SHORT COMMUNICATION
Detection of Rickettsia rickettsii and Bartonella henselae in Rhipicephalus sanguineus Ticks from California MARY ELIZABETH WIKSWO,1,2 RENJIE HU,3 MARCO E. METZGER,3 1,4 AND MARINA E. EREMEEVA
J. Med. Entomol. 44(1): 158Ð162 (2007)
ABSTRACT Sixty-two questing adult Rhipicephalus sanguineus (Latreille) ticks were collected by direct removal from blades of turfgrass and adjacent concrete walkways at a suburban home in Riverside County, CA, and tested for the presence of Rickettsia, Bartonella, and Ehrlichia DNA. Polymerase chain reaction (PCR) was used to amplify fragments of the 17-kDa antigen gene and the rOmpA gene of the spotted fever group rickettsiae. One male tick contained R. rickettsii DNA; its genotype differed from R. rickettsii isolates found in Montana and Arizona that cause Rocky Mountain spotted fever and from Hlp#2 and 364D serotypes. One male tick and one female tick contained B. henselae DNA. No Ehrlichia platys or Ehrlichia canis DNAs were detected using nested PCR for their 16S rRNA genes. These Þndings extend the area where Rickettsia rickettsii may be vectored by Rh. sanguineus. Rh. sanguineus also may be infected with Bartonella henselae, a human pathogen that is typically associated with ßeas and causes cat scratch disease. KEY WORDS Rocky Mountain spotted fever, Rhipicephalus sanguineus, Rickettsia rickettsii, Bartonella henselae, California
Rhipicephalus sanguineus (Latreille), the brown dog tick, is distributed worldwide, with a predominantly urban distribution. Domestic dogs are the preferred hosts, although Rh. sanguineus can be found on a variety of domestic and wild animals, including cattle, sheep, cats, rodents, wild canids, wild boar, and rarely humans (Carpenter et al. 1990, Walker et al. 2000, Dantas-Torres et al. 2005, Foata et al. 2006) Rh. sanguineus also has been known to cause infestations in homes and may persist there for years (Lord 2001). In California, adult Rh. sanguineus ticks have been collected year-round and encountered mostly in areas where dogs are maintained (Furman and Loomis 1984). Rh. sanguineus is important mainly as a bloodsucking nuisance of dogs, but it also has great potential for carrying disease-causing agents. In parts of southern Europe, Asia, and Africa, Rh. sanguineus is the classic vector of Rickettsia conorii, the causative agent of Mediterranean spotted fever, and Rickettsia massiliae, which has recently been implicated as a cause of human disease (Parola et al. 2005, Vitale et al. 2006). New World Rh. sanguineus are commonly associated with Rickettsia rhipicephali; 1 Rickettsial Zoonoses Branch, Centers for Disease Control and Prevention, Atlanta, GA 30333. 2 Rollins School of Public Health, Emory University, Atlanta, GA 30322. 3 California Department of Health Services, Vector-Borne Disease Section, Ontario, CA 91764. 4 Corresponding author, e-mail:
[email protected].
Ehrlichia canis, the causative agent of canine ehrlichiosis; Babesia canis, the causative agent of canine babesiosis, which only very rarely causes disease in humans; and Ehrlichia platys, whose pathogenicity is not fully understood (Burgdorfer et al. 1975, Walker et al. 2000, Lord 2001). In the United States, Rh. sanguineus was recently found infected with R.. rickettsii in a region of Arizona with fatal cases of Rocky Mountain spotted fever (RMSF), but where classic vectors of RMSF were absent (Demma et al. 2005). R. massiliae also has been detected recently in Rh. sanguineus from Arizona (Eremeeva et al. 2006a). In California, the role of Rh. sanguineus as a potential vector of various tick-borne diseases is not fully understood. We report here the detection of DNA of both Bartonella henselae, the causative agent of cat scratch disease, and R. rickettsii in questing adult Rh. sanguineus ticks collected from Riverside County, CA, and extend the list of pathogenic agents carried by brown dog ticks and their geographic distribution, respectively. Materials and Methods Collection of Ticks and DNA Preparation. In response to a tick infestation complaint, questing adult Rh. sanguineus ticks were collected by direct removal from blades of turfgrass and adjacent concrete walkways at a suburban home in the city of Riverside, Riverside County, CA, on 26 July 2005. In total, 62
January 2007 Table 1.
