Development and characterization of microsatellite ...

J Appl Phycol DOI 10.1007/s10811-014-0301-y

Development and characterization of microsatellite markers from an enriched genomic library of Saccharina japonica Jing Zhang & Wei Li & Jieqiong Qu & Xumin Wang & Cui Liu & Tao Liu

Received: 9 December 2013 / Revised and accepted: 18 March 2014 # Springer Science+Business Media Dordrecht 2014

Abstract Saccharina (Laminaria) is an important economic seaweed. Simple sequence repeat (SSR) markers were developed for S. japonica from an SSR-enriched genomic library using a modified magnetic-bead enrichment protocol. Sequence analysis of 2,853 randomly picked recombinant colonies indicated that 1,092 of the colonies contained microsatellites. After filtration, the remaining 593 unique sequences were examined for their suitability and 266 primer pairs were ultimately designed. Among them, 179 could be used for genetic study by practicability tests. Then, 23 pairs of core primers with good representativeness were selected to analyze 13 Saccharina (Laminaria) gametophyte lines, which are widely used in breeding and economic cultivation in China. A total of 72 alleles were detected with an average of 3.13 alleles per locus. The Nei’s (1973) gene diversity (H) of these markers ranged from 0.1420 to 0.7222. Cluster analysis was generated from genetic distance by the Unweighted PairGroup Method with Arithmetic Mean (UPGMA) which resolved the 13 lines into two main groups in accord with their geographic distribution. These results indicated that the SSR markers developed in this study were informative and would

J. Zhang Shandong Provincial Key Laboratory of Microbial Engineering, Qilu University of Technology, 3501 Daxue Road, Jinan, Shandong Province 250353, People’s Republic of China W. Li : J. Qu : C. Liu : T. Liu (*) College of Marine Life Sciences, Ocean University of China, 5 Yushan Road, Qingdao, Shandong Province 266003, People’s Republic of China e-mail: [email protected] X. Wang CAS Key Laboratory of Genome Sciences and Information, Beijing Institute of Genomics, Chinese Academy of Sciences, 1 Beichen West Road, 100101 Beijing, People’s Republic of China

be useful for genetic analysis and germplasm management in Saccharina (Laminaria). Keywords Saccharina . Phaeophyta . Microsatellite markers . Enriched genomic library . Genetic analysis

Introduction Saccharina (Laminariales, Phaeophyceae) is one of the most important marine macroalgae genera with respect to its global distribution and economic importance (Kain 1979). As they are rich in iodine, iron, calcium, protein, vitamins, and other nutrients, they can be used as food for human and as resources for biochemical and pharmaceutical industries (Jensen 1993). With nearly 60 years’ development, breeding and cultivation of Saccharina (Laminaria) have been quite successful and 15 Saccharina varieties have been cultivated (Fang et al. 1962; Zhang et al. 2007; Li et al. 2008; Zhang et al. 2011). However, there are still unsolved problems, such as limited improved varieties, declining germplasm, and genetic confusion. Applying genetic molecular markers to evaluate genetic structure systematically will lay a solid foundation for genetic study. Recently, randomly amplified polymorphism of DNA (RAPD), inter-simple sequence repeat (ISSR) and amplified fragment length polymorphism (AFLP) markers have been developed and applied in germplasm identification (Wang et al. 2004), parentage analysis (Billot et al. 1999a), genetic diversity (Wang et al. 2005; Yotsukura et al. 2001; Xia et al. 2005), population genetics (Shan et al. 2011; Bi et al. 2011), genetic mapping (Li et al. 2007; Yang et al. 2009), and QTL analysis (Liu et al. 2010a, 2011) in Saccharina (Laminaria). Microsatellites, also known as single sequence repeats (SSRs), occur as tandem arrays of mono-, di-, tri-, tetra-, or penta-nucleotide repeat units throughout the genomes of most

J Appl Phycol

eukaryotic species (Powell et al. 1996). Given their good reproducibility and specificity, high level of polymorphism, codominant inheritance, and widespread distribution, they have been widely used in genetics and breeding of land plants (Tautz 1989). However, research work associated with SSR in Saccharina (Laminaria) is just at the beginning, and only a few genomic SSR and EST-SSR markers are at present available for Saccharina (Laminaria) genetic studies. There were ten polymorphic genomic SSRs isolated from Laminaria digitata genomic libraries of small inserts (Billot et al. 1999b). Eighteen polymorphic microsatellite DNA markers were developed for S. japonica based on fast isolation by AFLP of sequence containing repeats (FIASCO) method (Shi et al. 2007). In addition, 12 EST-SSR markers were generated and characterized from 578 S. japonica EST sequences using updated public EST databases and 9 pairs of these primers revealed polymorphism (Liu et al. 2010b). Twenty-three EST-SSR markers which showed polymorphism were developed from 4,099 ESTs of the L. digitata and S. japonica EST database (Wang et al. 2011). Thirteen EST-SSR markers with polymorphism in a wild S. japonica population were developed from L. digitata ESTs (Liu et al. 2012). In any case, advancement of SSR markers is left far behind the need for the study of molecular genetics of Saccharina (Laminaria). Consequently, it is indispensable to develop large amounts of SSR markers quickly and effectively with high polymorphism and good transferability to overcome the lack of SSR markers. For these species with limited genome information, the use of magnetic-bead-enriched genomic libraries for microsatellite development is a strategy devised to decrease the cost and increase the discovery opportunity (Bronw et al. 1995). Here, a microsatellite library for S. japonica was successfully constructed using the modified magnetic-bead enrichment procedure, and a set of novel microsatellite markers was reported, which represented a powerful tool in genetic studies. To our knowledge, this was the first batch of SSR markers for this species using this quick enrichment method. Moreover, gametophytes from different species of Saccharina (Laminaria) were used to screen SSR markers with good representativeness, providing an SSRbased analytic system in Saccharina (Laminaria) and evidence for germplasm identification as well as conservation.

