Detection of tumor cells in peripheral blood samples from ... - Nature

Bone Marrow Transplantation, (1998) 22, 771–775  1998 Stockton Press All rights reserved 0268–3369/98 $12.00 http://www.stockton-press.co.uk/bmt

Detection of tumor cells in peripheral blood samples from patients with germ cell tumors using immunocytochemical and reverse transcriptase-polymerase chain reaction techniques MO Hildebrandt1, F Bla¨ser1, J Beyer1, W Siegert1, MY Mapara2, D Huhn1 and A Salama1 1

Blood Bank, Department of Hematology and Oncology, Charite´ Campus Virchow-Klinikum, and 2Department of Hematology, Oncology and Tumor Immunology, Robert Ro¨ssle-Klinik at the Max Delbru¨ck Centrum for Molecular Medicine, Charite´ Campus Buch, Humboldt University, Berlin, Germany

Summary: The aim of this study was to establish sensitive techniques for the detection of residual germ cell tumor cells in peripheral blood and progenitor cell harvests. For this purpose, we used immunocytochemical staining for cytokeratin filaments and reverse transcriptasepolymerase chain reaction (RT-PCR) for epidermal growth factor receptor (EGF-R) and germ cell alkaline phosphatase (GCAP). Germ cell tumor lines Tera-1 and Tera-2 were titrated into normal peripheral blood. Immunocytochemical staining allowed detection of one cytokeratin-positive tumor cell in 105 cells. RT-PCR for EGF-R revealed one tumor cell in 10 cells for Tera-1 and one tumor cell in 103 cells for Tera-2, while RTPCR for GCAP displayed a sensitivity of one tumor cell in 106 cells for Tera-1, one tumor cell in 104 cells for Tera-2, and no positivity in normal mononuclear cells (n = 20) and progenitor cell harvests (n = 5). The analysis of peripheral blood and progenitor cell harvests from 20 patients with germ cell tumors revealed tumor cell contamination in three patients using immunocytochemical staining and in seven patients by RT-PCR for GCAP. We conclude that RT-PCR for GCAP appears to be suitable for the sensitive detection of residual germ cell tumor cells in peripheral blood and progenitor cell harvests. Keywords: germ cell tumors; peripheral blood; RT-PCR; alkaline phosphatase

cant portion of labelled cells within sites of relapse in patients with neuroblastoma, suggesting that reinfused tumor cells may, in fact, contribute to relapse.4 In patients with follicular lymphoma, the reduction in contaminating tumor cells by purging autologous transplants to PCRnegativity, ie disappearance of a t(14;18) translocation-specific amplification product, has been shown to be associated with a better treatment outcome than in t(14;18) translocation amplification product-positive autografts.5 These results emphasize the need for sensitive methods for tumor cell detection. Immunocytochemical staining and reverse transcriptase-polymerase chain reaction (RT-PCR) have been demonstrated to be sensitive and specific techniques for detecting micrometastases and residual disease.6,7 The former technique may allow exact cell determination as reported for tumors of epithelial origin,7,8 but is timeconsuming and may be less sensitive than RT-PCR. We used immunocytochemical staining to detect cytokeratin, since germ cell tumors have been described to express cytokeratin filaments.9 For RT-PCR, EGF receptor mRNA was used as a target sequence, because it allows a sensitive detection of epithelial tumor cells in peripheral blood and progenitor cell harvests.10 Furthermore, EGF receptor is expressed in most tissues with the exception of the hematopoietic system.11 Finally, we investigated the feasibility of a novel target sequence, germ cell alkaline phosphatase (GCAP), for RT-PCR analysis.

Patients and methods Current treatment modalities lead to durable remissions in the majority of patients with germ cell tumors.1 Certain subgroups of patients do not respond well to conventional treatment,2 but may significantly benefit from dose intensification with consecutive reinfusion of autologous hematopoietic progenitor cells.3 The role of residual tumor cells which may be present in the peripheral blood and in progenitor cell harvests of these patients is still speculative. Recent gene marking studies have demonstrated a signifiCorrespondence: Dr M Hildebrandt, Blood Bank, Charite´ Campus Virchow-Klinikum, Humboldt University of Berlin, Augustenburger Platz 1, D-13353 Berlin, Germany Received 4 April 1998; accepted 9 June 1998