WIKSWO ET AL.: Rickettsia AND Bartonella IN CALIFORNIA
159
Primers used for detection and characterization of Rickettsia, Bartonella, and Ehrlichia
Application
Target
Screening for spotted fever group rickettsiae
17-kDa antigen gene (htrA)
Species identiÞcation of rickettsiae
rOmpA gene (rompA)
Genotype characterization of R. rickettsii Detection and identiÞcation of Bartonella
VNTR B
Detection and identiÞcation of E. chaffeensis and E. playtis
16S rRNA (rrs)
Riboßavin synthase gene (ribC)
Primer ID
Primer sequence 5⬘33⬘
Rr17-122 Rr17-500 TZ15 TZ16 Rr190-70 Rr190-701 Rr190-602 BF BR RibC-1F RibC-1R RibC-2F RibC-2R ECC ECB ECAN5 HE3 PLATYS
CAGAGTGCTATGAACAAACAAGG CTTGCCATTGCCCATCAGGTTG TTCTCAATTCGGTAAGGGC ATATTGACCAGTGCTATTC ATGGCGAATATTTCTCCAAAAA GTTCCGTTAATGGCAGCATCT AGTGCAGCATTCGCTCCCCCT AGCCTTAGATAATGTCTTAAC CATGGCTTCAAAAAAAGAACC CGGATATCGGTTGTGTTGAA CATCAATRTGACCAGAAACCA GCATCAATTGCGTGTTCA CCCATTTCATCACCCAAT AGAACGAACGCTGGCGGCAAGC CGTATTACCGCGGCTGCTGGCA CAATTATTTATAGCCTCTGGCTATAGGA TATAGGTACCGTCATTATCTTCCCTAT GATTTTTGTCGTAGCTTGCTATG
adult ticks were collected and preserved in 70% ethanol until being tested for the presence of DNA of various disease agents. Ticks were individually surface disinfected in 10% bleach and 70% ethanol, dried, frozen in liquid nitrogen, and crushed into powder by using Kontes pestles (Kimble-Kontes, Fisher, Pittsburgh, PA). The powder was then resuspended in ATL lysis buffer supplemented with 1 mg/ml of proteinase K (QIAGEN, Valencia CA) and incubated overnight at 56⬚C. DNA was extracted with a QIAamp DNA Mini kit (QIAGEN) and stored at 4⬚C before analysis. All reactions were performed using a TaqPCR Master Mix kit (QIAGEN) and an Eppendorf Master Cycler (Eppendorf, Westbury, NY). Primers were synthesized by the Centers for Disease Control and Prevention (CDC) Core Facility (Atlanta, GA) and used at a Þnal concentration of 1 M unless otherwise indicated. The primers used, their characteristics, and their applications are listed in Table 1. Detection and Identification of Rickettsia Species. Polymerase chain reaction (PCR) assays for the 17-kDa antigen gene of spotted fever group rickettsiae, the rOmpA gene for Rickettsia species identiÞcation, and the variable number tandem repeat region B for characterization of R. rickettsii at the genotype level were used. DNA from R. sibirica strain K-1 grown in VERO E6 cells was used as a positive control. The R. rickettsii strain Sheila Smith intergenic region B (845704 Ð 845898 nt) fragment was ampliÞed as described previously (Eremeeva et al. 2006b). Detection and Identification of Bartonella Species. A nested PCR assay was used to amplify a fragment of the riboßavin synthase gene (ribC) (Zeaiter et al. 2003) to detect Bartonella DNA. DNA of B. bacilliformis strain KC584 was used a positive control. Detection and Identification of Ehrlichiae. For the detection of E. platys and E. canis DNA, nested PCR assays were used to amplify fragments of their 16S rRNA genes. Primers ECC and ECB were used in the
Reference Eremeeva et al. 2006a Eremeeva et al. 2006a Eremeeva et al. 2006b Zeaiter et al. 2003
Murphy et al. 1998
Inokuma et al. 2000
primary ampliÞcations with DNA from E. canis strain Oklahoma and E. platys strain LSU, respectively, as positive controls. Primers ECAN5 and HE3 were used in the nested ampliÞcations of the 16S rRNA gene sequence of E. canis (Murphy et al. 1998). Primers ECB and PLATYS were used in the seminested ampliÞcations of the 16S rRNA gene sequence of E. platys (Inokuma et al. 2000). Amplicons of the expected size were detected by electrophoresis in 1.2% agarose gel stained with 0.5 g/ml ethidium bromide. Amplicon bands were excised, and the DNA recovered using Wizard PCR Preps (Promega, Madison, WI). The puriÞed product was sequenced with the ABI PRISM BigDye Terminator Cycle 3.1 Sequencing kit (Applied Biosystems, Foster City, CA). The sequenced product was then puriÞed with a DyeEx 2.0 kit (QIAGEN) and run on an Applied Biosystems 3100 sequencer. The data were analyzed with Nucleic Acid Sequence Analyzer (AppliedBiosystems)andCAPsequenceassembler(www. infobiogen.fr). Homologous sequences were detected using the