Journal of Medical Virology 79:1089–1094 (2007)
Determining the Source of Nosocomial Transmission in Hemodialysis Units in Tunisia by Sequencing NS5B and E2 Sequences of HCV Fatma Hmaı¨ed,1* Myriam Ben Mamou,1 Martine Dubois,2 Christophe Pasquier,2 Karine Sandres-Saune,2 Lionel Rostaing,3 Amine Slim,1 Zakia Arrouji,1 Saı¨da Ben Redjeb,1 and Jacques Izopet2 1
Laboratoire de Microbiologie, Hoˆpital Charles Nicolle, Tunis, Tunisia Laboratoire de Virologie, IFB Purpan, CHU de Toulouse, France 3 Service de Ne´phrologie-Transplantation, Hoˆpital Rangueil, CHU de Toulouse, France 2
Hepatitis C virus infection is a significant problem in hemodialysis units. HCV is very variable genetically with six genotypes. Clinical and epidemiological investigation of a new infection requires the determination of both the genotype and the strain of the HCV involved. A prospective, epidemiologic study of 395 dialysis patients in Tunisia was conducted from November 2001 to November 2003 to identify the source of nosocomial transmission using phylogenetic analysis of NS5b and E2 sequences. Hepatitis C infection was diagnosed by screening for anti-HCV antibodies and HCV RNA in sera using third generation ELISA and a qualitative RT-PCR assay. HCV strains were genotyped by sequencing the NS5b region. The genetic relatedness of the HCV strains was studied by sequencing the NS5b and the HVR-1 regions of the HCV genome. Two de novo cases of HCV infection were detected during the follow-up. One of them has been described previously. The case described in this study occurred in a center in which 12 patients were already infected with HCV strains belonging to genotypes 1b (n ¼ 8) and 1a (n ¼ 4). Phylogenetic analysis of the NS5b region from the HCV strains circulating in this center disclosed four clusters, confirmed by analysis of the HVR-1 region, providing strong evidence for nosocomial infection. Epidemiological data showed that these patients were dialyzed during the same shift and in the same area. Phylogenetic analysis of NS5b sequences is useful for determining the HCV genotype and providing evidence of nosocomial transmission. J. Med. Virol. 79:1089–1094, 2007. ß 2007 Wiley-Liss, Inc. KEY WORDS: hepatitis C; hemodialysis; nosocomial transmission; NS5b region; E2 region; Tunisia
ß 2007 WILEY-LISS, INC.
INTRODUCTION Hemodialysis is a risk factor for HCV transmission, despite the screening of blood products for anti-HCV antibodies and the use of recombinant erythropoietin to treat anemia [Rostaing et al., 1998]. Hence, HCV infection in hemodialysis units is due currently mainly to nosocomial transmission [Izopet et al., 1999, 2005; Savey et al., 2005]. Approximately 26% of the hemodialysis patients in Tunisia have anti-HCV antibodies, and HCV RNA has been detected in 75% of anti-HCV positive patients [Ben Othman et al., 2004a; Hmaied et al., 2006]. HCV is very variable genetically. A consensus nomenclature determined six genotypes of HCV (1–6) on the basis of overall sequence similarity and subtypes within each type are designated by lowercase letters in the order of their discovery [Robertson et al., 1998; Simmonds et al., 2005]. Determining the HCV genotype is very important. Indeed, there is a correlation between the genotype and the response to antiviral therapy [Boyer and Marcellin, 2000; Schroter et al., 2003; Zeuzem et al., 2004], making genotyping necessary for tailoring therapeutic regimens [Hnatyszyn, 2005]. Molecular typing of HCV, including phylogenetic analysis of nucleotide sequences, has been used to investigate the mode of transmission, in particular nosocomial transmission [Mizuno et al., 1998; Norder et al., 1998; Izopet et al., 1999; Bracho et al., 2005]. Sequencing several conserved regions of the HCV The GenBank accession numbers for the NS5B sequences reported in this paper are DQ508461–DQ508484 and those for E2 sequences are DQ508439–DQ508460. *Correspondence to: Fatma Hmaı¨ed, Laboratoire de Microbiologie, Hoˆpital Charles Nicolle, 1006 Tunis, Tunisia. E-mail:
[email protected] Accepted 16 February 2007 DOI 10.1002/jmv.20877 Published online in Wiley InterScience (www.interscience.wiley.com)
1090
Hmaı¨ed et al.
