DEVELOPMENT OF A MULTIPLEX PCR ASSAY FOR THE ... - SIPaV

030_JPP286SC_495

25-06-2009

12:54

Pagina 495

Journal of Plant Pathology (2009), 91 (2), 495-497

Edizioni ETS Pisa, 2009

495

SHORT COMMUNICATION DEVELOPMENT OF A MULTIPLEX PCR ASSAY FOR THE SIMULTANEOUS DETECTION OF CLAVIBACTER MICHIGANENSIS subsp. MICHIGANENSIS, PSEUDOMONAS SYRINGAE pv. TOMATO AND XANTHOMONAS AXONOPODIS pv. VESICATORIA USING PURE CULTURES Z. Özdemir Adnan Menderes University, Faculty of Agriculture, Department of Plant Protection, 09100 Aydın, Turkey

SUMMARY

A multiplex PCR assay for the simultaneous detection of three bacterial seed-borne pathogens of tomato was developed. Published primers: (i) CMM-5-CMM-6 for Clavibacter michiganensis pv. michiganensis; (ii) primer 1primer 2 for Pseudomonas syringae pv. tomato; (iii) RST2RST3 for Xanthomonas axonopodis pv. vesicatoria, were used in the assay. Annealing temperatures were determined by gradient PCR individually for each pathogen and primer concentration ratios were investigated. Sensitivity assays were carried out and compared with single PCR. Temperature of 59±1°C was optimal for annealing. Optimal primer concentrations were determined as 0.36 µMol l-1 for C. m. michiganensis, 0.30 µMol l-1 for X. a. vesicatoria, and 0.12 µMol l-1 for P. s. tomato. Sensitivity assays showed that 3 CFU in 50 µl sterile distilled water, derived from pure cultures of C. m. michiganensis, P. s. tomato and X. a. vesicatoria could reliably be detected by multiplex PCR when applied to pure cultures. The detection limit was determined to be ca. 10 times lower than that of single PCR. Multiplex PCR provided less labor and rapid results for the detection of bacterial pathogens of tomato, but the sensitivity of detection was reduced. Thus, the sensitivity of this technique should be assayed prior to its use in place of single PCR. Key words: Clavibacter michiganensis subsp. michiganensis, Pseudomonas syringae pv. tomato, Xanthomonas axonopodis pv. vesicatoria, tomato, detection, multiplex PCR. Clavibacter michiganensis subsp. michiganensis, Pseudomonas syringae pv. tomato and Xanthomonas axonopodis pv. vesicatoria are important bacterial pathogens of tomato and cause economic losses worldwide. PCR methods and primers have been developed for each pathogen (Bereswill et al., 1994; Dreier et al., 1994; Leite et al., 1995). Coronatine toxin-producing Corresponding author: Z. Özdemir Fax: +90.256.7727233 E-mail: [email protected]

strains of P. syringae pv. tomato were identified with a 650 bp PCR product, along with other coronatine- producing pathovars of Pseudomonas syringae (Bereswill et al., 1994). Xanthomonas axonopodis pv. vesicatoria, the agent bacterial spot of tomato and pepper, was amplified by three different PCR primer pairs targeted to the hrp gene cluster of the genus Xanthomonas. One of these primer pairs, RST2-RST3 was designed on the hrpB region of Xanthomonas axonopodis pv. vesicatoria strain 75-3 and amplified a 840 bp product (Leite et al., 1994). Specific detection of virulent strains of Clavibacter michiganensis subsp. michiganensis that causes bacterial canker of tomato, was possible, using CMM-5 and CMM-6 primers, from plasmid-borne pat-1 gene which generated a 614 bp product specific to virulent strains (Dreier et al., 1995). The detection limit in this assay, when testing infected plants was ca. 2x102 CFU ml-1. Multiplex PCR allows the amplification of more than one target region in one PCR reaction mixture and can reduce the time and labor as compared with single PCR (Chamberlain and Chamberlain, 1994). However, the use of multiple primers on multiple templates may result in inefficient or preferential binding of some primers to their templates, while the degree of proximity of annealing temperatures of different primers can negatively affect the outcome of the assay (Elnifro et al., 2000). Nonetheless, multiplex PCR assays have already been employed for detection of a number of pathogens (Glick et al., 2002; Menzel et al., 2002; Bertolini et al., 2003; Hiroyuki and Tsuda, 2005; Özdemir, 2005a). The aim of this study was the development of a multiplex PCR assay to detect three seed-borne pathogens of tomato, C. michiganensis subsp. michiganensis, P. syringae pv. tomato and X. axonopodis pv. vesicatoria simultaneously in a single PCR tube. A preliminary report of this work has been given previously (Özdemir, 2005b), but this paper now extends the study to the partial optimization of amplification conditions from pure cultures of the pathogens. For PCR assays, C. michiganensis subsp. michiganensis ICMP 2550 [Type strain (International Collection of Micro-organisms from Plants, Auckland, New Zealand)], P. syringae pv. tomato ICMP 2844 and X. axonopodis pv. vesicatoria ICMP 9592 [75-3, group A

