plastow et al. 1998) is the application of DNA pools. The appearance of AFLP bands in banding patterns derived from DNA pools, i.e., their presence or absence and their intensity, undoubtedly does not reflect the band frequency (Murani et al., unpublished). Therefore, the use of DNA pools from individuals of both tails of the trait distribution for AFLP analysis, while focusing only on fragments that are present or absent in the pools, is likely to provide an inflated rate of false negatives and positives. In cattle, the frequent occurrence of association between nonsyntenic loci was observed (Farnir et al. 2000). It is likely that similar widespread linkage disequilibium exists in pigs. To confirm the presence of a QTL in the region surrounding the potential marker, a test for linkage is needed. This is of particular importance when the QTL search is performed in an experimental population. It has been shown in an experimental pig cross that significant association with a quantitative trait could be found over large parts of the genome (Haley, 1999). In order to facilitate linkage QTL analyses, we attempted to derive simple PCR-based tests from original polymorphisms of two prominent AFLP markers. Simple PCR markers are more suitable for large-scale genotyping than AFLP and can be easily applied in marker-assisted selection. One AFLP marker turned out to be a 5-bp insertion/deletion within the AFLP fragment. Using the vectorette PCR (Riley et al. 1990), we have successfully identified an alternate TaqI restriction site, underlying the second AFLP marker. Extension of both STS sequences by vectorette PCR enabled us to identify a likely human ortholog to the region surrounded by the STS markers. Interval QTL mapping demonstrated that by using the proposed approach we were able to detect a significant QTL for eye muscle area, located on Chr 4. Significant effects (Pgenomewide < 0.05) of loci on Sscr1 (Rohrer and Keele 1998b), Sscr2 (Jeon et al. 1999, Nezer et al. 1999), Sscr3 (Andersson-Eklund et al. 1998),

K. Wimmers et al.: AFLP for QTL detection in pigs

209

Fig. 1. F-value curves for model fitting one QTL. Arrows on the x-axis indicate the position of the microsatellites; the dashed arrows, the position of STS derived from AFLP markers for eye muscle area. The horizontal dashed line represents the genomewide significance level Pgenomewide ⳱ 0.05.

and Sscr7 (Geldermann et al. 1999) on eye muscle area were reported. On Sscr4 a significant QTL for eye muscle area was found by Pe´rez-Enciso et al. (2000) in the same region (in the interval S0001–S0214) as the QTL in the present study. A suggestive QTL for eye muscle area in this region reported by Wang et al. (1998) gives additional support to our results. The discovery of two prominent AFLP markers that turned out to map to the same chromosomal region and to be linked to QTL that have also been identified in other populations indicates that, by using AFLP-based association QTL mapping, we detected one of major QTL segregating in our resource population and probably in many pig populations. However, the statistical support for association of the STSBo1 with variation in the eye muscle area in the commercial German Landrace pigs is weak. In contrast to the DUMI resource population, where the M allele is associated with lower performance, in the German Landrace it is associated with increased eye muscle area, but showed low frequency probably because of undesired effects of the QTL or other linked loci. Another reason could be lack of linkage disequilibrium between marker and QTL. As shown by the results of the BLAST search, the QTL region on Sscr4 most likely corresponds with human Chr 8. This is in good agreement with published pig–human comparative maps (http://www.toulouse.inra.fr/lgc/pig/compare/compare.htm). The orthologous region comprises two positional candidate genes: corticotropin–releasing hormone, located close to the STS-Bo1 homologous sequence, and musculin. So far, sequence analysis has revealed no apparent functional elements within the STS. Since there is accumulating evidence of a major effect of loci on chromosome 4 on backfat thickness and carcass length, we have also included these two traits in the QTL analysis. Similar to Pe´rez-Enciso et al. (2000), we have found a significant QTL for backfat thickness in the same position as the QTL for eye muscle area. The position of the QTL in our study corresponds well with that reported by Knott et al. (1998). The strongest evidence of a QTL we have found is that for a QTL affecting carcass length. The location of the QTL is comparable with that found by Geldermann et al. (1999). It can be concluded that the present study has proved the capability of the AFLP-based selective genotyping for QTL detec-