Patients Patients with advanced testicular cancer (n = 7) and patients who relapsed after conventional treatment (n = 13) were enrolled for a high-dose chemotherapy regimen as described.12 The first group included patients with unequivocal non-seminomatous germ cell tumors and either primary mediastinal germ cell tumor manifestations or those fulfilling the ‘poor prognosis’ criteria according to the recent International Germ Cell Cancer Collaborative Group (IGCCCG) classification.13 The second group consisted of patients who relapsed after at least four cycles of a cisplatinum-based chemotherapy. All patients received a first cycle of chemotherapy consisting of either taxol (175 mg/m2 day 1) and ifosfamide (5 g/m2 day 1) or cis-

Germ cell tumor cells in peripheral blood MO Hildebrandt et al

772

platinum (20 mg/m2 days 1–5), etoposide (100 mg/m2 days 1–5) and ifosfamide (2.5 g/m2 days 1–5). Thereafter, patients received 5 ␮g G-CSF s.c. per kg of body weight daily, beginning from day 3 (TI) or day 7 (PEI). Peripheral blood progenitor cell aphereses were performed using an AS 104 (Fresenius AG, St Wendel, Germany) or a Cobe Spectra cell collector (Cobe Laboratories, Heimstetten, Germany). At time of apheresis, an aliquot of peripheral blood and of the apheresis product were processed for tumor cell detection. In one patient (patient No. 15), bone marrow was collected instead of peripheral blood progenitor cells. All patients enrolled in the study gave their written informed consent, and the study was approved by the local ethics committee. Cell lines Cell lines Tera-1 (germ cell tumor of seminomatous origin) and Tera-2 (germ cell tumor of non-seminomatous origin) were purchased from the American Type Culture Collection (Rockville, MD, USA). The cells were grown in McCoy’s 5A medium containing 10% fetal calf serum and 1 mmol glutamine without addition of antibiotics. The other cell lines were grown in RPMI 1640 (Jurkat, Raji and U266) or Dulbecco’s MEM (HepG2) containing 10% fetal calf serum. Fetal calf serum and media were purchased from Biochrom (Berlin, Germany). RNA preparation Peripheral blood mononuclear cells were separated on a Ficoll–Hypaque gradient (Pharmacia, Uppsala, Sweden), washed twice with PBS containing 1% FCS, counted and tested for viability by the use of trypan blue exclusion. The cells were lysed in TRIzol reagent (GIBCO BRL, Grand Island, NY, USA) and sheared to homogeneity, following a one-step guanidinium isothiocyanate/phenol RNA preparation technique.14 Chloroform was added, and the RNA contained in the aqueous upper phase was precipitated in isopropanol at −80°C, washed in 80% ethanol and resuspended in RNAse-free water. The integrity of RNA was examined by RT-PCR analysis for ␤2 microglobulin mRNA.15

liters of the final PCR products were separated on a 1% agarose gel (Oncor Appligene, Heidelberg, Germany). For reamplification (‘semi-nested’ RT-PCR), 5 ␮l of the PCR product were again subjected to 40 cycles of PCR using a nested sense primer. RNA preparation and PCR were carried out in separate locations to avoid any contamination. Oligonucleotides used in this study were chosen from published mRNA sequences. The sequences of the primers are listed in Table 1. Immunocytochemical staining Ten micrograms of a murine F(ab)2 fragment directed against cytokeratin (A45-B/B3, EpiMet Tumor Cell Detection Kit; Baxter Biotech, Unterschleißheim, Germany) were used for immunocytochemical staining. Cell suspensions were attached to slides by cytocentrifugation, air dried and stored at −20°C. The germ cell tumor cell line Tera-2 was used as a positive control for each immunostaining experiment. For anti-cytokeratin-F(ab)2 staining, a standard protocol as outlined in the kit was followed. In brief, the slides were allowed to dry after thawing and permeabilized in methanol with 4% formaldehyde. The anti-cytokeratin F(ab)2 fragment, being linked to alkaline phosphatase, allowed immediate staining with a chromogenic substrate. Tumor cells were considered immunocytochemically positive when staining of more than 70% of cytoplasm was observed. Routinely, an overall number of 106 MNC, with 5 × 105 cells per slide, were analyzed and tumor cells quantified.

