Food Biotechnology, 23:97–106, 2009 Copyright © Taylor & Francis Group, LLC ISSN: 0890-5436 print DOI: 10.1080/08905430902873007
Development and Application of SCAR Marker for the Detection of Papaya Seed Adulteration in Traded Black Pepper Powder
Downloaded By: [Sasikumar, B.] At: 10:32 22 May 2009
1532-4249 0890-5436 LFBT Food Biotechnology, Biotechnology Vol. 23, No. 2, Mar 2009: pp. 0–0
Detection K. DhanyaofetPapaya al. Seed Adulteration in Black Pepper Powder
K. Dhanya, S. Syamkumar, and B. Sasikumar Crop Improvement and Biotechnology Division, Indian Institute of Spices Research, Calicut, Kerala, India The present study reports the development of a specific, sensitive, and reproducible Sequence Characterized Amplified Region (SCAR) marker to detect papaya seed powder adulteration in traded black pepper powder. A putative RAPD marker (449 bp) specific to papaya seed was identified, cloned, and sequenced to design the SCAR primers. This specific SCAR marker could detect the presence of papaya seed in all the analyzed simulated standards and in one of five branded market samples of black pepper powder tested. The analytical strategy being very simple could be used for large scale screening of powdered black pepper market samples intended for export and domestic uses. Key Words: adulteration; black pepper; detection; papaya seed; PCR; SCAR marker
INTRODUCTION Black pepper (Piper nigrum L., Family Piperaceae) has an important position among spices and is often referred to as “The King of Spices” or “Black Gold.” It is the most widely used spice and is very important in the cuisines globally. It also forms a component in curry powders, soluble seasonings, sauces, and related spice mixtures (Tainter and Grenis, 1993; Premavalli et al., 2000). In addition to its use as a spice and flavoring agent, black pepper has antimicrobial, antioxidant, anti-inflammatory, and antitoxic properties (Vijayan and Thampuran, 2000). However, adulteration has been reported
Address correspondence to B. Sasikumar, Crop Improvement and Biotechnology Division, Indian Institute of Spices Research, Calicut, Kerala, India-673 012; E-mail:
[email protected]
Downloaded By: [Sasikumar, B.] At: 10:32 22 May 2009
98
K. Dhanya et al.
in whole black pepper and its products such as white pepper, ground pepper, essential oil, and oleoresin (Bhalla and Punekar, 1975; Archer, 1987; Madan et al., 1996), affecting the quality of the commodity. Papaya seed (Carica papaya L.) is one of the most common adulterants of whole black pepper because of its structural resemblance to the commodity (Pruthi and Kulkarni, 1969), its low cost, and easy availability. Undetected adulteration of black pepper berries with papaya seeds can lead to adulteration of processed products, such as black pepper powder and oleoresin (Paradkar et al., 2001). Numerous conventional analytical methods, which rely on physical, histochemical, or standard biochemical methods, have been reported for the detection of papaya seed adulteration in black pepper berries/simulated black pepper powder (Pruthi and Kulkarni, 1969; Hartman et al., 1973; Sreedharan et al., 1981; Curl and Fenwick, 1983; Madan et al., 1996; Paradkar et al., 2001; Paramita et al., 2003), which are handicapped by one or the other defects. Pruthi and Kulkarni (1969) used an alcohol flotation test to detect papaya seed in whole black pepper. A histochemical test based on difference in color development in halved black pepper and papaya seed using 10g l−1 iodine in aqueous potassium iodide solution was developed by Sreedharan et al. (1981). A sensitive test based on the determination of benzyl glucosinolate (glucotropaeolin), a compound specific to papaya seed, was used by Curl and Fenwick (1983). Hartman et al. (1973), Paradkar et al. (2001), and Paramita et al. (2003) utilized chromatographic behavior and characteristic UV fluorescence with a lower Rf value for papaya than black pepper in developing techniques to determine papaya seed adulteration in black pepper. Detecting papaya seed adulteration by glucotropaeolin estimation based on gas chromatography (Curl and Fenwick, 1983) is restricted in its utility, as it is primarily applicable to large industries (Paradkar et al., 2001). Similarly, in the TLC method developed by Paradkar et al. (2001) and Paramita et al. (2003), the aldehydes (n-nonanal, 2-decanal, n-dodecanal, etc.) associated with the fluorescent spot in the chromatogram, developed as specific markers for papaya, are highly incompatible with oxidizing agents and may be affected by the shelf life of the samples. The DNA-based method, being independent of these handicaps, is a viable alternative analytical tool in this context. With the advent of molecular biotechnology in the past few decades, genetic tools are now considered to provide more precise, quick, and reliable analytical methods for adulterant detection and authentication of food items (Bryan et al., 1998; Lockley and Bardley, 2000; Heather, 2000; Clavo et al., 2001; Terzi et al., 2003; Bandana and Mahipal, 2003; Sasikumar et al., 2004; Chang-Chai et al., 2005; Aida et al., 2007). Here, we report a new PCR-based protocol for detecting papaya seed adulteration in traded black pepper powder using a SCAR marker developed from a papaya seed specific RAPD amplicon.