Materials and methods Construction of microsatellite enriched genomic library Four “Fujian” individuals used in this study were obtained from Lidao located in Rongcheng City, China, and provided by the Culture Collection of Seaweed at Ocean University of China. “Fujian” is a later maturing variety of S. japonica,

which has not been subjected to any systematic selection and is now widely distributed in China. Genomic DNA was isolated from fresh sporophytes with an improved CTAB method (Guillemaut and Drouard 1992). The microsatellite-enriched genomic library was constructed following the modified magnetic-bead enrichment protocol according to the strong affinity between biotin and streptavidin (Geng et al. 2010). Genomic DNA was sonicated to fragments, mainly ranging from 500 to 1,000 bp, which were performed for 2 s, followed an interval of 10 s, and then for 2 s under 20 % power by ultrasonication. The fragmented genomic DNA was recovered using PCR Purification columns (Qiagen, Germany) according to manufacturer’s instruction. This was followed by ligation of double-stranded SNX linker primers (SNX-F: 5′-CTAAGGCCTTGCTAGCAGAAGC-3′ and SNX-R: 5′-pGCTTCTGCTAGCAAGGCCTTAGAAAA -3′) (Hamilton et al. 1999). Linker-ligated fragments were polymerase chain reaction (PCR) amplified with the SNX-F linker as primer. Amplifications were carried out in a 30-μL reaction volume containing 20–100 ng DNA, 1× Taq Polymerase buffer supplemented with 1.5 mM MgCl2, 50 μM of each dNTP, 0.5 U Taq DNA polymerase, and 0.5 μM of SNX-F linker. The PCR amplifications were carried out by the following protocol: 95 °C for 2 min, followed by 20 cycles (95 °C for 30 s, 62 °C for 30 s and 72 °C for 90 s), and then 72 °C for 30 min. The PCR products were hybridized to a biotinylated microsatellite oligonucleotide probe mixture containing (AG)12 and (AC)12 at 60 °C, and enriched with streptavidin magnetic particle beads (DynaL Biotech, Norway). Following hybridization, the beads were washed with BW buffer in the presence of 10 mM Tris (pH=7.5), 1.0 mM EDTA (pH=8.0) and 1.0 M NaCl. After the final wash, 20 μL of hybridization buffer (6× SSC, 0.1% SDS) was added to the beads, and the mixture was incubated at 95 °C for 10 min to release the DNA from the probes. The second round of hybridization was performed using the same probes and hybridization conditions. The captured fragments containing microsatellites were again amplified with the SNX-F as a primer to generate doublestranded DNA using the PCR conditions described above. Amplified enriched DNA was cleaned with purification columns (Qiagen). The enriched fragments were inserted in pGEM-T Vector (Promega, USA) and transformed into competent cells (Escherichia coli DH10B) which were plated onto LauriaBertani agar (LB; Difco) supplemented with 50 μg mL−1 ampicillin. Plasmids from recombinant colonies were prepared with the standard alkaline lysis procedure and amplified using primers (M13-F: 5′-GGAAACAGCTAT GACCATG-3′ and M13-R: 5′-GTAAAACGACGCCAGT G-3′). Sequencing was performed on an automated sequencer 3730 (Applied Biosystems, USA) at the Beijing Institute of Genomics, CAS.

J Appl Phycol

Primer design and practicability test

Table 1 The 13 Saccharina (Laminaria) gametophyte clones used in this study

Microsatellites, which more than 20 nucleotides long, were identified from the obtained sequences using SSRIT software (www.gramene.org/db/searches/ssrtool). The parameters were set for detection of dimer, trimer, tetramer, and pentamer motifs with a minimum of 10, 7, 5, and 4 repeats, respectively. Redundant sequences were identified by clustering the sequences using the CAP3 program (Huang and Madan 1999). Primers were designed to be 18–22 bp long from conserved flanking sequences with an annealing temperature between 45 and 65 °C and to give an expected product size of 150–350 bp using Primer Premier software (v.5.0). Oligonucleotides were custom synthesized at Invitrogen, Shanghai, China. All designed primer pairs were initially tested for amplification using three DNA samples of Saccharina cultivation varieties: “Rongfu” (S. japonica×Saccharina latissima), “Fujian” population (S. japonica) and “Pingbancai” (S. japonica). These three cultivation varieties are all widely cultured in China. PCR amplifications were performed with the mixture containing 1× buffer, 250 μM dNTPs, 200 μM of each primer, 30–50 ng template DNA, 1.5 mM MgCl2, and 0.5 U Taq DNA polymerase in 20-μL reaction volumes using a GeneAmp thermocycler 9700 with gradient temperature control. The thermal program was as follows: 5 min at 94 °C, then 35 cycles of 50 s at 94 °C, a 45-s gradient from 45 to 65 °C and 45 s at 72 °C, finishing with 10 min at 72 °C. PCR products were separated by electrophoresis in 3 % agarose gels and stained with ethidium bromide. They were then used to test which primer pairs yielded clear bands, to optimize the annealing temperature and to determine the PCR cycle number.