genome has been used to determine the HCV genotype by comparing them with the same regions of other genotypes. The NS5B region seems to be the most suitable for genotype and subtype identification [Ben Othman et al., 2004b; Cantaloube et al., 2006; Laperche et al., 2006]. The rapid evolution of the HCV genome and the development of molecular epidemiology has meant that the relationship between HCV strains is usually determined by sequence analysis of the rapidly evolving HVR-1 region [Izopet et al., 1999; Bracho et al., 2005]. This study examines whether phylogenetic analysis of NS5b sequences provides sufficient evidence for nosocomial transmission by comparing the data with the conventional approach based on phylogenetic analysis of the HVR-1 region of the E2 gene. PATIENTS AND METHODS Patients and Sera A total of 395 patients (60% men, mean age: 54 years, range 18–88) attending 10 hemodialysis centers (A, B, C, D, E, F, G, I, J and K) were included in this study. Serum samples were collected between November 2001 and May 2002. All sera were prepared and divided into aliquots within 6 hr of blood sampling and stored frozen at 708C [Hmaied et al., 2006]. Patients were screened for anti-HCV antibodies and HCV RNA in sera at the beginning of the study. The general epidemiological and virological characteristics of dialysis patients were determined in a previous report [Hmaied et al., 2006]. Anti-HCV negative hemodialysis patients were followed monthly by measuring ALT. Any rise in ALT above the upper limit of normal led to screening for HCV–RNA to detect de novo infection. Newly infected patient and those already infected were investigated by sequencing the NS5b and the HVR-1 regions of the HCV genome [Hmaied et al., 2006]. Dialysis machines dedicated to infected patients were not used for anti-HCV negative patients in all centers. Patients had been isolated according to their anti-HCV status in seven hemodialysis units (A, B, C, D, E, F and G) since 1996; anti-HCV-positive patients were not isolated in centers I, J and K. NS5B Sequencing and Phylogenetic Analysis The genotypes of the HCV strains from newly infected patients and those circulating in the same dialysis center were determined by sequencing the amplicons
obtained in the NS5b region of the viral genome. Briefly, HCV RNA was extracted from 140 ml serum using the QIAamp viral RNA method (Qiagen), 10 ml of RNA was amplified by RT-PCR using a Qiagen one-step RT-PCR kit [Sandres-Saune´ et al., 2003]. The mix contained 3.5 mM MgCl2, 10 U ribonuclease inhibitor (Invitrogen), 2 U uracil–DNA glycosylase (Roche) and 200 nM primers Pr3 and Pr2. PCR products (391 bp segment) were then purified (QIAquick PCR purification kit) and sequenced with the same primers that were used for amplification using Big Dye Terminator cycle technology on an Applied Biosystems ABI 3100 Genetic Analyzer. Sequence chromographs were analyzed using the Sequence Navigator programTM software [Parker, 1997]. The genotype of each sample was determined by comparing its nucleotide sequence with those of HCV prototypes representing different genotypes obtained from the Los Alamos HCV sequence database (http://hcv.lanl.gov). The DNA alignments were performed with Clustal W1.7 [Thompson et al., 1994]. The genetic distances between sequences were calculated by the Kimura 2-parametres method using Molecular Evolutionary Genetics