Detection of Papaya Seed Adulteration in Black Pepper Powder
MATERIALS AND METHODS
Downloaded By: [Sasikumar, B.] At: 10:32 22 May 2009
Sample Materials and DNA Isolation Dried black pepper (Malabar pepper) procured from Spices Board, Cochin, India, five popular branded market samples of black pepper powder and papaya seeds collected and dried from mature papaya fruits procured from the local market in Calicut, Kerala, India, were used in the study. Control blends of black pepper (Malabar pepper) and papaya seeds in the proportion 99:1, 95:5, 90:10, and 80:20 were prepared on a weight basis (Paradkar et al., 2001) and ground to fine powder using a Cyclotech 1093 sample mill. These simulated samples were used as analytical standards for detecting papaya seed adulteration in black pepper powder. Genuine hybrid/cultivar of black pepper, Panniyur-1, Karimunda, and Wayanadan, obtained from the Indian Institute of Spices Research Experimental Farm at Peruvannamuzhi, Calicut, Kerala, India, were also used as controls. Genomic DNA was extracted from all the samples as per the protocol of Dhanya et al. (2007).
RAPD-PCR PCR for amplifying the DNA preparations was performed in a reaction volume of 25 µL. A reaction tube contained 35 ng of DNA, 1 X assay buffer (Bangalore Genei, India), 0.2 mM of dNTPs, 2 mM MgCl2, 10 pmol random decamer primer, and 1 U of Taq DNA polymerase enzyme (Bangalore Genei, India). Amplifications were carried out in a thermal cycler (Eppendorf, Master Cycler Gradient S) using the following parameters: 94°C for 3 min, 35 cycles at 94°C for 1 min, 37°C for 1 min, 72°C for 1 min, and a final extension at 72°C for 15 min. PCR products were subjected to 1.5% [w/v] agarose gel (containing 0.5µgml−1 of EtBr) electrophoresis in 1X TAE buffer along with 1Kb DNA ladder (Biogene, USA) as size marker. The gel was documented using a gel documentation system (Alpha Imager 2220, San Leandro, CA, USA).
Screening Strategy and Identification of RAPD Amplicon Twenty-four random decamer primers (OPA-07, OPA-08, OPA-18, OPB-10, OPB-15, OPB-17, OPC-05, OPC-07, OPC-10, OPC-11, OPC-14, OPC-16, OPC-20, OPD-02, OPD-03, OPD-07, OPD-11, OPD-20, OPE-03, OPE-11, OPJ-09, OPJ-11, OPJ-12, and OPJ-19) procured from Operon Technologies Inc., Alameda, Calif., USA, were screened for identifying the papaya seed specific marker from the market samples. The primers, which gave consistent amplification patterns for both black pepper and papaya seeds separately, were selected for subsequent amplification. Genomic DNA from five commercial samples of black pepper powder along with genuine black pepper (Malabar pepper) and papaya seed were amplified and resolved in the same agarose gel. Papaya
99
100
K. Dhanya et al.
seed specific bands were scored on the basis of their presence in the papaya seed sample and absence in black pepper powder (Malabar pepper).