Number

Material ID

Origin

Species name

1 2 3 4

L.o2-3 (♀) L.o1-3 (♂) L.o2-2 (♀) L.o1-1 (♂)

Japan, 1981 Japan, 1981 Japan, 1981 Japan, 1981

Saccharina ochotensis Saccharina ochotensis Saccharina ochotensis Saccharina ochotensis

5 6 7 8 9 10 11 12 13

L.o2-6 (♀) L.j1-1 (♀) L.j1-2 (♀) L.a2-1 (♀) L.a2-3 (♀) L.r1-3 (♂) L.h1-4 (♂) L.d (♂) L.s1-8 (♂)

Japan, 1981 Japan, 1981 Japan, 1981 Japan, 1981 Japan, 1981 Japan, 1981 Germany, 1982 Germany, 1982 Germany, 1982

Saccharina ochotensis Saccharina japonica Saccharina japonica Saccharina angustata Saccharina angustata Saccharina religiosa Laminaria hyperborea Laminaria digitata Saccharina latissima

1991). Molecular size of the amplifications was estimated using 20-bp DNA ladder (Takara). SSR products which were amplified using each primer pair were scored based on the SSR pattern with the reported method (Sun et al. 2006). Genetic similarity and genetic diversity were calculated by POPGENE v.1.31 (Yeh et al. 1999), and cluster analysis was performed on the similarity matrix employing the UPGMA (Unweighted Pair Group Method with Arithmetic Mean). Using TFPGA (Tools for Population Genetic Analyses, v.1.3) software, bootstrap values of phylogenetic tree branches were calculated.

Results Genetic diversity in Saccharina (Laminaria) gametophyte clones A total of 13 Saccharina (Laminaria) gametophyte clones which are widely used in breeding and economic cultivation in China were used to evaluate genetic diversity with the selected SSR primers in this study. Of those, five gametophyte clones [L.o2-3 (♀), L.o1-3 (♂), L.o2-2 (♀), L.o1-1 (♂) and L.o2-6 (♀)] were from S. ochotensis, two [L.j1-1 (♀) and L.j12 (♀)] were from S. japonica, two [L.a2-1 (♀) and L.a2-3 (♀)] were from Saccharina angustata, one [L.r1-3 (♂)] was from S. religiosa, one [L.h1-4 (♂)] was from Laminaria hyperborea, one [L.d (♂)] was from L. digitata, and one [L.s1-8 (♂)] was from S. latissima (Table 1). PCR amplifications were carried out using the SSR reaction conditions described above. The amplified products were separated by 6 % polyacrylamide gel electrophoresis (PAGE), and then visualized by a silver-staining method (Bassam et al.

Microsatellites from enriched genomic library The majority of DNA fragments generated by ultrasonication were concentrated by size ranging from 500 to 1,000 bp, which was a desired length distribution for constructing the microsatellite-enriched genomic library. Then, a library enriched for AG/TC, AC/TG containing short genomic DNA fragments was constructed. A total of 2,853 recombinant colonies were picked up randomly and sequenced. Of these, 1,092 of the high-quality reads (Phred20 quality; >99 % accuracy) were shown to contain at least one microsatellite motif and the enrichment efficiency was 38.3 % (1,092 repeats out of 2,853 sequenced colonies). The extent of redundancy within these colonies was tested using a cut-off level of 75 % homology over 50 nucleotides. Sequences assembling results revealed that 593 unique sequences harbored microsatellite repeats, which accounted for 54.3 % (593 sequences out of 1,092).

J Appl Phycol

Among the 1,131 microsatellite loci within 593 sequences, three types of microsatellites were detected according to Weber (1990): perfect (59 %, type I), imperfect (8 %, type II), and compound (33 %, type III) (Table 2). The isolated microsatellites could be grouped into six categories: mononucleotide (mono-), dinucleotide (di-), trinucleotide (tri-), tetranucleotide (tetra-), pentanucleotide (penta-) and hexanucleotide (hexa-). Di- and tri-nucleotides together represented 85.78 % of the isolated microsatellites. Poly (AC)n sequences (45.9 %) were the most abundant, followed by (AG)n (27.2 %). Despite the use of (AC)n and (AT)n probes in the enrichment, other motifs were also present in the library. However, the number of microsatellites involved in these cases were fewer (26.9 %). The distribution of microsatellite classes in this study is presented in Table 3. Characterization of microsatellite markers and evaluation Because some microsatellites were either located too close to the flanking region or their base composition of the flanking sequence was unsuitable, only part of the searched microsatellites were suitable for primer design. A set of 266 PCR primer pairs was designed, of which the flanking region met the primer designing criteria.

Table 3 Distribution of SSR repeat type and motif for all the microsatellites from enriched libraries of S. japonica Type

Numbera

Percent (%)b

Motif

Numberc

Percent (%)d

Di-

846

74.74

Tri-

125

11.04

Tetra-

71

6.27

CA/TG GA/TC AT/TA GC/CG AGC/CAG/GCA CTG/GCT/TGC AAC/CAA/ACA Others GTAC

520 308 12 6 44 34 18 29 18

45.9 27.2 1.0 0.5 3.9 3.0 1.6 2.6 1.6

TGTC TCTG Others GACGG ACGAA Others CAACAC CATACA Others

8 7 38 8 3 41 6 2 30 1,131

0.7 0.6 3.4 0.7 0.3 3.6 0.5 0.2 2.7 100

Penta-

52

4.59

Hexa-

38

3.36

Total

1,131

100

a

Table 2 Typical representatives of different types of microsatellites (perfect, imperfect, compound) Clone name