tion in animal experimental crosses. In contrast to QTL mapping by genome scans performed with microsatellites in experimental populations, this approach allows analysis of only one trait or a couple of correlated traits. However, for analyses focusing on one trait or for whole-genome QTL scans in species with less developed linkage maps, this approach represents a useful alternative to linkage QTL mapping. Furthermore, AFLP gives one the opportunity to produce new markers and fine-map regions already known to contain QTL through the analysis of individuals differing extremely in phenotype and carrying different alleles at markers surrounding the QTL region (e.g., Parker et al. 1998). As regards the application of the proposed approach in the commercial pig populations, the routine of performance testing of two sibs and the improved and increased amount of phenotypic data recorded in the breeding process can provide a large number of samples suitable to select extremely discordant sib pairs. However, even when this sampling strategy is not used, selecting individuals from large populations is recommended (Van Gestel et al. 2000). References Ajmone-Marsan P, Valentini A, Cassandro M, Vecchiotti-Antaldi G, Bertoni G et al. (1997) AFLP markers for DNA fingerprinting in cattle. Anim Genet 28, 418–426 Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z et al. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25, 3389–3402 Andersson L, Haley CS, Ellegren H, Knott SA, Johansson M et al. (1994) Genetic mapping of quantitative trait loci for growth and fatness in pigs. Science 263, 1771–1774 Andersson-Eklund L, Marklund L, Lundstrom K, Haley CS, Andersson K et al. (1998) Mapping quantitative trait loci for carcass and meat quality traits in a wild boar × Large White intercross. J Anim Sci 786, 694–700 Darvasi A, Soller M (1994) Selective DNA pooling for determination of linkage between a molecular marker and a quantitative trait locus. Genetics 138, 1365–1373 Farnir F, Coppieters W, Arranz JJ, Berzi P, Cambisano N et al. (2000) Extensive genome-wide linkage disequilibrium in cattle. Genome Res 10, 220–227

210 Geldermann H, Moser G, Mu¨ller E, Beeckmann P, Yue G et al. (1999) Status of genome and QTL mapping in pigs—data of Hohenheim F2 families. Arch Tierz Dummerstorf 42, 67–81 Green P, Falls K, Crooks S (1990) Cri-Map, Version 2.4. St. Louis, Mo.: Washington University School of Medicine Haley CS (1999) Advances in quantitative trait locus mapping. In From Jay Lush to Genomics: Visions for Animal Breeding and Genetics, 16– 18 May 1999, JCM Dekkers, SJ Lamont, MF Rothschild, eds. (Ames, Iowa: AgBiotechNet威), pp 47–59 Haley CS, Knott SA, Elsen JM (1994) Mapping quantitative trait loci in crosses between outbred lines using least squares. Genetics 136, 1195– 1207 Hardge T, Ko¨pke K, Reißmann M, Wimmers K (1999) Maternal influences on litter size and growth in reciprocal crossed miniature pigs and Durocs. Arch Tierz Dummerstorf 42, 83–92 Homo sapiens genome view build 22. (2001) NCBI home page. http://www. ncbi.nlm.nih.gov/genome/seq/page.cgi?F⳱HsBlast.html&&ORG⳱Hs Jeon JT, Carlborg O, Tornsten A, Giuffra E, Amarger V et al. (1999) A paternally expressed QTL affecting skeletal and cardiac muscle mass in pigs maps to the IGF2 locus. Nat Genet 21, 157–158 Knott SA, Marklund L, Haley CS, Andersson K, Davies W et al. (1998) Multiple marker mapping of quantitative trait loci in a cross between outbred wild boar and large white pigs. Genetics 149, 1069–1080 Lander ES, Botstein D (1989) Mapping Mendelian factors underlying quantitative traits using RFLP linkage maps. Genetics 121, 185–199 Lander E, Kruglyak L (1995) Genetic dissection of complex traits: guidelines for interpreting and reporting linkage results. Nat Genet 11, 241– 247 Marklund L, Johansson Moller M, Hoyheim B, Davies W, Fredholm M et al. (1996) A comprehensive linkage map of the pig based on a wild pig–Large White intercross. Anim Genet 27, 255–269 Nezer C, Moreau L, Brouwers B, Coppieters W, Detilleux J et al. (1999) An imprinted QTL with major effect on muscle mass and fat deposition maps to the IGF2 locus in pigs. Nat Genet 21, 155–156 Parker GD, Chalmers KJ, Rathjen AJ, Landridge P (1998) Mapping loci associated with flour colour in wheat (Triticum aestivum L.). Theor Appl Genet 97, 238–245 ´ vilo C, Coll A et al. (2000) A QTL Pe´rez-Enciso M, Clop A, Noguera JL, O on pig chromosome 4 affects fatty acid metabolism: evidence from an Iberian by Landrace intercross. J Anim Sci 78, 2525–2531 Plastow GS, Kuiper M, Wales R, Archibald AL, Haley CS et al. (1998)