Analysis software: MEGA (version 3) [Kumar et al., 2001]. The reproducibility of the branching pattern was determined using bootstrap analysis (100 replicates). Subtypes were determined when sequences clustered together with a bootstrap value >70%. Finally, the phylogenetic tree was drawn using Treeview 1.66 by the neighbor-joining (NJ) method. HVR-1 Sequencing and Phylogenetic Analysis The HVR-1 regions of HCV isolates from newly infected patient and those with the same genotype circulating in the same dialysis unit were sequenced [Izopet et al., 1999]. Extracted RNA was reverse transcribed with 20 U of M-MLV reverse transcriptase and 500 nM of external antisense primer (KS2). Aliquots (20 ml) of cDNA were amplified by PCR using 2.5 U AmpliTaq DNA polymerase (Applera) and 500 nM primers (external sense, KS1 and external antisense, KS2). The PCR thermal profile was 958C for 7 min, 30 cycles at 958C for 30 s, 558C for 30 s and 728C for 1 min 30 s, and a final elongation at 728C for 10 min. Nested PCR was carried out on 2 ml of the first PCR products with 2.5 U AmpliTaq DNA polymerase (Applera) and 500 nM primers (nested sense, KS3 and nested antisense, KS4) (Table I). The nested PCR thermal profile was 958C for 7 min, 30 cycles at 958C for 30 s, 558C for 30 s and 728C for 45 s, followed by 10 min at 728C. A
TABLE I. PCR Primers for HVR-1 Amplification Primer KS1 KS2 KS3 KS4 a
Sequence CAGGACTGCAATTGCTCAATCTA TTGCAGTTTAAGGCAGTCC CACTGGGGAGTCCTGGCGGG ATGTGCCAGCTGCCATTGGT
Positions according to HCV-J (genotype 1b).
J. Med. Virol. DOI 10.1002/jmv
Polarity
Positiona
Sense Antisense Sense Antisense
1,245–1,266 1,612–1,630 1,395–1,414 1,587–1,606
NS5B Region and Nosocomial Transmission of HCV
1091
212 bp segment of E2 was amplified. PCR products were sequenced and analyzed as described for NS5B region. RESULTS Phylogenetic Analysis Phylogenetic analysis was carried out on strains from newly infected patients and on those circulating in the same dialysis center. Two cases of de novo HCV infection, with elevated ALT values and HCV RNA positive, were identified in centers A and K. The phylogenetic analysis of HCV strains in center A has been reported [Hmaied et al., 2006]. The NS5b regions of 12 strains from infected patients in the unit K: K3, K8, K10, K16, K17, K20, K22, K25, K28, K29, K30 and K43 were sequenced. These analyses showed that four strains K3, K28, K29 and K43 were genotype 1a, while strains K8, K10, K16, K17, K20, K22, K25 and K30 belonged to genotype 1b. The phylogenetic tree comparing NS5B sequences from HCV strains isolated in center K and those of center A (A7, A12, A17 and A22) with those of HCV prototypes shows that the HCV 1b strains from the two centers were not closely related, thus excluding the possibility of PCR contamination (Fig. 1) and was detected by the positive HCV viraemia and seroconversion of a previously anti-HCV negative patient (K14), who had an elevated ALT [Hmaied et al., 2006]. The NS5b region could not be amplified; the genotype was determined by sequencing the 50 NC region, revealing a 1b subtype. Figure 2 shows the phylogenetic tree including the NS5b sequences of all the HCV strains from infected patients in center K and 18 controls from GenBank, nine reference sequences were from Tunisia. This analysis disclosed four clusters with significant bootstrap values; the first cluster (cluster 1) included the four