Table 1

Sequences of primers (5′ to 3′)

␤2 microglobulin

CGAGCAGAGAATGGAAAGTC (sense)

(HSMGLO 73–341)

GATGCTGCTTACATGTCTCG (antisense)

EGF receptor

TCTCAGCAACATGTCGATGG (sense)

(HSEGFPRE 702–1175)

TCGCACTTCTTACACTTGCG (antisense)

germ cell alkaline

GCTCTGTCCAAGACATACAG (sense)

phosphatase (GCAP)

CACCTTGGCTGTAGTCATCT (antisense)

cDNA synthesis and PCR Ten micrograms of RNA were incubated with 50 ng of a 15(dT) primer at 60°C for 10 min. After addition of deoxynucleotide mix (10 mm), DTT (10 mm) and first-strand reaction buffer, 100 U MMLV reverse transcriptase (GIBCO BRL) were added to a final volume of 50 ␮l. The cDNA synthesis reaction was carried out at 37°C for 40 min. After heat inactivation at 95°C for 5 min and subsequent maintenance at 4°C, 5 ␮l of each reaction product were subjected to PCR analysis. The PCR reaction was carried out at 94°C (40 s), 60°C (for ␤2 microglobulin and EGF receptor primers) or 65°C (for germ cell alkaline phosphatase primers, 1 min) and 72°C (1 min) for 40 cycles, followed by a final 5 min at 72°C. All reagents employed for PCR analysis were purchased from InViTek (Berlin, Germany). Twenty micro-

(HSALKPHO 319–733) GCAP, reamplification (HSALKPHO 319–682)

GCTCTGTCCAAGACATACAG (sense) ACATGTACTTTCGGCCTCCA (antisense)

The nucleotide sequences of the primers used for RT-PCR analyses are listed. The sequences of the amplification products correspond to the nucleotide positions in the original sequences derived from the European Molecular Biology Laboratory (EMBL) database as listed below each primer pair name.


Results 1

Expression of EGF receptor and germ cell alkaline phosphatase mRNA in tumor cell lines RNA was isolated from different tumor cell lines and subjected to RT-PCR for EGF receptor and GCAP mRNA. Of the cell lines analyzed, bands for EGF receptor mRNA were detected for cell lines HepG2 (hepatocellular carcinoma), Tera-1 (germ cell tumor, seminomatous origin) and for Tera-2 (germ cell tumor, non-seminomatous origin). Primary amplification for GCAP mRNA yielded bands in samples derived from cell lines Tera-1 and Tera-2. RNA derived from HepG2 became positive after secondary amplification using ‘semi-nested’ primers. The other cell lines tested, Raji (Burkitt-like lymphoma), Jurkat (T cell acute leukemia) and U266 (multiple myeloma) remained negative for GCAP mRNA. Immunocytochemical staining of HepG2, Tera-1 and Tera-2 cells showed positivity for cytokeratin filaments, whereas the other cell lines tested were negative. Detection of germ cell tumor cells by immunocytochemical staining and RT-PCR Tera-1 and Tera-2 cells were titrated into normal peripheral blood mononuclear cells up to a dilution of 1 tumor cell per 106 nucleated cells. For each cell line, three dilution series were performed and subjected to immunocytochemical staining and RT-PCR analysis. Immunocytochemical staining for cytokeratin-positive cells allowed the detection of germ cell tumor cells up to a dilution of 1 tumor cell per 105 mononuclear cells. At a dilution of 10−5, 6 Tera-1 cells were detected per 10 tumor cells seeded, with a range of 1–13. For Tera 2, 2 tumor cells were detected per 10 tumor cells seeded in all three dilution series. No cytokeratin-positive cells were detected at a dilution of 10−6 tumor cells per nucleated cell. By RT-PCR for EGF-R mRNA, a maximum sensitivity of one tumor cell in 10 nucleated cells was obtained for Tera-1. For Tera-2, bands positive for EGF receptor mRNA were detectable up to 1 tumor cell in 103 mononuclear cells. RT-PCR analyses for GCAP mRNA in Tera-1 dilutions reached a sensitivity of at least one tumor cell in 106 mononuclear cells. Reamplification of the PCR product using semi-nested primers helped only to enhance the intensity of the bands detected after the first amplification. For Tera2 dilutions, the maximum sensitivity achieved was one tumor cell in 104 PBMC. Reamplification did not result in a higher sensitivity but, again, rather in enhancement of the previously detected bands. The controls, peripheral blood mononuclear cells and peripheral blood progenitor cell harvests from healthy volunteers donors, were negative in all cases by immunocytochemical staining, and by RT-PCR for GCAP mRNA, even after secondary amplification (Figure 1). Tumor cells in peripheral blood and progenitor cell harvests from patients with germ cell tumors Samples from 20 patients were processed and analyzed by immunocytochemical staining for cytokeratin and RT-PCR