Type

Sequences

CAGCTGCTGCTGCGGTCGACGATTCTCN GGCCTTGTCTAGCAGAAGCGGTTGGC TAGGTATGATATGTTACTTGCN GCGGTGAGAGAGAGAGAGAGAGAG AGAGAGAGAGAGAGAGAGAGAGAG AGAGAGAAAGAGAGAGAGAG AGACCCGTTCACAGCAGTGTCGCGGT ACAGTACAGGAGACCTAG SSR044 Imperfect ACAAACCGAGCGTCAGATCGAGCACAAA GGAATCGCGACGAAATGTCGCCATCT CGAGAGCGAGCCCGTCAGGCCTGCAA CAGGCCCCTTTAACCCGAGAGAGAGA GAGAGAGAGAGAGAGAGCTA GGGAGAGAGAGAGAGAGAGAGAGA GAGAGAGAGAGAGAGAGAGAGAGA GAGAGAGAGAGAGATCGTCAGACC GCCTGGCAGCGCATTTTCAGGCGGTG GGAGGAGCAGTCG SSR238 Compound ACGCATCTCGTGGAACGCCCGGAAAGCT GCGTGCGTCCATGAGTCGTCCACCAC TCGATCCTTAGGATAGTCAGTAGCTTCC TCCGCTACTCCCCCTCCTCCTCCTCCT GCTGCTGCTGCTCCGCTGCGTGGTGG GCGGTTGGGATCCACCTCCACCTGGC TGCTGCTGCTGCTACCAAGTCCGCGT CGCCCCCACGC

Number of each SSR repeat type from 1,131 microsatellites

b

Percentage of each SSR repeat type accounting for 1,131 microsatellites

c

Number of each SSR repeat motif from 1,131 microsatellites

d

Percentage of each SSR repeat motif accounting for 1,131 microsatellites

SSR003 Perfect

Core sequences shown in bold

Among the 266 PCR primer pairs tested in three Saccharina accessions, 179 successfully amplified the target region, gave clear banding patterns, and accounted for 67.3 %. Other primers showed no amplification, multiple bands, or stutter bands, and were excluded from further study. Of the screened 179 SSR primer pairs, 103 pairs were dinucleotide repeat type, 56 were trinucleotides repeat type, 7 were tetranucleotides repeat type, 8 were pentanucleotides repeat type, and 5 were hexanucleotides repeat type (Table 4). The results indicated that primers of trinucleotides repeat type were with the highest development efficiency (81.2 %). Genetic diversity analysis Of the 179 primer pairs tested, a unique banding pattern was found for all 13 Saccharina (Laminaria) lines with the combination of 23 representative polymorphic SSR markers, and their sequences have been deposited in GenBank (http://www. ncbi.nlm.nih.gov/) with accession numbers JF957338– JF957360. Figure 1 shows the amplification results of two primer pairs. The results indicated that SSR055 successfully amplified among S. ochotensis, S. japonica, L. hyperborea, L.

J Appl Phycol Table 4 Number of microsatellite primer pairs by repeat-unit type Type

Number of selected SSR primersa

Number of designed SSR primersb

Percent (%)c

DiTriTetraPenta-

103 56 7 8

167 69 9 12

61.7 81.2 77.8 66.7

HexaTotal

5 179

9 266

55.5 67.3

a

The SSR primers number of each repeat type which successfully amplified the target region tested in three Saccharina accessions among the designed 266 PCR primers

b The SSR primers number of each repeat type designed, of which the flanking region met the primer designing criteria among the 1,131 searched microsatellites c

Number of selected SSR primers/number of designed SSR primers

digitata, and S. latissima, but failed with S. angustata and S. religiosa. Seventy-two alleles were detected with the 23 SSR markers, and the number of alleles per locus (NA) ranged from 2 to 6 with an average of 3.13. Subsequently, the availability of these obtained SSR primer pairs was assessed for genetic diversity study. The Nei’s (1973) gene diversity (H) of the 23 markers was calculated using POPGENE, which was between 0.1420 and 0.7222, with an average of 0.4279. The detailed information of the 23 polymorphic markers is shown in Table 5. The genetic similarity coefficients among the 13 accessions amplified using 23 SSR markers ranged from 0.4653 to 0.9901 (Table 6). The high value occurred in accessions within the same species that generated almost identical fingerprints across the markers studied. Among the

Fig. 1 SSR patterns of the 13 Saccharina (Laminaria) lines amplified by SSR primer SSR052 (up) and SSR055 (down). Numbers 1–13 at the top of the figure indicate the Saccharina (Laminaria) lines: L.o2-3 (♀), L.o1-3 (♂), L.o2-2 (♀), L.o1-1 (♂), L.o2-6 (♀), L.j1-1 (♀), L.j12 (♀), L.a2-1 (♀), L.a2-3 (♀), L.r1-3 (♂), L.h1-4 (♂), L.d (♂), L.s1-8 (♂), respectively

accessions, L. hyperborea, L. digitata, and S. latissima showed low similarity value with the other ten accessions. A total of 72 amplified alleles were used for cluster analysis of the 13 Saccharina (Laminaria) lines using the UPGMA method. In the developed dendrogram (Fig. 2), the 13 Saccharina (Laminaria) lines were divided into two major groups. The first group contained 10 Saccharina lines [L.o2-3 (♀), L.o2-6 (♀), L.o1-1 (♂), L.o1-3 (♂), L.o2-2 (♀), L.a2-3 (♀), L.r1-3 (♂), L.j1-1 (♀), L.j1-2 (♀), and L.a2-1 (♀)], while the second group contained the other 3 lines [L.d (♂), L.h1-4 (♂), L.s1-8 (♂)], which were divided into two subgroups. Subgroup 1 contained one line from L. digitata and one line from L. hyperborea. Subgroup 2 contained only one line from S. latissima. Ten lines of the first group were all derived from Japan and three lines of the second group were all derived from Germany. This result was basically in agreement with traditional classifications.