HCV genotype 1a with very similar sequences (mean genetic distance: 0.0014). The remaining clusters included the 1b strains: the second cluster (cluster 2) comprised sequences K20 and K22 (bootstrap value: 92%, genetic distance: 0.0229), the third cluster (cluster 3) included sequences K8 and K17 (bootstrap value: 94%, genetic distance: 0.0588), the last cluster (cluster 4) included sequences K16 and K30 that were identical. K25 and K10 did not cluster significantly together (bootstrap value: 52%). A phylogenetic tree comparing HVR-1 sequences of HCV strains from center K and 17 controls from GenBank was constructed; seven reference sequences were from Tunisia (Fig. 3). Analysis of the HVR-1 region from all HCV strains in center K and reference sequences disclosed five clusters confirming results of NS5b region. Cluster 1 included the four HCV genotype 1a strains (mean genetic distance: 0.0431). The remaining clusters included the 1b strains: cluster 2 comprised strains K20 and K22 (bootstrap value: 100%, genetic distance: 0.0508), the cluster 3 included strains K8 and K17 (bootstrap value: 98%, genetic distance: 0.1014), the cluster 4 included strains K16 and K30 (bootstrap value: 100%, genetic distance: 0.0207). Lastly, the strain from the newly infected patient K14 and a strain from an
Fig. 1. Phylogenetic tree comparing nucleotide sequences of the NS5B region in HCV strains from the infected patients in center K with HCV strains from infected patients in center A (A7, A12, A17 and A22) and 18 worldwide reference sequences (10 with genotype 1b and 8 with genotype 1a; AM075802, AM075803, AM075804, AM075808, AM075809, AM075810, AM279719, AM279723 and AM279725 are Tunisian hepatitis C virus strains). The number given at the branch point indicates the frequency with which the node occurred out of 100 bootstrap replicates.
already infected patient K25 were closely related (bootstrap value: 100%, genetic distance: 0.0833). K10 sequence did not cluster with K25. Correlation between Phylogenetic Analysis and Epidemiological Data Epidemiological investigation showed that the patients in center K were not isolated according to their anti-HCV status, patients with anti-HCV antibodies were dialyzed in the same area as anti-HCV negative patients. The possibility of HCV transmission by intravenous drug use was excluded. Patients infected with HCV 1a strains K3 and K29 had been treated by dialysis and were transfused before 1995. They were found to be HCV positive in 1995, when screening for anti-HCV antibodies was introduced in Tunisia. The remaining patients infected with HCV 1a strains K28 J. Med. Virol. DOI 10.1002/jmv
1092
Hmaı¨ed et al.
found to be HCV positive in 1995, were closely related. Patient K14 did not receive blood transfusion before seroconversion. DISCUSSION
Fig. 2. Phylogenetic tree comparing nucleotide sequences of the NS5B region in HCV strains from the infected patients in center K (four HCV genotype 1a strains: K3, K28, K29 and K43; eight HCV genotype 1b strains: K8, K10, K16, K17, K20, K22, K25 and K30) and 18 worldwide reference sequences (10 with genotype 1b and 8 with genotype 1a; AM075802, AM075803, AM075804, AM075808, AM075809, AM075810, AM279719, AM279723 and AM279725 are Tunisian hepatitis C virus strains). The number given at the branch point indicates the frequency with which the node occurred out of 100 bootstrap replicates.