Downloaded By: [Sasikumar, B.] At: 10:32 22 May 2009
Cloning and Sequencing of RAPD Amplicon The putative marker [Pap0I] produced in market sample (sample III) and genuine papaya seed by the random primer OPJ-09 were excised from a 1.5% agarose gel with a sterile slicer and purified using Perfectprep Gel Cleanup Kit (Eppendorf, Germany). The excised RAPD bands were ligated into the “T” vector system (TA Cloning Kit, Bangalore Genei, India) following the supplier’s instructions. The ligated products were transformed into competent Escherichia coli strain DH5a using calcium chloride (Sambrook and Russel, 2001). Recombinants were identified as white colonies on LB plates supplemented X-Gal, IPTG, and ampicillin, and their master plates were prepared. Further screening was done by colony PCR in a reaction mix containing 1 X assay buffer, 0.2 mM of dNTPs, 1.5 mM MgCl2, 5 pmol of each SP6 and T7 promoter primers (IDT, Iowa City, IA, USA), 1 µl of lysate, and 1 U of Taq DNA polymerase enzyme in 25 µl total reaction volume. Thermal cycling conditions for amplification were 94°C for 3 min, 30 cycles at 94°C for 1 min, 48°C for 1 min, 72°C for 1 min, and a final extension at 72°C for 5 min. The amplified products were run in a 1.5% agarose gel. Putative positive transformants based on the size of the amplicon were characterized. Recombinant plasmid DNA was isolated from overnight grown liquid cultures of the selected clones using the Fast Plasmid Mini Prep Kit (Eppendorf, Germany). The size of the DNA insert in the plasmid was confirmed by Nco I restriction digestion. The recombinant plasmids were sequenced at the DNA sequencing service unit of Bangalore Genei, India, using the vector specific SP6 promoter primer.
Analysis of Sequence Data Nucleotide sequence of Pap0I produced in genuine papaya seed and the market sample III were compared by multiple sequence alignment using Clustal X (Thomson, 1997) and the percentage identity was determined using the BioEdit Sequence Alignment Editor (Hall, 1999). Sequence homology searches of the Pap0I marker also were performed within GeneBank’s nonredundant database using the BLAST 2.2.8 (Basic Local Alignment Search Tool) algorithm at http://www.ncbi.nlm.nih.gov/ BLAST/ of the National Center for Biotechnology Information (NCBI), with the program BLASTN.
SCAR Primer Designing and Sequence Specific Amplification Based on the sequence data, a pair of SCAR oligonucleotide primers, P1 (5′TGAGCCTCACGTATAGCATG3′) and P2 (5′TGAGCCTCACCGAGGAA
Downloaded By: [Sasikumar, B.] At: 10:32 22 May 2009
Detection of Papaya Seed Adulteration in Black Pepper Powder
ATC3′), was designed and the sequences were custom synthesized from Integrated DNA Technologies Inc, Iowa City, IA. Genomic DNA of genuine black pepper hybrid/cultivars (Panniyur-1, Karimunda, and Wayanadan), Malabar pepper, five commercial samples of black pepper powder, and papaya seed was analyzed using the designed SCAR primers. The specific primers also were used for PCR analysis of genomic DNA from Malabar pepper, papaya seeds, and their blends made in different concentrations. Thermal cycling conditions for amplification were optimized and consisted of 94°C for 3 min, 30 cycles at 94°C for 1 min, 60°C for 1 min, 72°C for 1 min, and a final extension at 72°C for 5 min. The reaction mix (25 µl) contained 35 ng of DNA, 1 X assay buffer (Bangalore Genei, India), 0.2 mM of dNTPs, 1.5 mM MgCl2, 5pmol of each primer (forward and reverse), and 1 U of Taq DNA polymerase enzyme (Bangalore Genei, India).
RESULTS Quality and Yield of DNA High molecular weight DNA was isolated from all 14 samples. The yield of the DNA varied from 6–10 µg per gram of tissue. An absorbance (A260/A280) ratio of 1.7–1.8 indicated insignificant levels of contaminating proteins and polysaccharides in the DNA.