National Center for Biotechnology Information (NCBI) BLAST search engine. Sequences generated in this study were submitted to the NCBI GenBank under the following accession numbers: DQ452933 for rompA fragment from tick RSCA13, DQ666025 for the repeat region B from RSCA13, DQ452934 for ribC fragment from RSCA9, and DQ452935 for ribC from RSCA45. Results Nested PCR testing results indicated that one male tick (1.6%) contained R. rickettsii DNA for the 17-kDa antigen gene. The same tick DNA was positive with the seminested PCR for a rompA fragment. The nucleotide sequence of 532 bp of the 5⬘ end rompA had 100% sequence identity to the sequence of the homologous rompA fragment of R. rickettsii reference strain Sheila Smith. However, the R. rickettsii DNA found in the California Rh. sanguineus tick differed from DNA of the reference
JOURNAL OF MEDICAL ENTOMOLOGY Fig. 1. Differentiation of R. rickettsii DNA from tick RSCA13 from DNA from R. rickettsii strains found in Montana and Arizona. Tandem repeated sequences (GGTGGA) are highlighted. GenBank sequences: R. rickettsii strain Sheila Smith isolated in Montana (845741Ð845848 nt from AADJ01000001), R. rickettsii Arizona strain AZ1 from Rh. sanguineus DQ666024, R. rickettsii strain Hlp#2 DQ864504, and D. occidentalis isolate 364D DQ864505.
160
Vol. 44, no. 1
strain Sheila Smith and from strains found in Arizona in two sites located between 845704 and 845898 nt of the Sheila Smith genome sequence (Fig. 1). Within this region, strain Sheila Smith has three loci consisting of four, two, and three exact repeated hexamers (GGTGGA), respectively, separated by two identical 27-nt sequences. Homologous loci from R. rickettsii strains isolated from Rh. sanguineus in Arizona contain four, three, and three of the same repeated hexamers, whereas R. rickettsii DNA detected in the tick from California had a different arrangement consisting of three, three, and three hexamers. Serotype 364D from Californian Dermacentor occidentalis (Marx) and Hlp#2 from Haemaphysalis leporispalustris (Packard) also have different genotypes in this locus (Fig. 1). DNA from one male tick and one female tick, neither of which tested positive for R. rickettsii, were positive for Bartonella. Fragments of their RibC genes were identical in sequence to that of B. henselae strain Houston-1. No Ehrlichia DNA was detected in any of the 62 tick DNA samples.
Discussion We report here the Þrst detection of R. rickettsii and B. henselae in questing adult Rh. sanguineus ticks from California. These results extend further west evidence of an association between R. rickettsii and brown dog ticks and raise additional questions regarding the role of this tick in the epidemiology of RMSF in California and elsewhere. The Þrst recorded human case of RMSF in California occurred in 1903 (Rotramel et al. 1976). In the next 35 yr, 188 cases were reported in California, nearly all in the Modoc Plateau area where Dermacentor andersoni (Stiles), a well-studied vector of RMSF, occurs. Subsequently, sporadic cases of RMSF in California were diagnosed outside the distribution of D. andersoni, suggesting that another tick also might be responsible for transmission of the disease. Laboratory studies implicated several other tick species including Dermacentor variabilis (Say), D. occidentalis, Dermacentor parumapertus (Neumann), Rh. sanguineus, and H. leporispalustris as possible vectors for R. rickettsii, all of which can be found in southern California where RMSF has been reported (Rotramel et al. 1976). Tick surveys conducted in 1980 detected spotted fever group rickettsiae in ticks collected in both northern and southern counties in California. More than 30% D. occidentalis ticks from San Bernardino County were tested positive for rickettsiae by hemolymph test (Lane et al. 1981). Rickettsial isolates from California ticks were characterized by microimmunoßuorescence typing and shown to vary in serotype. However, characterization of the spotted fever group rickettsiae found in association with these ticks is incomplete as contemporary molecular identiÞcation methods were not used and most of these isolates have been lost.