773

G-CSF stim. w/o G-CSF stim. 2

3

4

5

6

7

8

T2 NC

GCAP

GCAP nested

β2 microglobulin

Figure 1 Results of RT-PCR analyses for expression of germ cell alkaline phosphatase in G-CSF-mobilized progenitor cell harvests (samples 1– 4) and in non-mobilized mononuclear cells of the peripheral blood (samples 5–8) are presented. An overall number of 25 samples were tested. RNA derived from cell line Tera-1 was used as positive control. As a negative control (‘NC’), an additional RT-PCR reaction was performed without addition of RNA.

for germ cell alkaline phosphatase mRNA. The results are listed in Table 2. Immunocytochemical staining revealed positive cells in samples of three patients. Two of these had positive cells in peripheral blood and progenitor cell harvests, and the third had positive cells in the progenitor cell harvest alone. However, the number of cells detected never exceeded 1 in 105. Table 2 Analysis of tumor cell contamination in peripheral blood and progenitor cell harvests Patient No.

Immunocytochemical staining (cytokeratin) periph. blood

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15a 16 17 18 19 20

− − − − −

harvest − − − − −

+ − − − −

+

− − − −

+ − − − −

harvest −

+

+

+ − − − −

periph. blood −

− − − −

− − − − −

RT-PCR (germ cell alkaline phosphatase)

− − − − − − − −

− −

+ + −

− − − − − − − −

+ − − − −

+ +

−

+ + +

− − − −

The results of the analyses for contaminating tumor cells in peripheral blood (‘periph. blood’) and progenitor cell harvests (‘harvest’) by the use of immunocytochemical staining for cytokeratin and RT-PCR for germ cell alkaline phosphatase are presented. a In patient No. 15, bone marrow was tested instead of peripheral blood progenitor cell harvest.


774

RT-PCR analysis revealed positivity for GCAP mRNA in seven patient samples. Bands were detected in the progenitor cell harvests of five patients (secondary amplification, ie semi-nested PCR), only in the peripheral blood of one other patient (Figure 2), and in peripheral blood as well as progenitor cell harvest of a seventh patient. In this latter patient, the peripheral blood sample became positive only after secondary amplification, whereas the progenitor cell harvest was already positive after the primary amplification. Discussion The presence of residual tumor cells in peripheral blood and progenitor cell harvests has not yet been addressed in patients with germ cell tumors. In this study, we were able to detect such malignant cells by the use of immunocytochemical staining and RT-PCR. The sensitivity of both techniques was evaluated using serial dilutions of germ cell tumor cells in normal mononuclear cells of peripheral blood. The results showed a high sensitivity of the immunocytochemical approach in both cell lines (1 tumor cell in 105 mononuclear cells). In our analyses, EGF receptor RT-PCR revealed a sensitivity of one tumor cell in 103 mononuclear cells for Tera-2 and only 1 tumor cell in 10 mononuclear cells in Tera-1. Since reamplification of the PCR product using nested primers led to false-positive reactions, the sensitivity of this assay could not be further enhanced. In contrast, the detection of tumor cells by amplification of germ cell alkaline phosphatase mRNA was highly sensitive and allowed the detection of one Tera-1 tumor cell in at least 106 mononuclear cells. For Tera-2, the sensitivity of RT-PCR appears to be slightly lower than that of immunocytochemical staining. To date, RT-PCR represents the only technique that can unambiguously distinguish between germ cell alkaline phosphatase and placental alkaline phosphatase. The two Patient No.

20

A B

19

2

11

A B

A B

A B

T1 NC

GCAP

GCAP nested

β 2 microglobulin Figure 2 Results of RT-PCR analyses for expression of germ cell alkaline phosphatase mRNA in peripheral blood and progenitor cell harvests from four patients with germ cell tumors are presented. RT-PCR for ␤2 microglobulin mRNA was used to verify the integrity of the RNA. The patients’ numbers correspond to the patients’ numbers in Table 2. The samples of peripheral blood are presented under the letter ‘A’, the samples drawn from progenitor cell harvests under the letter ‘B’. As a negative control (‘NC’), an additional RT-PCR reaction was performed without addition of RNA.