Identification of Papaya Seed Specific RAPD Marker Among the 24 RAPD primers screened, 13 gave a consistent amplification pattern for both black pepper (Malabar pepper) and papaya seeds. These primers (OPA-07, OPA-08, OPA18, OPB-17, OPC-05, OPC-07, OPC-10, OPC-20, OPD-11, OPE-03, OPE-11, OPJ-09, and OPJ-19) were used for subsequent amplification of black pepper (Malabar pepper), papaya seeds, and five commercial samples of black pepper powder. Of these, two primers (OPJ-09 and OPA-18) generated unique banding patterns, which could easily distinguish the papaya specific bands in the market samples. Primer OPA-18 (5’-AGGTGACC GT-3’) produced two bands of approx 830bp and 470bp in the market sample III. The primer OPJ-09 (5’-TGAGCCTCAC-3’) amplified a product of ∼450 bp in two market samples (sample II and sample III; Fig. 1). However, the band produced in sample II was very weak compared with sample III. RAPD amplicon (∼450bp) from OPJ-09 (Pap0I) was selected for SCAR marker development, considering its high degree of resolution and size suitable for sequencing.
Cloning and Sequencing of RAPD Marker Pap0I produced in market sample III and papaya seed was cloned separately. Amplification with SP6 and T7 promoter primer yielded a product of ∼600bp
101
Downloaded By: [Sasikumar, B.] At: 10:32 22 May 2009
102
K. Dhanya et al.
Figure 1: RAPD profile of black pepper (Malabar pepper), commercial samples of black pepper powder and papaya seed amplified using primer OPJ-09. M - 1 Kb DNA ladder (Biogene, USA), Lane 1- Malabar pepper, Lane 2 - Market sample I, Lane 3 - Market sample II, Lane 4 - Market sample III, Lane 5 - Market sample IV, Lane 6 - Market sample V, Lane 7 Papaya seed.
Figure 2: Nucleotide sequence of RAPD amplicon Pap0I cloned from the market sample III.
in all positive clones. These clones were selected for plasmid DNA isolation. Restriction digestion using Nco I revealed a band ∼450bp on agarose gel, which confirmed the presence of the insert in the vector. The recombinants were sequenced. The first ten nucleotides at both ends of the sequences obtained matched completely with the RAPD primer OPJ-09 (Fig. 2).
Sequence Data Analysis The length of the Pap0I marker sequence obtained was of 449bp. The sequence alignment data revealed 100% similarity between the Pap0I sequences obtained from papaya seed and market sample III. Blast results revealed that the DNA fragment had partial homology with known plant
Detection of Papaya Seed Adulteration in Black Pepper Powder
nucleotide sequences at different sequence similarity levels. Considerable similarity was found with whole genome shotgun sequencing containing VV78X146502.10, clone ENTAV 115, (127 bits and E.-value 4e-26) of Vitis vinifera, and clone mth2-139k12 (113 bits, E–value 8e-22) of Medicago truncatula.
Downloaded By: [Sasikumar, B.] At: 10:32 22 May 2009
Conversion of RAPD Marker into SCAR Based on the sequence data, a pair of SCAR oligonucleotide primers (P1 and P2) was designed by identifying the original 10 bp sequence of the RAPD primer and adding the next 10 bp from the DNA sequence. The designed primer pair was used to amplify the genomic DNA from black pepper (Malabar pepper), papaya seeds, the model blends, and five different commercial samples of black pepper powder. A single, distinct, and brightly resolved band of 449 bp was obtained from the papaya seed, and in all the control blends (Fig. 3). One of the five market samples also amplified the same sequence specific marker (Fig. 4). The band was completely missing in the pure black pepper (including the genuine hybrid/cultivars and Malabar pepper) powder studied.
DISCUSSION AND CONCLUSION Even though RAPD analysis can reveal a high degree of polymorphism (Williams et al., 1990), the lower annealing temperature may reduce the specificity of the reaction as observed in market sample II. Reproducibility of RAPD also is reported to be affected by various factors (Wolfe and Liston, 1998). Conversion of RAPD markers to SCAR markers has significant advantage in this context (Das et al., 2005). In the SCAR, oligonucleotide primers specific to the
Figure 3: PCR amplification of papaya specific SCAR marker in model blends of black pepper
(Malabar pepper) and papaya seed made in different concentrations. M - 1 Kb DNA ladder (Biogene, USA), Lane 1 - Malabar pepper, Lane 2 - Model blend (99:1), Lane 3 - Model blend (95:5), Lane 4 - Model blend (90:10), Lane 5 - Model blend (80:20), Lane 6 - Papaya seed and Lane 7 - Negative control.