K. Wimmers et al.: AFLP for QTL detection in pigs AFLP for mapping and QTL detection in commercial pigs. Proc 6th World Cong Genet Appl Livest Prod, Armidale, Australia 23, 209–212 Plotsky Y, Cahaner A, Haberfeld A, Lavi U, Lamont SJ et al. (1993) DNA fingerprint bands applied to linkage analysis with quantitative trait loci in chickens. Anim Genet 24, 105–110 Ponsuksili S, Wimmers K, Schmoll F, Robic A, Schellander K (2000) Porcine ESTs detected by differential display representing possible candidates for the trait ‘eye muscle area’. J Anim Breed Genet 117, 25–35 Riley J, Butler R, Ogilvie D, Finniear R, Jenner D et al. (1990) A novel, rapid method for the isolation of terminal sequences from yeast artificial chromosome (YAC) clones. Nucleic Acids Res 18, 2887–2890 Risch N, Zhang H (1995) Extreme discordant sib pairs for mapping quantitative trait loci in humans. Science 268, 1584–1589 Rohrer GA, Keele JW (1998a) Identification of quantitative trait loci affecting carcass composition in swine: I. Fat deposition traits. J Anim Sci 76, 2247–2254 Rohrer GA, Keele JW (1998b) Identification of quantitative trait loci affecting carcass composition in swine: II. Muscling and wholesale product yield traits. J Anim Sci 76, 2255–2262 SAS (1996) SAS User’s Guide, Statistics Version, 6th ed. (Cary, N.C.: SAS Institute Inc.) Sellier P (1994) The future role of molecular genetics in the control of meat production and meat quality. Meat Sci 36, 29–44 Van Gestel S, Houwing-Duistermaat JJ, Adolfsson R, van Duijn CM, Van Broeckhoven C (2000) Power of selective genotyping in genetic association analyses of quantitative traits. Behav Genet 30, 141–146 Vos P, Hogers R, Bleeker M, Reijans M, van de Lee T et al. (1995) AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res 23, 4407– 4414 Walling GA, Archibald AL, Cattermole JA, Downing AC, Finlayson HA et al. (1998) Mapping of quantitative trait loci on porcine chromosome 4. Anim Genet 29, 415–424 Wang L, Yu TP, Tuggle CK, Liu HC, Rothschild MF (1998) A directed search for quantitative trait loci on chromosomes 4 and 7 in pigs. J Anim Sci 76, 2560–2567 Yerle M, Echard G, Robic A, Mairal A, Dubut-Fontana C et al. (1996) A somatic cell hybrid panel for pig regional gene mapping characterized by molecular cytogenetics. Cytogenet Cell Genet 73, 194–202 Yerle M, Pinton P, Robic A, Alfonso A, Palvadeau Y et al. (1998) Construction of a whole-genome radiation hybrid panel for high-resolution gene mapping in pigs. Cytogenet Cell Genet 82, 182–188