developed for strict and opportunistic pathogenic bacteria (Salmonella, ... The detection of pathogenic bacteria with culture techniques in water samples relies ...
OECD Workshop Molecular Methods for Safe Drinking Water
Interlaken ‘98
DETECTION OF VIABLE PATHOGENIC BACTERIA FROM WATER SAMPLES BY PCR Karine Delabre (1), Paulina Cervantes (1), Véronique Lahoussine (2), and MarieRenée de Roubin (1) (1)
ANJOU RECHERCHE, Laboratoire Central Générale des Eaux, Immeuble Le Dufy, 1 place de Turenne, 94417 Saint-Maurice Cédex, France. (2)
Agence de l’Eau Seine-Normandie, 51 rue S. Allende, 92027 Nanterre Cédex, France
Abstract The Polymerase chain reaction (PCR) is a molecular technique which can be used for identify specific bacterial strains within a mixed population. A detection method has been developed for strict and opportunistic pathogenic bacteria (Salmonella, enterohemorragic Escherichia coli and Aeromonas hydrophila) in raw and treated water. This method is composed of a bacterial DNA purification step followed by PCR detection. Compared to the traditional culture techniques, this method has an enhanced specificity and sensitivity. Furthermore, the simple and rapid protocol of the proposed technique provides results at a fraction of the time required by the traditional culture techniques (24 hours compared with 2 to 6 days). However, unlike the culture methods, detection by PCR does not provide information related to the viability of the bacteria since the detected bacteria can be viable and cultivable, viable but non-cultivable, or dead. The viability concept is very important for interpreting the detection of pathogenic bacteria in relation to public health issues. To overcome this limitation, an indirect approach has been developed for assessing the viability of PCR detected bacteria from water samples. This method is based on the analysis of each sample before and after a 20hour culture step in a non selective medium: an increase in the PCR response after cultivation indicates the occurrence of bacterial multiplication and thus demonstrates the viability of the detected bacteria. This new protocol allows the simultaneous detection of several viable cultivable pathogenic bacteria by PCR from water samples.
Introduction The detection of pathogenic bacteria with culture techniques in water samples relies on: (i) a pre-enrichment step in a non selective medium, and/or (ii) a culture step on a selective medium and/or (iii) an isolation step on a specific agar medium followed by biochemical/serological test on grown colonies (ISO 6340, 1995). Results of this method are obtained only several days after receiving the water sample. Furthermore, the culture media are chosen based on a compromise between the selectivity necessary to avoid the inhibition of the targeted bacteria from interfering flora and the possibility of promoting the growth of stressed bacteria such as those found in water samples. Finally, the use of biochemical identification might result in specificity problems. Given the numerous drawbacks of the traditional culture techniques, molecular biology methods appear as an interesting alternative for detecting pathogenic bacteria in water samples. Unlike the traditional techniques, these methods are based on the detection of a fraction of the genetic material of the targeted bacteria. By using those techniques, one overcomes the selectivity and sensitivity problems associated with the culture techniques.
K.Deadre, P.Cervantes, V.Lahousinne and M.Roubin
1
OECD Workshop Molecular Methods for Safe Drinking Water
Interlaken ‘98
The Polymerase Chain Reaction (PCR) is one of those molecular techniques (Mullis and Faloona, 1987). It relies on the in vitro amplification of a DNA fragment. It is simple and rapid, and thus a result is obtained within a short period of time after receiving the sample. However, whereas this technique is easy to carry out with a single bacterial colony, inhibitors may hamper the PCR reaction when the bacteria are included in a complex matrix such as a water concentrate. Such inhibition phenomena have often been described for different types of matrixes, including water concentrates (Kreader, 1996; for a review see: Bej, 996; Wilson, 1997). Bacterial DNA purification consequently becomes an indispensable preliminary step for any PCR reaction. Numerous techniques have been described in order to achieve this goal, resulting in various purification levels of the DNA (Bej, 1996). It is thus possible, after DNA purification, to detect bacterial species in a rapid, as well as highly specific and sensitive manner. A positive result will prove the presence of the targeted DNA fragment in the analyzed water sample. However, using such a technique, it will not be possible to assess the viability of the detected bacteria (Josephson et al., 1993). Yet this viability concept is fundamental for interpreting the result in terms of public health when dealing with water samples. The PCR technique must consequently be associated with a viability test. A protocol consisting of a pre-enrichment step followed by a DNA purification step and PCR has been developed in our laboratory for the detection of a number of strict or opportunistic pathogenic bacteria: Salmonella, Enterohemorragic Escherichia coli (EHEC) and Aeromonas hydrophila. The goal of the present work was prove the feasibility of this protocol by applying it to spiked or unspiked natural water samples. Moreover, a viability assessment method of the detected bacteria has been developed and studied.