isoenzymes have been demonstrated to differ only by 7 to 11 amino acid residues.16 Unfortunately, there was no immunological reagent specific for germ cell alkaline phosphatase available. Therefore, we could neither investigate the correlation between germ cell alkaline phosphatase mRNA and protein expression, nor perform immunocytochemical staining for germ cell alkaline phosphatase for detection of germ cell tumor cells. Consistent with previous reports,17 all malignant cell lines of hematopoietic origin tested in our study were negative for EGF receptor mRNA. Both germ cell tumor cell lines used in our study, Tera-1 and -2, and HepG2, a hepatocellular carcinoma cell line, were found to be positive for EGF receptor mRNA. Germ cell alkaline phosphatase has been described as a marker of carcinoma in situ of the testis, assigning a high sensitivity to this protein for the detection of tumor cells.18 For this reason, we investigated the feasibility of germ cell alkaline phosphatase to serve as a marker for tumor cell detection. RT-PCR analysis showed significant expression of germ cell alkaline phosphatase mRNA in Tera-1 and -2 and weak expression in RNA derived from HepG2. Previous studies have demonstrated weak expression of germ cell alkaline phosphatase in testis, thymus, lung, cervix19 and in several non-germ cell tumors as well.20–22 Twenty samples of normal peripheral blood and five samples of progenitor cell harvests tested negative for GCAP mRNA (Figure 1). Since the samples of peripheral blood were collected by venepuncture, a contamination by epithelial or other non-hematopoietic cells has to be taken into account. However, immunocytochemical staining of all control samples for cytokeratin-positive cells showed no positivity. Additionally, in previous studies 40 samples of normal peripheral blood collected by venepuncture were negative for EGFR mRNA. Based on our results, mononuclear cells of the peripheral blood do not appear to express germ cell alkaline phosphatase. Thus, RT-PCR assays for GCAP mRNA appear to be a useful tool for the detection of germ cell tumor cells in peripheral blood. The prospective analysis of samples drawn at day of apheresis revealed that circulating tumor cells can be detected in both the peripheral blood and progenitor cell harvests of patients with advanced germ cell tumors. Immunocytochemical staining demonstrated tumor cell contamination in three out of 20 patients, two of whom had tumor cells in peripheral blood and progenitor cell harvests, and one of whom had tumor cells in the progenitor cell harvesting product only. Based on an estimated detection efficiency of 20% as derived from the dilution experiments, an overall tumor cell contamination of 1 in 105 mononuclear cells can be assumed. This amount of contaminating cells is similar to that of tumor cells in peripheral blood and progenitor cell harvests of breast cancer patients.7 GCAP RT-PCR was positive in seven of 20 patients. In one patient, tumor cell contamination was revealed by immunocytochemical staining but not by RT-PCR. An explanation for this finding might be a lower expression of germ cell alkaline phosphatase in the tumor cells detected, which, in this patient, would result in a reduced sensitivity of the RT-PCR assay. This assumption is further substantiated by the comparative analysis of the serial dilutions, in


which the sensitivity of the immunocytochemical approach was inferior to RT-PCR in Tera-1, but superior in Tera-2 dilutions. Our observation is in accordance with the data reported by Scha¨r et al23 who showed that the differential expression of alkaline phosphatase isoenzymes in germ cell tumors depends on the respective degree of tumor differentiation. However, this finding does not appear to limit the feasibility of the assay for sensitive detection of germ cell tumor cells in peripheral blood. The number of clinical samples analyzed in our study does not allow us to draw conclusions regarding a possible correlation between the presence of circulating tumor cells and other prognostic factors. Further studies are needed to evaluate more precisely the extent of tumor cell contamination in peripheral blood and progenitor cell harvests of patients with germ cell tumor, and to elucidate the impact of these findings on the patients’ outcome and survival.

Acknowledgements This work was supported by a grant from the Wilhelm SanderStiftung, Germany.

