Song, J.-H., H. Cho, M. Y. Park, D. S. Na, H. B. Moon, and C. H.. Pai. 1993. Detection ... concerning the diagnosis and treatment of Lyme disease. A 41-year-old ...
LET[ERS TO THE EDITOR
VOL. 32, 1994
antigen. So far, our attempts to use the ,u-capture technique with enzyme-conjugated antigen have resulted in lessened sensitivity of the assay, and further work is necessary to establish an enzyme immunoassay method for measuring poliovirus-specific IgM antibodies.
1415
immunoglobulin M antibodies in laboratory diagnosis of acute poliomyelitis. J. Clin. Microbiol. 31:2427-2432. 2. Roivainen, M., E. Kinnunen, and T. Hovi. Twenty-one patients with strictly defined postpoliomyelitis syndrome: no poliovirus-specific IgM antibodies in the cerebrospinal fluid, submitted for publication. Merja Roivainen, Ph.D. Tapani Hovi, M.D., Ph.D., professor Enterovirus Laboratory National Public Health Institute Mannerheimintie 166 SF-00300 Helsinki Finland
REFERENCES 1. Roivainen, M., M. Agboatwalla, M. Stenvik, T. Rysa, D. S. Akram, and T. Hovi. 1993. Intrathecal immune response and virus-specific
Detection of Salmonella typhi by PCR In their paper, Song et al. describe a PCR-based diagnostic test for the detection of Salmonella typhi (3). The authors employed a nested PCR approach using as their first pair of primers an S. typhi-specific forward primer (ST 1) and a common flagellin gene-derived reverse primer and nested to them a second set of primers. In this second set, the forward primer (ST 3) was originally also thought to be S. typhi specific (1) but was later found to share the same DNA sequence with other type d flagellin genes (2). Therefore, it is not surprising that in the nested PCR, applied to cultured salmonella, an amplified product was obtained when S. typhi as well as S. muenchen DNA was used as template. In the Discussion section, the authors doubt (quite rightly) the significance and actual probability of finding S. muenchen in blood samples. However, in order to avoid this problem altogether, the authors could have used, as we are in our laboratory, a different forward primer for the first PCR which is derived from the DNA sequence located just upstream to primer ST I (1, 3), i.e., 5' TATGCCGCTACATATGATGAG 3' (1), together with primer ST 2 (1, 3). The use of these primers in the first round of DNA amplification should result in an amplified product using either S. typhi or S. muenchen DNA template (and also DNA from other Salmonella species expressing flagellar antigen d). Primer ST 1, which is the S. typhi-specific
primer, should then be used together with primer ST 4 (3) for the nested reaction. As blood PCR was positive only for the nested reactions, false-positive amplification due to sample contamination with other Salmonella species (like S. muenchen) will be avoided. REFERENCES 1. Frankel, G., S. M. C. Newton, G. K. Schoolnik, and B.A. D. Stocker. 1989. Unique sequences in region VI of the flagellin gene of Salmonella typhi. Mol. Microbiol. 3:1379-1383. 2. Moshitch, S., L. Doll, B.-Z. Rubinfeld, B. A. D. Stocker, G. K. Schoolnik, Y. Gafni, and G. Frankel. 1992. Mono- and bi-phasic Salmonella typhi: genetic homogeneity and distinguishing characteristics. Mol. Microbiol. 6:2589-2597. 3. Song, J.-H., H. Cho, M. Y. Park, D. S. Na, H. B. Moon, and C. H. Pai. 1993. Detection of Salmonella typhi in the blood of patients with typhoid fever by polymerase chain reaction. J. Clin. Microbiol. 31:1439-1443. Gad Frankel Department of Biochemistry Imperial College of Science, Technology and Medicine London SW7 2AY, United Kingdom
Ed. Note: The author of the published article declined to respond.
Treatment of Late Lyme Disease: We have read with great interest Liegner's guest commentary (1). We present a case which supports Liegner's opinions concerning the diagnosis and treatment of Lyme disease. A 41-year-old male physician suffered a tick bite on his back. Forty-four hours later, the tick was traumatically removed by a dermatologist. Prophylactic oral doxycycline (200 mg/12 h) was administered for 5 consecutive days. Three months later, he complained of fatigue, febricula, and asthenia. The patient ignored these symptoms until he noted generalized and progressive muscle hypotrophy with fasciculations, accompanied by nonspecific neurologic, gastrointestinal, genitourinary, and cardiorespiratory symptomatology 27 months after the tick bite. He was initially diagnosed as having a psychiatric disorder by several specialists. Ancillary studies included complete blood count, erythrocyte sedimentation rate, biochemical pro-
a
Challenge to Accept
filing, serum immunoglobulins (Igs), thyroid hormones, human immunodeficiency virus, Treponema pallidum, Brucella mellitensis, Salmonella typhi, Epstein Barr virus serum antibody titers, tuberculin testing, chest X ray, electrocardiogram, electroencephalogram, echocardiography, abdominal ultrasound, and central nervous system (CNS) magnetic resonance imaging. Results were within the normal range except for a high serum IgM titer and partial IgA deficiency. Forty-one months after the tick bite, the patient was diagnosed by a neurologist as having probable encephalomyelitis due to Borrelia burgdorferi. Serum and cerebrospinal fluid (CSF) antibody titers to B. burgdorferi, as well as CSF cytology and biochemistry, were negative. Thus, no antibiotic therapy was initiated until further clinical deterioration was very evident. He received 2 g of ceftriaxone daily for 4 weeks. Marked early clinical improve-