Materials and methods Bacterial strains and culture media: Aeromonas hydrophila 76.14, Escherichia coli 53126, Escherichia coli 103571 (EHEC), and Salmonella typhimurium WG45 were obtained from the Institut Pasteur (Paris - France). These strains are cultivated on Plate Count Agar (Diagnostics Pasteur - France) or in peptone broth (Sanofi Pasteur - France) at 37°C. Water sample treatments: Water samples are taken in sterile containers. The water volume analyzed depends on the water type studied: 2 liters for river water and 5 liters for water samples taken along the water treatment plants. The samples are concentrated by filtration through 0.45 µm pore size nitrocellulose filters (Sartorius - France). The filters are then vortexed in peptone broth (Sanofi-Pasteur - France) for recovering the bacteria. After removing the filters, the bacteria are either centrifuged at 4500 g for 20 min (without pre-enrichment) or cultivated at 37°C for 20 hours and are then centrifuged (with pre-enrichment). DNA purification: The pellets are resuspended in 700 µl supernatant. The bacterial suspension is vortexed in presence of 200 µl Chelex-100 (20%), (Biorad) and 9 µl proteinase K (10 mg/ml), (Boehringer). This mixture is incubated at 56°C for 30 min, and then at 95°C for 10 min. Samples are then centrifuged at 6000 g for 5 min. The supernatant is used for PCR amplification. As a negative control of this purification stage, one Escherichia coli colony resuspended in 700 µl of apyrogenic water is treated in same way as the water samples. Controls used in all the PCR: a reaction mixture containing 20 µl of apyrogenic water is included as a negative control and a reaction mixture containing 20 µl of waterborne purified DNA seeded with DNA of the targeted bacteria is included as a positive control. Detection of Salmonella by nested-PCR: during this nested-PCR, two genes are targeted: H1i gene (Joys, 1985) and hin gene (Zieg and Simon, 1983). The first round (PCR1) is
K.Deadre, P.Cervantes, V.Lahousinne and M.Roubin
2
OECD Workshop Molecular Methods for Safe Drinking Water
Interlaken ‘98
performed in a total volume of 100 µl: 80 µl of reaction mixture and 20 µl of bacterial DNA. The reaction mixture contains the buffer II (Perkin-Elmer), 2mM MgCl2 (Perkin-Elmer), 200 µM of each dNTP (Perkin-Elmer), 2.5 U of Taq polymerase (Perkin-Elmer), 800 ng/µl of BSA (Boehringer) and 100 ng of each primer (Genset - France): r L(a) 5'CTGAACGAAATCGACCGTGTA3' r L(b) 5'GGATGTACCGTTATCTGCAGT3' r I(a) 5'CGGGTGTCAACAATTGACCAA3' r I(b) 5'AATAGCTAATTGCTGCCGAGG3'.
L(a) and L(b) primers allow amplification of a 699 bp fragment, and I(a) and I(b) a 484 bp fragment. The reaction conditions were 94°C for 4 min, and then 20 cycles of 94°C for 40 sec, 62°C for 40 sec, 72°C for 50 sec, with a final extension period of 7 min at 72°C. The second round (PCR2) is performed in a total volume of 100 µl : 97 µl of reaction mixture and 3 µl of PCR1 product. The composition of the reaction mixture and the reaction conditions were as previously described (Way et al., 1993), except that BSA (800 ng/µl) is added in the reaction mixture. Enterohemorragic Escherichia coli (EHEC) detection by PCR : the amplification is performed in 100 µl volumes : 80 µl of reaction mixture and 20 µl of bacterial DNA. The primer pairs used allow amplification of specific fragments from the genes encoding for shiga-like toxins I and II. The expected size of these fragments is respectively 348 bp and 584 bp. The reaction mixture and PCR conditions are as previously described (Cebula et al., 1995), except that 800 ng/µl of BSA was added and AmpliTaq Gold polymerase (Perkin-Elmer) was used. Aeromonas hydrophila detection by PCR: the amplification is performed in 100 µl volumes : 80 µl of reaction mixture and 20 µl of bacterial DNA. The specific fragment amplified (685 bp) is localized in the genes encoding for 16S rRNA. The reaction mixture and PCR conditions are as previously described (Dorsch & Stackebrandt, 1992; Dorsch et al., 1994), except for the addition of 800 ng/µl of BSA (Boehringer). Visualization of PCR products: electrophoresis is performed on 15 µl of the suspensions containing amplified fragments on a 3% (wt/vol.) agarose gel (Prolabo - France), stained with ethidium bromide at 0.5 mg/ml (Sigma) and viewed under UV light.