10

11 12

13 14 15

16 17

References 1 Bosl GJ, Motzer RJ. Medical progress: testicular germ-cell cancer. New Engl J Med 1997; 337: 242–253. 2 Bajorin D, Katz A, Chan E et al. Comparison of criteria for assigning germ cell tumor patients to ‘good risk’ and ‘poor risk’ studies. J Clin Oncol 1988; 6: 786–792. 3 Beyer J, Bokemeyer C, Schmoll HJ, Siegert W. Treatment intensification in disseminated germ-cell tumors. World J Urol 1994; 12: 207–213. 4 Brenner MK, Rill DR, Moen RC et al. Gene-marking to trace origin of relapse after autologous bone marrow transplantation. Lancet 1993; 341: 1134–1137. 5 Gribben JG, Arnold MD, Freedman MD et al. Immunologic purging of marrow assessed before autologous bone marrow transplantation for B cell lymphoma, New Engl J Med 1991; 325: 1525–1533. 6 Lin F, Cross NCP. Molecular methods for monitoring malignant disease after bone marrow transplantation. Curr Opin Oncol 1995; 2: 460–467. 7 Ross AA, Cooper BW, Lazarus HM et al. Detection and viability of tumor cells in peripheral blood stem cell collections from breast cancer patients using immunocytochemical and clonogenic assay techniques. Blood 1993; 82: 2605–2610. 8 Shpall EJ, Jones RB. Release of tumor cells from bone marrow. Blood 1994; 83: 623–625. 9 Miettinen M, Virtanen I, Talerman A. Intermediate filament

18

19

20 21

22

23

proteins in human testis and testicular germ-cell tumors. Am J Pathol 1985; 120: 402–410. Mapara MY, Ko¨rner IJ, Hildebrandt M et al. Monitoring of tumor cell purging after highly efficient immunomagnetic selection of CD34 cells from leukapheresis products in breast cancer patients: comparison of immunocytochemical tumor cell staining and reverse transcriptase-polymerase chain reaction. Blood 1997; 89: 337–344. Carpenter G. Receptors for epidermal growth factor and other polypeptide mitogens. Ann Rev Biochem 1987; 56: 881–914. Siegert W, Beyer J, Strohscheer I et al. High-dose treatment with carboplatin, etoposide, and ifosfamide followed by autologous stem-cell transplantation in relapsed or refractory germ cell cancer: a phase I/II study. The German Testicular Cancer Cooperative Study Group. J Clin Oncol 1994; 12: 1223–1231. Mead GM. International germ cell consensus classification: a prognostic factor-based staging system for metastatic germ cell cancers. J Clin Oncol 1997; 15: 594–603. Chomczynski P, Sacchi N. Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987; 162: 156–159. Bouaboula M, Legoux P, Pesse´gue´ B et al. Standardization of mRNA titration using a polymerase chain reaction method involving co-amplification with a multispecific internal control. J Biol Chem 1992; 267: 21830–21838. Millan JL, Manes T. Seminoma-derived Nagao isozyme is encoded by a germ-cell alkaline phosphatase gene. Proc Natl Acad Sci USA 1988; 85: 3024–3028. Hildebrandt M, Mapara MY, Ko¨rner IJ et al. Reverse transcriptase-polymerase chain reaction (RT-PCR)-controlled immunomagnetic purging of breast cancer cells using the magnetic cell separation (MACS) system: a sensitive method for monitoring purging efficiency. Exp Hematol 1997; 25: 57–65. Giwercman A, Cantell L, Marks A. Placental-like alkaline phosphatase as a marker of carcinoma-in-situ of the testis. Comparison with monoclonal antibodies M2A and 43–9F. Acta Pathol Microbiol Immunol Scand 1991; 99: 586–594. Goldstein DJ, Rogers C, Harris H. A search for trace expression of placental-like alkaline phosphatase in nonmalignant human tissues: demonstration of its occurrence in lung, cervix, testis and thymus. Clin Chim Acta 1982; 125: 63–75. Harmenberg U, Koha M, Makiya R et al. Identification and characterization of alkaline phosphatase isozymes in human colorectal adenocarcinomas. Tumour Biol 1991; 12: 237–248. Iles RK, Ind TE, Chard T. Production of placental alkaline phosphatase (PLAP) and PLAP-like material by epithelial germ cell and non-germ cell tumours in vitro. Br J Cancer 1994; 69: 274–278. al-Mudamgha ZA, Rassam MB, al-Salihi AR, al-Sammeraie FT. Alkaline phosphatase of cancerous larynx tissue in comparison with the placental enzyme. Biochemical and histochemical studies. Acta Oncol 1997; 36: 213–218. Scha¨r BK, Otto VI, Hanseler E. Simultaneous detection of all four alkaline phosphatase isoenzymes in human germ cell tumors using reverse transcrition-PCR. Cancer Res 1997; 57: 3841–3846.

775