Discussion SSR markers have expanded so quickly that they have now become the most widely used molecular marker system for genetic analysis (Rungis et al. 2004). Saccharina (Laminaria), with great economic and ecological value, has been considered as the model organism for genetic research of seaweeds (Waaland et al. 2004). Therefore, S. japonica was chosen to be the object of this study, with an enriched genomic library and a large amount of microsatellite markers, paving the way for algal genetics. The major disadvantage of SSR markers is their strong species-specificity, therefore SSR markers need to be developed de novo for species being examined at the beginning stage (Squirrell et al. 2003). Previously, there were two

J Appl Phycol Table 5 Information of the developed 23 EST-SSR primers Clone name

SSR motif

Forward primer (5′–3′)

Reverse primer (5′–3′)

Tm (°C)a

Predicted size (bp)

NAb

Hc

SSR002 SSR032 SSR035 SSR038

(CT)12 (GCA)5 (ACA)5 (CTG)7

GCAGGGTCGACGATTCCA CGTGGAAGGGTGATGGTG TAGGACTGGGAATCAGGACAG CACCAAAAGTTGTTGTAGCTC

CGAGGCAGAGGCAGGTGT TTGTTGTGCCCGCTGTTT ATACACAGAGGCAAAACGAATC ATGTCTCCCGACATGAAAA

56 56 50 54

263 231 210 206

3 3 2 4

0.4298 0.2722 0.3750 0.6600

SSR052 SSR053 SSR094 SSR135 SSR144 SSR155 SSR158 SSR163 SSR165 SSR169 SSR176 SSR187 SSR195 SSR218 SSR227 SSR229 SSR238 SSR261

(CAG)6 (TG)7 (TC)5 (AC)9 (GT)9 (TG)7 (TGC)5 (TG)7 (GT)5 (CG)5 (TG)6 (CA)6 (CTG)6 (CTG)5 (TGC)5 (TC)16 (CCT)5 (GA)23

TTTGAGGCTTCAACGCTAT GAGACAGGCGTTGGCGTAG CGGGCACATGGACTCTTAT GACGGGTAGAAAGGAAGG GTGTAGTCTATCTATGCGTGTC AGACAGGCGTTGGCGTAG CACTGAGCTTTACATGGGA AGACAGGCGTTGGCGTAG GTGCGTACAGGAAGAGCG CGGCAAGGTTTGCTCATT TGTAGATTTGAGTATCGTGGGT AGCGACAGCGACAGGAAC CGCAGGAGCACCAGAAGT CGCACCGACAAATCAAAC GGTTCCGTTTCTTTCTTCT CTTCCCAAACTGCCTCTA ACGCATCTCGTGGAACGC AGATGGAAGAAGACCTCG

TTGTGAATGCTTCCTCCTG GGAACATGATGATGCAGGGA ACGGTGTTCGGCATCTTT ATCATCGGCGTACAGCAT CATTAGTGAGCCCATGTCT GAGCGAACATCAAACCATTAC TTATCGTCGGGTGCTACT GAGCGAACATCAAACCATTAC TCACTTCAGGGTCATTTCAC AACGCCTCCAACGCTACT TTTCATTGTTGCGTTTCG GAAGCGGTCAGGCAGGTA TGCCGTGAATGTCAGCAC GCAAAGGCACGAGAAGGA CATCCTCCACAGTTAGCAC CCAAAGTTGTGGATACGG AGCCGCAACAAGGACAGC ACATGAACCAAACCTACAGT

50 56 54 53 51 54 54 54 50 53 51 53 54 50 50 50 51 56

166 223 188 328 311 302 350 171 186 346 341 157 288 289 273 175 230 226

3 2 2 2 3 2 2 3 3 4 3 2 4 3 2 5 3 6

0.5444 0.4734 0.1420 0.1653 0.4615 0.1420 0.1653 0.2722 0.4615 0.6746 0.4615 0.3967 0.7222 0.3787 0.2778 0.6391 0.4615 0.7219

SSR278

(AG)23

TCCCATATTAGTGGTCAAA

TAGAAGCGTCAATCGGTA

50

350

6

0.5444

a

Optimized annealing temperature of the primer

b

Total number of alleles

c

Nei’s (1973) gene diversity

genome libraries for developing SSR markers in Saccharina (Laminaria). Ten SSR polymorphic markers of L. digitata have been isolated from digested genomic library of small inserts (Billot et al. 1999b), which are costly and timeconsuming. The enriched genomic library of S. japonica was constructed by Yuanyuan Shi using the FIASCO method (Shi et al. 2007). The enrichment procedures such as enrichment by hybridization to oligonucleotide bound to a nylon membrane (Karagyozov et al. 1993), by hybridized to a biotinylated oligonucleotde (Kandpal et al. 1994), or by the FIASCO method (Zane et al. 2002) are faster and more costeffective. However, genomic DNA was restricted with enzyme during traditional enrichment procedures. In the enzyme method, the average length of fragments depends largely on genomic G+C content and endonuclease recognition sites, causing sampling bias. Due to no genome information available, ultrasonication sheared protocol was adopted for Saccharina during the process of enriched library construction in this study. Ultrasonication, as a method for mechanical breakage of genomic DNA, is an effective way for shearing