103
Downloaded By: [Sasikumar, B.] At: 10:32 22 May 2009
104
K. Dhanya et al.
Figure 4: PCR amplification of papaya specific SCAR marker in pure black peppers, commercial samples of black pepper powder and papaya seed. Lane 1 - Panniyur-1, Lane 2 - Karimunda, Lane 2 - Wayanad, Lane 4 - Malabar pepper, Lane 5 - Market sample I, Lane 6 - Market sample II, Lane 7 - Market sample III, Lane 8 - Market sample IV, Lane 9 - Market sample V, Lane 10 Papaya seed, Lane 11 - Negative control and M - 1 Kb DNA ladder (Biogene, USA).
sequence of the polymorphic bands can be used to amplify the characterized regions from genomic DNA under stringent conditions, which make these markers more specific and dependable compared with the RAPD markers (Paran and Michelmore, 1993). The PCR method using SCAR marker could detect the presence of papaya seed in one of the market samples of black pepper powder, confirming the occurrence of adulteration of commercial samples of black pepper powder with papaya seed powder, closely resembling black pepper powder in its physical features. The SCAR marker developed in the present study could detect the presence of papaya seed in all the model blends prepared, even at a lower concentration of 10 g papaya seed/kg of black pepper tried. These results substantiate the applicability of the designed primers as a qualitative diagnostic tool for the detection of powdered papaya seed adulteration in black pepper powder. However, for the quantitative analysis of papaya seed content in commercial samples, techniques such as real time PCR could be tried. This study has special significance as adulteration is a major concern under the Sanitary and Phytosanitary issues of the WTO agreement.
ACKNOWLEDGMENTS The authors acknowledge the Director (Marketing) of the Spices Board, Cochin, for providing the samples and the Director of the Indian Institute of Spices Research, Calicut, Kerala, for providing the facilities for the research work. This work was supported by a research grant from the Department of Biotechnology, Government of India.
Detection of Papaya Seed Adulteration in Black Pepper Powder
REFERENCES Aida, A.A., Che Man, Y.B., Raha, A.R., Son, R. (2007). Detection of pig derivatives in food products for halal authentication by polymerase chain reaction-restriction fragment length polymorphism. J. Sci. Food Agric. 87:569–572. Archer, A.W. (1987). The adulteration of white pepper with rice starch. J. Assoc. Publ. Analysts 2:43–46. Bandana, D., Mahipal, S. (2003). Molecular detection of cashew husk (Anacardium occidentale) adulteration in market samples of dry tea (Camella sinensis). Planta Med. 69:882–884.
Downloaded By: [Sasikumar, B.] At: 10:32 22 May 2009
Bhalla, K., Punekar, B.D. (1975). Incidence and state of adulteration of commonly consumed spices in Bombay city. II. mustard, black pepper and asafoetida. Indian J. Nutr. Diet 12:216–222. Bryan, G.J., Dixon, A., Gale, M.D., Wiseman, G. (1998). A PCR-based method for the detection of hexaploid bread wheat adulteration of Duram wheat and Pasta. J. Cereal Sci. 28:135–145. Chang-Chai, N., Chun-Yi, L., Wen-Sheng, T., Chen-Chin, C., Yuan-Tay, S. (2005). Establishment of an internal transcribed spacer (ITS) sequence-based differentiation identification procedure for mei (Prunus mume) and plum (Prunus salicina) and its use to detect adulteration in preserved fruits. Food Res. Int. 38:95–101. Clavo, J.H., Zaragoza, P., Osta, R. (2001). Random amplified polymorphic DNA fingerprints for identification of species in poultry pate. Poultry Sci. 80:522–524. Curl, C.L., Fenwick, G.R. (1983). On the determination of papaya seed adulteration of black pepper. Food Chem. 12:241–247. Das, M., Bhattacharya, S., Pal, A. (2005). Generation and characterization of SCARs by cloning and sequencing of RAPD products: A strategy for species–specific marker development in Bamboo. Ann. Bot-London 95:835–841. Dhanya, K., Jaleel, K., Syamkumar, S., Sasikumar, B. (2007). Isolation and amplification of genomic DNA from recalcitrant dried berries of black pepper (Piper nigrum, L) — a medicinal spice. Mol. Biotechnol. 