Results and discussion PCR detection of Salmonella, EHEC and Aeromonas hydrophila in water samples A protocol based on PCR has been developed in our laboratory for the detection of Salmonella, Enterohemorragic Escherichia coli (EHEC) and Aeromonas hydrophila. In order to develop this protocol, research has initially focused on DNA purification techniques. This work has been carried out on river water samples, which contain high amounts of inhibitory substances. The PCR steps have then been studied using pure bacterial strains. The final protocol is composed of: ( i) membrane filtration of the sample to be analyzed, (ii) a 20-hour preenrichment step in a non-selective medium, (iii) partial DNA purification using an ion-exchange resin and (iv) the PCR amplification step specific for Salmonella (Way et al., 1993; Delabre et al., 1997), EHEC (Cebula et al., 1995) and Aeromonas hydrophila (Dorsch and Stackebrandt, 1992; Dorsch et al., 1994). This last step is carried out in the presence of Bovine Serum Albumin (BSA). The main steps of the protocol are summarized in Figure 1. K.Deadre, P.Cervantes, V.Lahousinne and M.Roubin
3
OECD Workshop Molecular Methods for Safe Drinking Water
Interlaken ‘98
WATER SAMPLE FILTRATION
CULTURE IN A NON SELECTIVE MEDIUM ò to increase the number of pathogenic bacteria targeted.
PURIFICATION OF DNA ò several purification techniques have been tested to remove interfering compounds: the best result has been obtained with the use of a chelating ion exchange resin.
PCR DETECTION ò use of specific primers described in the literature, except for the first round of Salmonella nested-PCR. Salmonella PCR GENE TARGETED
1) gene encoding for a flagellin 2) gene encoding for a regulatory protein
Aeromonas hydrophila PCR gene encoding for the 16S rRNA
Enterohemorragic Escherichia coli PCR 1) gene encoding for the shiga like toxin I 2) gene encoding for the shiga like toxin II
Figure 1: Main steps of the protocol for the detection of pathogenic bacteria by PCR In order to assess the feasibility of the overall protocol and to evaluate its validity for different types of water, samples of river water, water after sand filtration or ozonation have been analyzed after spiking with a known quantity of the targeted bacteria (c.a. 108). Water samples without spiking were analyzed as controls. The data presented in Table 1 show that positive results were obtained with spiked samples for all types of water. This result proves that the protocol developed allows the detection of the targeted bacteria in different types of water matrixes. However, in some cases, this detection was observed only after diluting the DNA before performing the PCR step. This observation suggests the persistence of inhibition phenomena and proves the necessity of developing internal controls in order to interpret the negative results. These results prove the possibility of assessing within 24 hours the presence of three types of bacteria from the same water sample. The protocol can be applied to different types of water samples, including those, such as river water samples that are likely to contain high amounts of inhibitory substances. Those types of water have been selected for assessing the protocol because (i) some of them were likely to contain the targeted bacteria and (ii) the amount of substances inhibiting the PCR reaction was high and allowed evaluating the robustness of the protocol. The protocol was then applied to unspiked water samples: river water, and partially treated water at different steps of a treatment plant. The results presented in Table 2 show that the three targeted bacteria were detected in river water. However, as mentioned above, in almost all cases the bacteria were clearly detected only in the diluted DNA concentrate. Salmonella and EHEC were usually not found in water after ozonation or Granulated Activated Carbon (GAC) filtration. On the contrary, Aeromonas hydrophila was found in ozonated and GAC filtered K.Deadre, P.Cervantes, V.Lahousinne and M.Roubin
4
OECD Workshop Molecular Methods for Safe Drinking Water
Interlaken ‘98
water; in the latter case it was found in both diluted and undiluted DNA concentrates. Compared to the impossibility of detecting Aeromonas hydrophila in undiluted DNA concentrates from river water, this observation is probably related to the elimination of interfering substances for PCR removed during the water treatment process (mainly organics). Table 1: Application of the PCR detection to spiked water samples (spiking: c.a. 108 CU) PCR results EHEC
Salmonella
Aeromonas Hydrophila
Dilution of DNA sample Test 1
Test 2
Test 3
Raw water Sand filtered water Ozonated water Raw water Sand filtered water Ozonated water Raw water Sans filtered water Ozonated water
Pure + + + + + + +* + + + + + + + +
unspiked spiked unspiked spiked unspiked spiked unspiked spiked unspiked spiked unspiked spiked unspiked spiked unspiked spiked unspiked spiked
+ : positive result
1/10 + + + + + + +* + + + + + +
Pure + + + + + + + +
+*: weak positive result
1/10 + + + + + + +* + + + +
Pure + + + + + +
1/10 + + + + + + + + + + + + + + + + +
-: negative result
Table 2 : PCR positive samples for Salmonella, EHEC and Aeromonas hydrophila in surface and partially treated water (no control for viability).