DNA. The length of DNA fragments produced by ultrasonication which could be managed by changing sonication time and power was less dependent on the genomic DNA composition, therefore it ensured the random distribution of DNA fragments (Karagyozov et al. 1993; Kandpal et al. 1994). The method has been successfully applied in Cricetulus griseus, Haliotis diversicolor (Zhan et al. 2009), and Ochotona curzoniae (Li et al. 2009; Geng et al. 2010). The independence of species and the original microsatellite frequency in the genome would make this ultrasonication sheared protocol suitable for microsatellite library construction in a large variety of taxa. In this study, the microsatellite library for S. japonica was constructed with this protocol within 1 week and the unique high-quality sequences containing microsatellites were up to 54.3 % (593 sequences out of 1,092), which fully demonstrated its feasibility, rapidity, and effectiveness. This is the first report on the large-scale development of microsatellites by this method in Saccharina or Laminaria. Alternatively, we used two rounds of capture to get enough DNA fragments for the double-stranded DNA

J Appl Phycol Table 6 Nei's genetic identity (above diagonal) and genetic distance (below diagonal) Number

1

2

3

4

5

6

7

8

9

10

11

12

13

1 2 3 4 5 6 7 8 9 10 11 12 13

– 0.0404 0.0612 0.0200 0.0100 0.3247 0.2331 0.3385 0.0933 0.2844 0.4562 0.5208 0.5721

0.9604 – 0.0612 0.0404 0.0302 0.3524 0.2844 0.3666 0.1153 0.2844 0.5208 0.5898 0.6078

0.9406 0.9406 – 0.0404 0.0718 0.3524 0.2844 0.3666 0.1378 0.3111 0.4880 0.5547 0.5721

0.9802 0.9604 0.9604 – 0.0302 0.3524 0.2584 0.3385 0.1153 0.2844 0.4880 0.5547 0.6078

0.9901 0.9703 0.9307 0.9703 – 0.3111 0.2457 0.3524 0.0825 0.2976 0.4720 0.5376 0.5898

0.7228 0.7030 0.7030 0.7030 0.7327 – 0.2084 0.5547 0.2584 0.4562 0.4255 0.4880 0.5042

0.7921 0.7525 0.7525 0.7723 0.7822 0.8119 – 0.4720 0.2713 0.3524 0.4104 0.4720 0.4880

0.7129 0.6931 0.6931 0.7129 0.7030 0.5743 0.6238 – 0.2713 0.3524 0.6448 0.7650 0.7439

0.9109 0.8911 0.8713 0.8911 0.9208 0.7723 0.7624 0.7624 – 0.2457 0.4720 0.5376 0.5898

0.7525 0.7525 0.7327 0.7525 0.7426 0.6337 0.7030 0.7030 0.7822 – 0.6078 0.6078 0.7031

0.6337 0.5941 0.6139 0.6139 0.6238 0.6535 0.6634 0.5248 0.6238 0.5446 – 0.0825 0.1378

0.5941 0.5545 0.5743 0.5743 0.5842 0.6139 0.6238 0.4653 0.5842 0.5446 0.9208 – 0.1843

0.5644 0.5446 0.5644 0.5446 0.5545 0.6040 0.6139 0.4752 0.5545 0.4950 0.8713 0.8317 –

recovery. It could help, to a larger extent, the capture ability and elevating the proportion of microsatellite-containing sequences. By SSR analysis in several species genomes, dinucleotide repeat types especially (AC)n, (AT)n, and (AG)n motifs accounted for the majority (Toth et al. 2000). In this study, mixed probes of (CA)12 and (CT)12 were used to screen SSRs in the genome of S. japonica. Recently, more and more researchers have used mixed probes to select SSR markers in order to increase screening efficiency. But the efficiency of microsatellite enrichment was still quite low (38.3 %), showing that repeat motifs of (CA)n and (CT)n are not widely distributed along the genome of S. japonica. Wang et al. (2011) searched microsatellite sites against 4,099 EST sequences and found that, among different repeat types, trinucleotide repeat type accounted for 43.7 % as the most

Fig. 2 Dendrogram of the 13 Saccharina (Laminaria) lines based on 23 representative polymorphic SSR markers developed in this study by the UPGMA method

abundant type, demonstrating its advantage in distribution in the transcriptome of S. japonica. However, the microsatellite distribution of Saccharina genome is not clear, and there is no foundation for probe selection for enriched library construction. With the sequencing of the Saccharina genome and the elucidation of microsatellite motifs characteristics, it will facilitate the selection of probes and will increase the efficiency of the enrichment library. Primer design is the key step of SSR marker development, which has a pre-requirement for nucleotide sequences. Once SSR markers are established in some species, they can be used in any time, any place, by any person. By practicability tests, among 266 primer pairs, 179 pairs have been successfully amplified and could be used in linkage map construction, germplasm identification, and breeding in the future. Although some microsatellites isolated in this study did not