and K43 were first found to be HCV positive at their inclusion in 2002 and 2003, in our previous study (Fig. 4). Phylogenetic analysis placed strains K20 and K22 in cluster 2; anti-HCV antibodies were first detected in April 2001 for patient K22 while patient K20 seroconverted in February 2002. For cluster 3 (strains K8 and K17) patient K8 underwent seconversion in 2001 and patient K17 in 2002. Patient K16, included in cluster 4, underwent seroconversion in 1996 and patient K30 was found to be HCV positive during our previous study in 2002. Finally, the strains infecting the newly infected patient K14 and patient K25, who was J. Med. Virol. DOI 10.1002/jmv
HCV transmission is a substantial problem in hemodialysis units, and nosocomial infection is the most likely explanation for the persistent HCV propagation in dialysis units [Stuyver et al., 1996; Izopet et al., 1999, 2005; Furusyo et al., 2004; Savey et al., 2005]. Evidence for nosocomial transmission has been obtained by sequencing the NS5b region of HCV strains from infected patients [Le Pogam et al., 1998; Norder et al., 1998]; clustering of HCV strains belonging to the same genotype and isolated from patients attending the same dialysis center points to nosocomial transmission. A Tunisian retrospective study demonstrated the utility of NS5b prototype assay in epidemiological studies without proving the nosocomial transmission of HCV in hemodialysis patients [Ben Othman et al., 2004b]. Nevertheless, analysis of the NS5B region allowed the exclusion of several patients as putative sources of contamination based on the difference of genotypes; this was the case of the patient suspected to have a recent HCV infection in center C [Hmaied et al., 2006]. The same study demonstrated nosocomial contamination in center A using molecular tools. We have now investigated HCV transmission in center K. Phylogenetic analysis of the NS5b region from all the HCV strains infecting patients in center K showed four clusters: one strongly related cluster of four HCV genotype 1a strains with similar sequences and three clusters involving 1b strains; each cluster comprised two closely related sequences, suggesting nosocomial transmission. Analysis of the HVR-1 region confirmed these results; the corresponding tree disclosed five clusters. A recent study reported the performance of sequencing NS5B region for determining HCV genotype in epidemiological study [Laperche et al., 2006]. But, Bracho et al. [2005] demonstrated that the analysis of HVR-1 sequence, a rapidly evolving region, to obtain evidence of nosocomial transmission was accurate. Others have sequenced the HVR-1 region to distinguish between HCV strains of the same subtype with phylogenetic analysis confirming transmission [Mizuno et al., 1998; Izopet et al., 1999; Halfon et al., 2002]. It was found that the NS5B analysis is as reliable as analysis of the HVR-1 region; it allowed the conclusion that some strains were closely related and associated with transmission. Epidemiological data plus phylogenetic analysis identified potential contaminators. The strain from the newly infected patient K14 detected in our previous study and another strain from already infected dialysis patient K25 were closely related; indicating that the latter is probably the transmitter. The correlation between phylogenetic analysis and the date of seroconversion allow us to identify potential transmitters. Patient K22 is probably the transmitter of case K20, patient K8 is the putative source of contamination of
NS5B Region and Nosocomial Transmission of HCV
1093
Fig. 3. Phylogenetic tree comparing nucleotide sequences of the HVR-1 region in HCV strains from the newly infected patient K14 which had genotype 1b, 12 already infected hemodialysis patients in center K (four HCV genotype 1a strains: K3, K28, K29 and K43; eight HCV genotype 1b strains: K8, K10, K16, K17, K20, K22, K25 and
K30) and 17 worldwide reference sequences (13 with genotype 1b and 4 with genotype 1a; AY564782, AY564783, AY564784, DQ508439, DQ508440, DQ508441and DQ508442 are Tunisian hepatitis C virus strains). The number given at the branch point indicates the frequency with which the node occurred out of 100 bootstrap replicates.
patient K17, patient K16 is probably the transmitter of K30. Lastly, patients K3 and K29 infected with HCV 1a strains were found to be HCV positive when systematic screening of blood donors for anti-HCV antibodies was introduced in Tunisia. They had been treated by hemodialysis and were transfused before that date; transmission by blood transfusion is thus possible. The four HCV 1a strains in center K were related genetically, confirming nosocomial transmission, but data were insufficient to identify potential transmitter(s). All these patients were dialyzed on the same shift and in
the same area, suggesting nosocomial transmission due to sharing articles between patients and/or via nurses and medical staff [Jadoul et al., 1993; Taskapan et al., 2001]. In summary, the molecular characteristics of HCV strains circulating in Tunisian dialysis units were investigated and nosocomial transmission of HCV in hemodialysis units was confirmed by sequencing the NS5b and HVR-1 region. The sources of infection were identified from the epidemiological data. Unique phylogenetic analysis of NS5b sequences is suitable for
Fig. 4. First detection of positive anti-HCV serology in patients from center K.