3:165–168. Hall, T.A. (1999). BioEdit: A user-friendly biological sequence alignment editor and analysis program for windows 95/98/NT. Nucleic Acids Symp. Ser. 4:95–98. Hartman, C.P., Divakar, N.G., Rao, V.N.N. (1973). A study of identification of papaya seed in black pepper. J.Food Sci. Tech. 10:43. Heather, F.J.B. (2000). Detection of adulteration of Basmati rice with nonpremium long grain rice. Int. J. Food Sci. Tech. 35:257–265. Lockley, A.K., Bardley, R.G. (2000). DNA-based methods for food authentication. Trends Food Sci. Tech. 11:67–77. Madan, M.M., Singhal, R.S., Kulkarni, P.R. (1996). An approach into the detection of authenticity of black pepper (Piper nigrum L.) oleoresein. Journal of Spices and Aromatic Crops 5:64–67. Paradkar, M.M., Singhal, R.S., Kulkarni, P.R. (2001). A new TLC method to detect the presence of ground papaya seed in ground black pepper. J. Sci. Food Agric. 81: 1322–1325. Paramita, B., Singhal, R.S., Achyut, S.G. (2003). Supercritical carbon dioxide extraction for identification of adulteration of black pepper with papaya seeds. J. Sci. Food Agric. 83:783–786.
105
106
K. Dhanya et al. Paran, I., Michelmore, R.W. (1993). Development of reliable PCR-based markers linked to Downy mildew resistance genes in lemice. Theor. Appl. Genet. 8:985–993. Premavalli, K.S., Majumdar, T.K., Malini, S. (2000). Quality evaluation of traditional products. II. Garam masala and Puliyodara mix masala. Indian Spices 57:10–13. Pruthi, J.S., Kulkarni, B.M. (1969). A simple technique for the rapid and easy detection of papaya seeds in black pepper berries. Indian Food Packer 2:51–52. Sambrook, J., Russel, D.W. (2001). Molecular Cloning: A Laboratory Manual. New York: Cold Spring Harbour Laboratory Press.
Downloaded By: [Sasikumar, B.] At: 10:32 22 May 2009
Sasikumar, B., Syamkumar, S., Remya, R., John Zachariah, T. (2004). PCR-based detection of adulteration in the market samples of turmeric powder. Food Biotechnol. 18:299–306. Sreedharan, V.P., Mangalakumari, C.K., Mathew, A.G. (1981). Staining technique for the determination of papaya seed for the differentiation of papaya seed from black pepper. J. Food Sci. Technol. 18:65–66. Tainter, D.R., Grenis, A.T. (1993). Spices and Seasonings. New York: NCH Publications. Terzi, V.I., Malnati, M., Barbanera, M., Stanca, A.M., Faccioli, P. (2003). Development of analytical systems based on real-time PCR for Triticum species-specific detection and quantitation of bread wheat contamination in semolina and pasta. J. Cereal Sci. 38:87–94. Thomson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G. (1997). The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 24:4876–4882. Vijayan, K.K., Thampuran, R.V.A. (2000). Pharmacology, toxicology and clinical application of black pepper. In: Ravindran, P.N., ed. Black Pepper (Piper nigrum L.). Amsterdam: Harwood Academic Publishers, pp. 455–466. Williams, J.G.K., Kubelik, A.R., Livak, K.J., Rafalski, J.A., Tingey, S.V. (1990). DNA polymorphism amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Res. 18:6531–6535. Wolfe, A.D., Liston, A. (1998). Contributions of PCR-based methods to plant systematics and evolutionary biology. In: Soltis, D.E., Soltis, P.S., Doyle, J.J., eds. Molecular Systematics of Plants II: DNA Sequencing. New York: Kluwer, pp 43–86.