J Appl Phycol

show any application or polymorphism in the test DNA accessions, these 266 microsatellite markers had a higher level of transferability in relatively closely related species. Their transferability was characterized and showed that 87 pairs of SSR primers successfully amplified in Sargassum (S. thunbergii, S. horneri, S. fusiforme), Kappaphycus alvarezii, and Undaria pinnatifida, indicating potential in future research on marker transferability. Referring to SSR markers of algae, some research has shown good transferability of SSR primers among species within the same genus, even between different families (Enrique et al. 2005). These microsatellites may also be potentially useful in the other economically important algae. In addition, 23 pairs of core primers were selected from 179 pairs and could effectively differentiate all 13 accessions in this study. Nei’s (1973) gene diversity (H) is an important parameter using the designed SSR markers. In the 13 examined Saccharina (Laminaria) lines, the H value of the detected loci ranged in a quite broad region, from 0.1420 to 0.7222. These results indicated that the 13 examined Saccharina (Laminaria) lines could be discriminated by the 23 developed SSRs markers. The phylogenetic relationships were in accordance with their geographic distribution but inconsistent with the previous study on morphological characteristics. The species in the two clades detected in our study involved two kinds: L. hyperborea, L. digitata, and S. latissima were from Germany found along the coast of the Atlantic Ocean, while all the species in the other clade were from Japan along the coast of the Pacific Ocean. L. hyperborea and L. digitata are endowed with digitate blades, while S. latissima and all the species in the other clade have simple blades, which might result from long-term geographical and reproductive isolation of the two different groups. The clustering result showed the great potential of these SSR markers for genetic study. In addition, the amplification of SSR 055 indicated that it might be valuable in Saccharina (Laminaria) gametophyte clone identification and determination of genetic relationships within crossbreeding offspring. In conclusion, the microsatellite-enriched library protocol of this paper has been well documented as a preferable strategy for isolating microsatellites. These novel polymorphic microsatellites developed in this study were candidate codominant markers with enough polymorphism to study the population genetics and were potential for the molecular breeding of Saccharina (Laminaria). Based on the data we report in this manuscript, we will continue to use this microsatelliteenriched library as a resource for developing more useful microsatellite markers. Acknowledgement This work was supported by the Fund projects of national agricultural transformation (2010GB23600666).

References Bassam BJ, Caetano-Anolles G, Gresshoff PM (1991) Fast and sensitive silver staining of DNA in polyacrylamide gels. Anal Biochem 196: 80–83 Bi YH, Hu YJ, Zhou ZG (2011) Genetic variation of Laminaria japonica (Phaeophyta) populations in China as revealed by RAPD markers. Acta Oceanol Sin 30:103–112 Billot C, Boury S, Benet H, Kloareg B (1999a) Development of RAPD markers for parentage analysis in Laminaria digitata. Bot Mar 42: 307–314 Billot C, Rousvoal S, Estoup A, Epplen JT, Saumitou-Laprade P, Valero M, Kloareg B (1999b) Isolation and characterization of microsatellite markers in nuclear genome of the brown alga Laminaria digitata (Phaeophyceae). Mol Ecol 7:1778–1780 Bronw J, Hardwick LJ, Wright AF (1995) A simple method for rapid isolation of microsatellites from yeast artificial chromosomes. Mol Cell Probes 9:53–57 Enrique AM, Leyla C, Cecilia F, Rodrigo UV, Claire B (2005) Microsatellites of Laminaria digitata tested in Lessonia nigrescens: Evaluation and improvement of cross amplification between kelps of two different families. J Appl Phycol 17(3):245–253 Fang TC, Wu CY, Jiang BY, Li JJ, Ren KJ (1962) The breeding of a new breed of haidai (Laminaria japonica) and its preliminary genetic analysis (in Chinese with English abstract). Acta Bot Sin 10:197–209 Geng JN, Li KX, Zhang YM, Hu SN (2010) A modified enrichment method to construct microsatellite library from plateau pika genome (Ochotona curzoniae). Genomics Proteomics Bioinform 8:72–76 Guillemaut P, Drouard LM (1992) Isolation of plant DNA: A fast, inexpensive, and reliable method. Plant Mol Bio Rep 10:60–65 Hamilton MB, Pincus EL, Di Fiore A, Flesher RC (1999) Universal linker and ligation procedures for construction of genomic DNA libraries enriched for microsatellites. Biotechniques 27:500–507 Huang X, Madan A (1999) CAP3: A DNA Sequence Assembly Program. Genome Res 9:868–877 Jensen A (1993) Present and future needs for algae and algal products. Hydrobiologia 269:15–23 Kain JM (1979) A view on the genus Laminaria. Oceanogr Mar Biol Annu Rev 17:101–161 Kandpal RP, Kandpal G, Weissman SM (1994) Construction of libraries enriched for sequence repeats and jumping clones, and hybridization selection for region-specific markers. Proc Natl Acad Sci USA 91: 88–92 Karagyozov L, Kalcheva LD, Chapman VM (1993) Construction of random small-insert genomic libraries highly enriched for simple sequence repeats. Nucleic Acids Res 21:3911–3912 Li YH, Yang YX, Liu JD, Wang XL, Gao TX, Duan D (2007) Genetic mapping of Laminaria japonica and L. longissima using amplified fragment length polymorphism markers in a “two-way pseudotestcross” strategy. J Integr Plant Biol 49:392–400 Li XJ, Liu JL, Cong YZ, Qu SC, Zhang ZZ, Dai H, Luo S, Han X, Huang S, Wang Q, Liang G, Sun J, Wang D, Yang G (2008) Breeding and trial cultivation of Dongfang No. 3, a hybrid of Laminaria gametophyte clones with a more than intraspecific but less than interspecific relationship. Aquaculture 280:76–80 Li KX, Geng JN, Yang J, Zhang YM, Hu SN (2009) Isolation and characterization of 13 microsatellite loci in the plateau pika (Ochotona curzoniae). Conserv Genet 10:785–787 Liu FL, Shao ZR, Zhang HN, Liu JD, Wang XL, Duan DL (2010a) QTL mapping for frond length and width in Laminaria japonica Aresch (Laminarales, Phaeophyta) using AFLP and SSR markers. Mar Biotechnol 12:386–394 Liu FL, Wang XL, Yao JT, Fu WD, Duan DL (2010b) Development of expressed sequence tag-derived microsatellite markers for Saccharina (Laminaria) japonica. J Appl Phycol 22:109–111