J. Med. Virol. DOI 10.1002/jmv
1094
Hmaı¨ed et al.
determining HCV genotype and providing evidence of nosocomial transmission. ACKNOWLEDGMENTS The authors thank all the technicians and nurses who took part in this study. We particularly thank L. Simet and E. Coutanceau for secretarial assistance and Dr. Owen Parkes for checking the English text. We are indebted to the medical staff of the dialysis centers (H. Limam, W. Hidoussi, K. Nouacer, Z. Aloulou, S. Ghalloussi, J. Hanafi, H. Nechi, R. Belhadj, M. Mistaoui, L. Meziou). REFERENCES Ben Othman S, Bouzgarrou N, Achour A, Bourlet T, Pozzetto B, Trabelsi A. 2004a. High prevalence and incidence of hepatitis C virus infections among dialysis patients in the East-Centre of Tunisia. Pathol Biol 52:323–327. Ben Othman S, Trabelsi A, Monnet A, Bouzgarrou N, Grattard F, Beyou A, Bourlet T, Pozzetto B. 2004b. Evaluation of a prototype HCV NS5b assay for typing strains of hepatitis C virus isolated from Tunisian haemodialysis patients. J Virol Methods 119:177–181. Boyer N, Marcellin P. 2000. Pathogenesis, diagnosis management of hepatitis C. J Hepatol 32:98–112. Bracho MA, Gosalbes MJ, Blasco D, Moya A, Gonzalez-Candelas F. 2005. Molecular epidemiology of a hepatitis C virus outbreak in a hemodialysis unit. J Clin Microbiol 43:2750–2755. Cantaloube JF, Laperche S, Gallian P, Bouchardeau F, De Lamballerie X, de Micoo P. 2006. Analysis of the 50 noncoding region versus the NS5b region in genotyping hepatitis C virus isolates from blood donors in France. J Clin Microbiol 44:2051–2056. Furusyo N, Kubo N, Nakashima H, Kashiwagi K, Etoh Y, Hayashi J. 2004. Confirmation of nosocomial hepatitis C virus infection in a hemodialysis unit. Infect Control Hosp Epidemiol 25:584–590. Halfon P, Roubicek C, Gerolami V, Quentin Y, Khiri H, Pepe G, Berland Y. 2002. Use of phylogenetic analysis of hepatitis C virus (HCV) hypervariable region 1 sequences to trace an outbreak of HCV in an autodialysis unit. J Clin Microbiol 40:1541–1545. Hmaied F, Ben Mamou M, Saune´-Sandres K, Rostaing L, Slim A, Arrouji Z, Ben Redjeb S, Izopet J. 2006. Hepatitis C virus infection among dialysis patients in Tunisia: Prevalence and molecular evidence for nosocomial transmission. J Med Virol 78: 185–191. Hnatyszyn HJ. 2005. Chronic hepatitis C and genotyping: The clinical significance of determining HCV genotypes. Antivir Ther 10:1–11. Izopet J, Pasquier C, Sandres K, Puel J, Rostaing L. 1999. Molecular evidence for nosocomial transmission of hepatitis C virus in a French hemodialysis unit. J Med Virol 58:139–144. Izopet J, Sandres-Saune K, Kamar N, Salama G, Dubois M, Pasquier C, Rostaing L. 2005. Incidence of HCV infection in French hemodialysis units: A prospective study. J Med Virol 77: 70–76. Jadoul M, Cornu C, VanYpersele de Strihou C. 1993. Incidence and risk factors for hepatitis C seroconversion in hemodialysis: A prospective study. Kidney Int 44:1322–1326.