Total number of tested samples
Number of Positive PCR results Aeromonas Salmonella EHEC hydrophila Dilution of DNA sample Pure
1/10
Pure
1/10
Pure
1/10
Raw water
21
0
21
3
13
0
10
After clarificationA
23
6
23
9
7
0
10
Ozonated water
7
1
6
1
0
0
0
GAC filtered water
7
6
7
1
1
0
0
A
Samples taken after sedimentation (following coagulation, flocculation) or rapid sand filtration
K.Deadre, P.Cervantes, V.Lahousinne and M.Roubin
5
OECD Workshop Molecular Methods for Safe Drinking Water
Interlaken ‘98
Development of a method for assessing the viability of the PCR detected bacteria Whereas conflicting results concerning the possibility of detecting only viable bacteria by PCR can be found (Bej et al., 1991; Josephson et al., 1993), the data available to-date conclusively show that bacterial DNA has been sufficiently altered, PCR detection becomes impossible. There is however no clear evidence of the impossibility of detecting dead bacteria by PCR in some cases; this is likely to depend on the condition of their DNA. The fact that Aeromonas hydrophila, which is usually present in water at high concentration, was found in all the samples studied, including disinfected water samples (Table 2), brings serious doubts as to the viability of the PCR detected material. Since an insufficient performance of the ozonation process was not recorded, it is therefore likely that PCR detects DNA from inactivated bacteria.
Table 3: Viability assay for PCR detected bacteria. 2 liters
200 ml
20 ml
2 ml
(1)
(2)
(1)
(2)
(1)
(2)
(1)
(2)
1
-
+
n.t.
n.t.
n.t.
n.t.
n.t.
n.t.
2
+
+
n.t.
n.t.
n.t.
n.t.
n.t.
n.t.
3
-
-
-
-
-
-
-
-
4
-
-
-
-
-
+*
-
-
5
-
+
-
+
-
+
+
+
1
+
+
n.t.
n.t.
n.t.
n.t.
n.t.
n.t.
Aeromonas
2
+
+
n.t.
n.t.
n.t.
n.t.
n.t.
n.t.
hydrophila
3
+
+
+
+
+
+
+
+
4
+
+
+
+
+
+
+
+
5
+
+
+
+
+
+
+
+
1
-
+
n.t.
n.t.
n.t.
n.t.
n.t.
n.t.
2
-
+
n.t.
n.t.
n.t.
n.t.
n.t.
n.t.
3
-
-
-
-
-
+
-
+
4
-
-
-
+
-
+
-
+
5
-
-
-
-
-
+
-
+
Salmonella
EHEC
(1) = without preenrichment (2) = with preenrichment +: positive result +*: weak positive result -: negative result
n.t.: not tested
Since the risk in terms of public health can be assessed only if viability data are available, it is necessary to complete the PCR technique with a method demonstrating the viability of the PCR detected bacteria. An indirect approach allowing meeting this requirement has been developed. This method is based on the analysis of each sample before and after a 20-hour culture step in a nonselective medium: an increase in the PCR response after cultivation indicates the occurrence of bacterial multiplication and thus demonstrates the viability of the detected bacteria. By analyzing several volumes of the same water sample before and after preenrichment, a negative results before pre-enrichment and a positive result after pre-enrichment can be obtained for one at least of the tested volumes if cultivable bacteria are present in the water sample. The results of such an experiment performed with river water samples are shown in Table 3. In some cases when the initial concentration of the targeted bacteria was above the K.Deadre, P.Cervantes, V.Lahousinne and M.Roubin
6
OECD Workshop Molecular Methods for Safe Drinking Water
Interlaken ‘98
detection threshold of the method, a positive result was obtained before pre-enrichment whatever the volume tested. An increase in the PCR signal could nevertheless be observed after the preenrichment step, thus proving the occurrence of bacterial multiplication. It must be pointed out that in one case (Salmonella, experiment 5), a positive result before pre-enrichment was found when 2 ml of water were analyzed whereas the result was negative for larger volumes. This fact again stresses the necessity of developing control tests in order to interpret the negative results. The limitation of this approach was the need for analyzing different volumes of water, especially when the order of magnitude of the bacterial concentration to be found was not known. In order to overcome this limitation, different dilutions of the DNA obtained before and after pre-enrichment were analyzed. When the detected bacteria were viable, an increase in the PCR signal occurred after pre-enrichment (data not shown).