J Appl Phycol Liu FL, Yao JT, Wang XL, Hu ZM, Duan DL (2011) Identification of SCAR marker linking to longer frond length of Saccharina japonica (Laminariales, Phaeophyta) using bulked-segregant analysis. J Appl Phycol 23:709–713 Liu FL, Wang FJ, Duan DL (2012) EST-SSR markers derived from Laminaria digitata and its transferable application in Saccharina japonica. J Appl Phycol 24:501–505 Powell W, Machray GC, Provan J (1996) Polymorphism revealed by simple sequence repeats. Trends Plant Sci 1:215–222 Rungis D, Berube Y, Zhang J, Ralph S, Ritland CE, Ellis BE, Douglas C, Bohlmann J, Ritland K (2004) Robust simple sequence repeat markers for spruce (Picea spp.) from expressed sequence tags. Theor Appl Genet 109:1283–1294 Shan TF, Pang SJ, Zhang YR, Yakovleva IM, Skriptsova AV (2011) An AFLP-based survey of genetic diversity and relationships of major farmed cultivars and geographically isolated wild populations of Saccharina japonica (Phaeophyta) along the northwest coasts of the Pacific. J Appl Phycol 23:35–45 Shi YY, Yang GP, Liu YJ, Liao MJ, Li XJ, Cong YZ (2007) Development of 18 polymorphic microsatellite DNA markers of Laminaria japonica (Phaeophyceae). Mol Ecol Notes 7:620–622 Squirrell J, Hollingsworth PM, Woodhead M, Russell J, Lowe AJ, Gibby M, Powell W (2003) How much effort is required to isolate nuclear microsatellites from plants? Mol Ecol 12:1339–1348 Sun JW, Liu T, Guo BT, Jin DM, Weng ML, Feng YB, Xu P, Duan DL, Wang B (2006) Development of SSR primers from EST sequences and their application in germplasm identification of Porphyra lines (Rhodophyta). Eur J Phycol 41:329–336 Tautz D (1989) Hypervariability of simple sequences as a general source for polymorphic DNA markers. Nucleic Acids Res 17:6463–6471 Toth G, Gaspari Z, Jurka J (2000) Microsatellites indifferent eukaryotic genomes: survey and analysis. Genome Res 10:967–981 Waaland JR, Stiller JW, Cheney DP (2004) Macroalgal candidates for genomics. J Phycol 40:26–33 Wang XL, Yang YX, Cong YZ, Duan DL (2004) DNA fingerprinting of selected Laminaria (Phaeophta) gametophytes by RAPD markers. Aquaculture 238:143–153

Wang XL, Liu CL, Li XJ, Cong YZ, Duan DL (2005) Assessment of genetic diversities of selected Laminaria (Laminarales, Phaeophta) gametophytes by inter-simple sequence repeat analysis. J Integr Plant Biol 47:753–758 Wang GL, Tan XL, Shen JL, Li J, Zhang L, Sun JW, Wang B, Weng ML, Liu T (2011) Development of EST-SSR primers and their practicability test for Laminaria. Acta Oceanol Sin 30:112–117 Weber JL (1990) Informativeness of human (dC-dA)n. (dG.dT)n polymorphisms. Genomics 7:524–530 Xia P, Wang XL, Li XJ, Zhao YS, Yao L, Duan DL (2005) Genetic study of kelp “901” strain. Chin J Oceanol Limnol 23(2):152–157 Yang GP, Sun Y, Shin YY, Zhang LA, Guo SS, Li BJ, Li XJ, Li ZL, Cong YZ, Zhao YS, Wang WQ (2009) Construction and characterization of a tentative amplified fragment length polymorphism-simple sequence repeat linkage map of Laminaria (Laminariales, Phaeophyta). J Phycol 45:873–878 Yeh FC, Yang RC, Boyle T (1999) POPGENE, version 1.31. Microsoft window-based freeware for population genetic analysis. Quick userguide (FrancisYeh, University of Alberta, Canada).www.ualberta. ca/-fyeh Yotsukura N, Kawai T, Motomura T, Ichimura T (2001) Random amplified polymorphic DNA markers for three Japanese Laminaria species. Fisheries Sci 67:857–862 Zane L, Bargelloni L, Patarnello T (2002) Strategies for microsatellite isolation: a review. Mol Ecol 11:1–16 Zhan X, Hu HY, Ke CH, Hu SN, Wang DX, Chen F (2009) Isolation and characterization of eleven microsatellite loci in small abalone, Haliotis diversicolor Reeve. Conserv Genet 10:1185–1187 Zhang QS, Tang XX, Cong YZ, Qu SC, Luo SJ, Yang GP (2007) Breeding of an elite Laminaria variety 90-1 through inter-specific gametophyte crossing. J Appl Phycol 19:303–311 Zhang J, Liu Y, Yu D, Song HZ, Cui JJ, Liu T (2011) Study on hightemperature-resistant and high-yield Laminaria variety “Rongfu”. J Appl Phycol 23:165–171