January 2007
WIKSWO ET AL.: Rickettsia AND Bartonella IN CALIFORNIA
The 2003Ð2004 outbreak investigation of RMSF in Arizona was the Þrst to provide molecular evidence implicating Rh. sanguineus in the transmission of R. rickettsii in the United States (Demma et al. 2005). The detection of R. rickettsii in Rh. sanguineus in California suggests that Rh. sanguineus may harbor R. rickettsii throughout its range, although more studies are needed. Furthermore, the differences between the genotypes of R. rickettsii isolated from California, Montana, and Arizona Rh. sanguineus provide additional evidence of signiÞcant genetic diversity in this species of spotted fever group rickettsiae. Whether the California genotype is as pathogenic as the isolates from Montana and Arizona is unknown. Moreover, the R. rickettsii DNA detected in Rh. sanguineus is clearly not related to the 364D and Hlp#2 serotypes that seem to be closely related, but likely nonpathogenic, spotted fever group rickettsiae. The relative importance of other ticks, particularly, D. variabilis and D. occidentalis, in the transmission of sporadic cases of RMSF in areas of California where D. andersonii is not present also is unclear. Domestic cats are considered to be both reservoirs and vectors for human infection with B. henselae, but transmission among cats is thought to occur primarily through their ßeas, speciÞcally the cat ßea, Ctenocephalides felis (Bouche´ ). However, cat ßea transmission to humans has not been excluded (Boulouis and Chomel 2004). Up to 30% of human cat scratch disease patients have not been scratched or bitten by cats and 1% of these patients do not have any known contact with animals (Chang et al. 2001). Similar to Rh. sanguineus and RMSF, nontraditional vectors also have recently been associated with B. henselae (Chang et al. 2001, 2002). A recent study of California ticks found Bartonella DNA for the Þrst time in 4.4% Ixodes pacificus Cooley & Kohls, 1.8% D. occidentalis, and 3.3% D. variabilis ticks (Chang et al. 2002). Another study in New Jersey detected B. henselae DNA in I. scapularis ticks collected from patient homes (Eskow et al. 2001). Bartonella DNA also has been found in 37.6% of Ixodes persulcatus Schulze, and 21.4% of D. reticulatus ticks collected from vegetation in Western Siberia (Rar et al. 2005). The discovery of Bartonella DNA in several species of ticks, and more speciÞcally of B. henselae in both Rh. sanguineus and I. scapularis, indicates that B. henselae may be transmitted through several tick vectors in addition to the commonly recognized cat-mediated mechanism. It is not understood whether Rh. sanguineus plays an important part in the natural cycles and transmission of R. rickettsii and B. henselae, or whether these bacteria may affect survival of the tick and its progeny. Consequently, whether the detection of R. rickettsii and B. henselae DNA in questing ticks reported here and by others represents an incidental spillover of these agents from their primary vectorÐreservoir cycles much as humans are dead end hosts for R. rickettsii and B. henselae, or this is an important part of the
161
natural history of these human pathogens, needs further systematic study.
Acknowledgments We thank Gregory A. Dasch (Rickettsial Zoonoses Branch, CDC, Atlanta) for valuable comments and review of the manuscript.