1416
LETTERS TO THE EDITOR
ment was observed and continued for 3 weeks after therapy was discontinued. He received 6 additional courses of intravenous antibiotics for 3 to 5 weeks' duration (penicillin, doxycycline [two courses], and ceftriaxone [three courses]), and 1 oral antibiotic (azithromycin). His general condition improved, but each antibiotic course was followed by a relapse. He was not asymptomatic while on antibiotic therapy. Specific B. burgdorferi serum IgM immune complex determination was positive in a stored sample obtained after the first antibiotic course. The analysis was done 10 months after the presumptive diagnosis. This case may be included in what some refer to as rare phenomena, that is, seronegative patients with circulating immune complexes to B. burgdorferi and poor response to standard treatment for late Lyme disease. The diagnosis of Lyme disease relies on compatible clinical findings for patients with histories of tick bites in areas in which the disease is endemic. The unreliability of available laboratory tests and seronegative Lyme disease patients underscore the importance of clinical impressions (1, 4). The proven efficacy of antibiotics as prophylactic and therapeutic agents of early disease supports an active treatment policy. This becomes more evident when one realizes that cases such as the one previously described could have been prevented. Many questions about the treatment of late Lyme disease remain unanswered. Should antimicrobial treatment be longer and/or include several agents to eradicate intracellular spirochetes, as is recommended for mycobacterial infections? Should treatment include novel therapies such as granulocytemacrophage colony stimulating factor or gamma interferon, proven effective for intracellular parasitic, fungal, and bacterial infections (2, 3)? REFERENCES 1. Liegner, K. B. 1993. Lyme disease: the sensible pursuit of answers. J. Clin. Microbiol. 31:1961-1963. 2. Perrine, S. P., E. Vichinsky, and D. V. Faller. 1989. Hematopoietic hormones: from cloning to clinic. Am. J. Pediatr. Hematol. Oncol. 11:268-275. 3. Roilides, E., and P. A. Pizzo. 1992. Modulation of host defenses by cytokines: evolving adjunts in prevention and treatment of serious infections in immunocompromised hosts. Clin. Infect. Dis. 15:508524. 4. Spach, D. H., W. C. Liles, G. L. Campbell, R. E. Quick, D. E. Anderson, and T. E. Fritsche. 1993. Tick-borne diseases in the United States. N. Engl. J. Med. 329:936-947.
Juan A. L6pez-Andreu, M.D. Josep Ferris, M.D., Ph.D. Cipriano A. Canosa, M.D., Ph.D. Jesus V. Sala-Lizarraga, M.D. Departamento de Pedidtrica Hospital Infantil "La Fe" Avda de Campanar, 21 46009-Valencia, Spain
J. CLIN. MICROBIOL.
Author's Reply Lopez-Andreu et al. recount a case in which diagnosis was delayed with resultant deterioration and personal suffering. The failure to diagnose Lyme disease can have dire consequences. Repeated courses of oral and intravenous antibiotics may have prevented chronic borrelial disease, but the patient is still symptomatic. "Progressive" borrelial encephalomyelitis, as described in the European literature (1), may be progressive mainly because it is not adequately treated. A lack of appreciation of the refractory chronicity of entrenched Lyme disease results in an overreliance on treatment protocols developed before a clear understanding of the pathobiology of the infecting agent was possible. Now, with a clearer picture of pathogenesis, physicians may offer prolonged treatment. That this patient's illness developed despite prophylactic treatment with doxycycline is disturbing. It suggests that prophylaxis was not effective. Perhaps the regimen of prophylaxis was too brief or the dose of doxycycline was too low. Alternatively, CNS seeding and/or intracellular localization may have occurred even by the time the tick was removed and antibiotics were given. Prior unrecognized tick bites and latent infection also might account for the apparent failure of prophylaxis. The patient's history of muscle fasciculation and loss of muscle bulk suggest the involvement of motor units. A relationship between Lyme disease and motor neuron disease has been suggested (3). Four patients seen in my practice having well-documented Lyme disease evidenced motor neuron involvement. Whether there is a true causal relationship is unclear. Two of the patients died of motor neuron disease despite antibiotic treatment, while two appeared to improve. The mechanism by which CNS borrelial infection might damage motor neurons has not been definitely determined, but kynurenine pathway-mediated toxic effects on the NMDA receptor is a possible explanation (2). All of us are challenged to find more effective and less costly regimens to treat patients such as the one described by Lopez-Andreu and colleagues. REFERENCES 1. Ackermann, R., E. Gollmer, and B. Rehse-Kupper. 1985. Progressive Borrelian-Enzephalomyelitis. Dtsch. Med. Wochenschr. 110: 1039-1042. 2. Halperin, J. J., and M. P. Heyes. 1992. Neuroactive kynurenines in Lyme borreliosis. Neurology 42:43-50. 3. Halperin, J. J., G. P. Kaplan, S. Brazinsky, T. F. Tsai, T. Cheng, A. Ironside, P. Wu, J. Delfiner, M. Golightly, R. H. Brown, R. J. Dattwyler, and B. J. Luft. 1990. Immunologic reactivity against Borrelia burgdorferi in patients with motor neuron disease. Arch. Neurol. 47:586-594. Kenneth B. Liegner Lyme Borreliosis and Related Disorders Intemal and Critical Care Medicine Arrnonk New York 10504