J. Med. Virol. DOI 10.1002/jmv
Kumar S, Tamura K, Jakobson IB, Nei M. 2001. MEGA2: Molecular evolutionary genetics analysis software. Bioinformatics 17:1244– 1245. Laperche S, Saune K, Deny P, Duverlie G, Alain S, Chaix ML, Gaudy K, Lunel F, Pawlotsky JM, Payan C, Pozzetto B, Tamalet C, Thibault V, Vallet S, Bouchardeau F, Izopet J, Lefre`re JJ. 2006. Unique NS5B hepatitis C virus gene sequence consensus database is essential for standardization of genotype determination in multicenter epidemiological studies. J Clin Microbiol 44:614–616. Le Pogam S, Le Chapois D, Christen R, Dubois F, Barin F, Goudeau A. 1998. Hepatitis C in a hemodialysis unit: Molecular evidence for nosocomial transmission. J Clin Microbiol 36:3040–3043. Mizuno M, Higuchi T, Kanmatsuse K, Esumi M. 1998. Genetic and serological evidence for multiple instances of unrecognized transmission of hepatitis C virus in hemodialysis units. J Clin Microbiol 36:2926–2931. Norder H, Bergtro¨m A, Uhnoo I, Alde´n J, Weiss L, Czajkowski J, Magnius L. 1998. Confirmation of nosocomial transmission of hepatitis C virus by phylogenetic analysis of the NS5-B region. J Clin Microbiol 36:3066–3069. Parker SR. 1997. Sequence navigator. Multiple sequence alignment software. Methods Mol Biol 70:145–154. Robertson B, Myers G, Howard C, Brettin T, Bukh J, Gaschen B, Gojobori T, Maertens G, Mizokami M, Nainan O, Netesov S, Nishioka K, Shin T, Simmonds P, Smith D, Stuyver L, Weiner A. 1998. Classification, nomenclature, and database development for hepatitis C virus (HCV) and related viruses: Proposals for standardization. Arch Virol 12:2493–2503. Rostaing L, Izopet J, Modesto-Segonds A. 1998. He´patite C apre`s greffe re´nale. Presse Me´dicale 27:684–688. Sandres-Saune´ K, Deny P, Pasquier C, Thibaut V, Duverlie G, Izopet J. 2003. Determining hepatitis C genotype by analyzing the sequence of the NS5b region. J Virol Methods 109:187–193. Savey A, Simon F, Izopet J, Lepoutre A, Fabry J, Desenclos JC. 2005. A large nosocomial outbreak of hepatitis C virus infections at a hemodialysis center. Infect Contr Hosp Epidemiol 26:752–760. Schroter M, Feucht HH, Zo¨llner B, Scha¨fer P, Laufs R. 2003. Multiple infections with different HCV genotypes: Prevalence and clinical impact. J Clin Virol 27:200–204. Simmonds P, Bukh J, Combet C, Deleage G, Enomoto N, Feinstone S, Halfon P, Inchauspe G, Kuiken C, Maertens G, Mizokami M, Murphy DG, Okamoto H, Pawlotsky JM, Penin F, Sablon E, Shin-I T, Stuyver LJ, Thiel HJ, Viazov S, Weiner AJ, Widell A. 2005. Consensus proposals for a unified system of nomenclature of hepatitis C virus genotypes. Hepatology 42:962–973. Stuyver L, Claeys H, Wyseur A, Van Arnhem W, De Beenhouwer H, Uytendaele S, Beckers J, Matthijs D, Leroux-Roels G, Maertens G, De Paepe M. 1996. Hepatitis C virus in a hemodialysis unit: Molecular evidence for nosocomial transmission. Kidney Int 49: 889–895. Taskapan H, Oymak O, Dogukan A, Utas C. 2001. Patient to patient transmission of hepatitis C virus in hemodialysis units. Clin Nephrol 55:477–481. Thompson JD, Higgins DG, Gibson TJ. 1994. CLUSTAL W: Improving the sensitivity of progressive multisequence alignement through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673–4680. Zeuzem S, Hultcrantz R, Bourliere M, Goeser T, Marcellin P, SanchezTapias J, Sarrazin C, Harvey J, Brass C, Albrecht J. 2004. Peginterferon alfa-2b plus ribavirin for treatment of chronic hepatitis C in previously untreated patients infected with HCV genotypes 2 or 3. J Hepatol 40:993–999.