References Cited Boulouis, H. J., and B. Chomel. 2004. Bartonellosis: emerging infection. Rev. Prat. 54: 1982Ð1986. Burgdorfer, W., D. J. Sexton, R. K. Gerloff, R. L. Anacker, R. N. Philip, and L. A. Thomas. 1975. Rhipicephalus sanguineus: vector of a new spotted fever group rickettsia in the United States. Infect. Immun. 12: 205Ð210. Carpenter, T. L., M. C. McMeans, and C. P. McHugh. 1990. Additional instances of human parasitism by the brown dog tick (Acari: Ixodidae). J. Med. Entomol. 27: 1065Ð 1066. Chang, C. C., B. B. Chomel, R. W. Kasten, V. Romano, and N. Tietze. 2001. Molecular evidence of Bartonella spp. in questing adult Ixodes pacificus ticks in California. J. Clin. Microbiol. 39: 1221Ð1226. Chang, C. C., H. Hayashidani, N. Pusterla, R. W. Kasten, J. E. Madigan, and B. B. Chomel. 2002. Investigation of Bartonella infection in ixodid ticks from California. Comp. Immunol. Microbiol. Infect. Dis. 25: 229 Ð236. Dantas-Torres, F., L. A. Figueredo, and S. P. Brandao-Filho. 2006. Rhipicephalus sanguineus (Acari: Ixodidae), the brown dog tick, parasitizing humans in Brazil. Rev. Soc. Bras. Med. Trop. 39: 64 Ð 67. Demma, L. J., M. S. Traeger, W. L. Nicholson, C. D. Paddock, D. M. Blau, M. E. Eremeeva, G. A. Dasch, M. L. Levin, J. Singleton, Jr., S. R. Zaki, J. E. Cheek, D. L. Swerdlow, and J. H. McQuiston. 2005. Rocky Mountain spotted fever from an unexpected tick vector in Arizona. New England J. Medicine 353: 587Ð594. Eremeeva, M., E. A. Bosserman, L. J. Demma, M. L. Zambrano, D. M. Blau, and G. A. Dasch. 2006a. Isolation and identiÞcation of Rickettsia massiliae in Rhipicephalus sanguineus ticks from Arizona. Appl. Environ. Microbiol. 72: 5569 Ð5577. Eremeeva, M., E. A. Bosserman, M. L. Zambrano, L. J. Demma, and G. A. Dasch. 2006b. Molecular typing of Rickettsia rickettsii strains from Arizona. Ann. NY Acad. Sci. 1078: 573Ð577. Eskow, E., R. V. Rao, and E. Mordechai. 2001. Concurrent infection of the central nervous system by Borrelia burgdorferi and Bartonella henselae: evidence for a novel tickborne disease complex. Arch. Neurol. 58: 1357Ð1363. Foata, J., D. Mouillot, J.-L. Culioli, and B. Marchand. 2006. Inßuence of season and host age on wild boar parasites in Corsica using indicator species analysis. J. Helminthology 80: 41Ð 45. Furman, D. P., and E. C. Loomis. 1984. The Tick of California: (Acari; Ixodida). Bull. Calif. Insect Survey, vol. 25. Inokuma, H., D. Raoult, and P. Brouqui. 2000. Detection of Ehrlichia platys DNA in brown dog ticks (Rhipicephalus sanguineus) in Okinawa Island, Japan. J. Clin. Microbiol. 38: 4219 Ð 4221. Lane, R. S., R. N. Philip, and E. A. Casper. 1981. Ecology of tick-borne agents in California. II. Further observations on rickettsiae. In W. Burgdorfer and R. L. Anacker [eds.], Rickettsiae and rickettsial diseases. Academic, New York.
162
JOURNAL OF MEDICAL ENTOMOLOGY
Lord, C. C. 2001. Brown dog tick, Rhipicephalus sanguineus Latreille (Arachnida: Acari: Ixodidae). Featured creatures, University of Florida, Gainesville, FL. Murphy, G. L., S. A. Ewing, L. C. Whitworth, J. C. Fox, and A. A. Kocan. 1998. A molecular and serologic survey of Ehrlichia canis, E. chaffeensis, and E. ewingii in dogs and ticks from Oklahoma. Vet. Parasitol. 79: 325Ð339. Parola, P., C. D. Paddock, and D. Raoult. 2005. Tick-borne rickettsioses around the world: emerging diseases challenging old concepts. Clin. Microbiol. Rev. 18: 719 Ð756. Rar, V. A., N. V. Fomenko, A. K. Dobrotvorsky, N. N. Livanova, S. A. Rudakova, E. G. Fedorov, V. B. Astanin, and O. V. Morozova. 2005. Tickborne pathogen detection, Western Siberia, Russia. Emerg. Infect. Dis. 11: 1708 Ð1715. Rotramel, G. L., T. G. Schwan, and R. E. Doty. 1976. Distribution of suspected tick vectors and reported cases of
Vol. 44, no. 1
Rocky Mountain spotted fever in California. Am. J. Epidemiol. 104: 287Ð293. Vitale, G., S. Mansuelo, J.-M. Rolain, and D. Raoult. 2006. Rickettsia massiliae human isolation. Emerg. Infect. Dis. 12: 174 Ð175. Walker, J. B., J. E. Keirans, and I. G. Horak [eds.]. 2000. Rhipicephalus sanguineus (Latreille, 1806). Cambridge University Press, New York, NY. Zeaiter, Z., P.-E. Fournier, G. Greub, and D. Raoult. 2003. Diagnosis of Bartonella endocarditis by a real-time nested PCR assay using serum. J. Clin. Microbiol. 41: 919 Ð925.
Received 25 July 2006; accepted 8 October 2006.