Conclusion This work proves the feasibility of detecting three pathogenic bacteria from the same water sample by PCR within 24 hours. The method is specific and easy to apply. It allows the detection of culturable bacteria: this concept is crucial since PCR detection does not give indications on the viability of the detected material. Inhibiting substances sometimes hamper PCR detection; however, inhibition phenomena proved to be less stringent for partially treated water samples compared to natural water samples. It is therefore likely that few difficulties will be encountered when applying this protocol to drinking water samples. Further work is underway in order to develop control tests which are necessary for the interpretation of negative results.
Acknowledgements The authors gratefully acknowledge the financial support from Agence de l’Eau SeineNormandie and the help of Dr. J.C. Joret for the preparation of the manuscript.
References Bej. A.K., Mahbubani M.H., and Atlas R.M., Detection of viable Legionella pneumophila in water by polymerase chain reaction and gene probe methods, Appl. Environ. Microbiol., 1991, 57, 597-600. Bej A.K., PCR amplification of DNA recovered from the aquatic environment, 1996, In : Nucleic Acids in the Environment, (Springer Lab Manual, J.T. Trevors, J.D. van Elsas (Eds)), p.179-218. Cebula T.A., Payne W.L., and Feng P., Simultaneous identification of strains of Escherichia coli serotype O157:H7 and their shiga-like toxin type by mismatch amplification mutation assay-multiplex PCR, J. Clin. Microbiol., 1995, 33, 248-250. Delabre K., Mennecart V., Joret J.C., and Cervantes P., Simultaneous detection of pathogenic bacteria in water using nested-PCR, 1997, Proceedings of the Water Quality Technology Conference, Denver, USA. Dorsch M., & Stackebrandt E., Some modifications in the procedure of direct sequencing of PCR amplified 16S rDNA, J. Microbiol. Meth, 1992, 16, 271-279. Dorsch M., Ashbolt N.J., Cox P.T., and Goodman A.E., Rapid identification of Aeromonas species using 16S rDNA targeted oligonucleotide primers: a molecular approach based on screening of environmental isolates, J. Appl. Bacteriol, 1994, 77, 722-726. ISO 6340, Qualité de l’eau, Recherche de Salmonella (Réf : ISO 6340 / 1995 (F)), 1995.
K.Deadre, P.Cervantes, V.Lahousinne and M.Roubin
7
OECD Workshop Molecular Methods for Safe Drinking Water
Interlaken ‘98
Josephson K.L., Gerba C.P., and Pepper I.L., Polymerase chain reaction detection of nonviable bacterial pathogen, Appl. Environ. Microbiol., 1993, 59, 3513-3515. Joys T.M., The covalent structure of the phase-1 flagellar filament protein of Salmonella typhimurium and its comparison with other flagellins, J. Biol. Chem., 1985, 260, 1575815761. Kreader C.A., Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein, Appl. Environ. Microbiol, 1996, 62, 1102-1106. Mullis K.B., and Faloona F.A., Specific synthesis of DNA in vitro via a polymerase-catalysed chain reaction, Methods in Enzymol. 1987, 155, 335-350. Way J.S., Josephson K.L., Pillai S.D., Abbaszadegan M., Gerba C.P., and Pepper I.L., Specific detection of Salmonella spp. by multiplex polymerase chain reaction, Appl. Environ. Microbiol., 1993, 59, 1473-1479. Wilson I.G., Inhibition and facilitation of nucleic acid amplification, 1997, Appl. Environ. Microbiol., 63, 3741-3751. Zieg J. and Simon M., Analysis of the nucleotide sequence of an invertible controlling sequence, Proc. Natl. Acad. Sci. USA, 1983, 77, 4196-4200.
K.Deadre, P.Cervantes, V.Lahousinne and M.Roubin
8