030_JPP286SC_495

496

25-06-2009

12:54

Pagina 496


Multiplex PCR of bacterial pathogens of tomato

strains, tomato race 1, also classified as X. euvesicatoria, Jones et al., (2004)] were routinely grown on King medium B (King et al., 1954), on yeast dextrose calcium carbonate agar [YDCA (Wilson et al., 1967)] and on nutrient broth yeast extract agar [NBYA (Vidaver, 1967)] at 24ºC. Cultures were maintained in 30% glycerol at -80ºC for long term storage. PCR primers used in this study, shown in Table 1, had the following sequences: CMM-5: GCGAATAAGCCCATATCAA (19-mer), CMM-6: CGTCAGGAGGTCGCTAATA (19-mer) (Dreier et al., 1995); primer 1: GGCGCTCCCTCGCACTT (17-mer), primer 2: GGTATTGGCGGGGGTGC (17-mer) (Bereswill et al., 1994), RST2: AGGCCCTGGAAGGTGCCCTGGA (22-mer), RST3: ATCGCACTGCGTACCGCGCGCG (22-mer) (Leite et al., 1994). Annealing temperatures were determined by gradient PCR. Reaction mixture contained 200 µMol l-1 dNTPs, 1x PCR buffer (100 mMol l-1 Tris-HCl pH 8.8, 500 mMol l-1 KCl, 0.8% Nonidet P40), 1.5 µMol l-1 magnesium chloride, 0.05 units µl-1 Taq polymerase (Fermentas, Lithuania) in 25 µl reaction volume. DNA templates were prepared from 4-day-old cultures grown on their respective agar medium, suspending half loopful from each culture in 200 µl sterile distilled water in eppendorf tubes. Tubes were boiled for 10 min in a thermomixer (Eppendorf AG, Germany) and 1.25 µl of boiled suspension was used as DNA template. Primer concentrations for each pair were 0.12 µMol l-1 (primer 1-primer 2), 0.3 µMol l-1 (RST2-RST3) and 0.36 µMol l-1 (CMM-5-CMM-6) (Genosys, Sigma-Aldrich, USA). Thermocycler conditions were determined as 30 cycles at 95ºC for 30 sec, annealing at 57ºC (in a gradient) for 30 sec, at 72ºC for 45 sec and final extension at 72ºC for 5 min. The temperature gradient was 55.2, 56.3, 57.4, 58.5, 59.5, 60.4, 61.0 and 61.4°C. PCR products were run in 2% agarose (Sigma-Aldrich, USA) gel electrophoresis in 1x TBE (Tris-borate EDTA, pH 8.3) buffer, stained with ethidium bromide and visualized under UV by a Kodak imaging system. To determine primer concentration ratios for multi-

plex PCR, the three primer pairs were grouped in pairs and several primer concentration ratios were tested. These primer groups and their concentration ratios were: (i) RST2-RST3/CMM-5-CMM-6; 4:1, 1:4, 2:4, 1:1.2; (ii) primer 1-primer 2/CMM-5-CMM-6; 1:3, 3:3, 2:4, 1:4; (iii) primer 1-primer 2/RST2-RST3; 1:2.5, 3:3, 2:4, 1:4. Each concentration was run in duplicate. Except for primer concentrations and annealing temperature, reaction mix and thermocycler conditions were the same as in gradient PCR conditions. Annealing temperature was set to 59.4°C. PCR products were run in gel electrophoresis in 3% high resolution agarose (Sigma-Aldrich, USA). Gels were run in 1x TBE (Tris-borate EDTA, pH 8.3) buffer for 130 min at 4 V/cm, stained with ethidium bromide and visualized under UV by a Kodak imaging system. For sensitivity testing of multiplex PCR assays, 4-dayold pure cultures grown at 24°C were used. Templates were prepared by boiling for 10 min in an Eppendorf thermomixer. For each bacterial culture, three colonies were suspended in 50 µl sterile distilled water and 10 to 100 fold dilutions were made. An aliquot of 1.25 µl template was used for each pathogen in a final PCR volume of 25 µl. Cycling conditions were 35 cycles at 95°C for 30 sec, 59.4°C for 30 sec and 72°C for 45 sec. Final extension was at 72°C for 5 min. The same amount of primer concentration and reaction mixture was used as in the gradient PCR. The effect of Taq polymerase and Mg+2 (1.5, 2, 2.5 and 3 mMol l-1) concentration was also tested. Under standard magnesium concentration (1.5 mMol l-1), Taq polymerase concentration was increased by 1.6-fold. All PCR experiments were repeated at least twice. Multiplex PCR requires such an annealing temperature that all templates can be amplified efficiently by their primers. A gradient PCR, with temperatures increasing from 55.2ºC to 61.4ºC was applied to each template of C. m. michiganensis, P. s. tomato and X. a. vesicatoria. A common annealing temperature for all templates was determined as 59±1ºC. In parallel to determination of the annealing temperature, for homogenous amplification of templates, primer concentration ratios of three primer pairs were tested as paired group by PCR. Based on the

Table 1. Primers used for PCR assays. Primers CMM-5CMM-6

Pathogen Clavibacter michiganensis subsp. michiganensis

Target gene pat-1

Fragment length 614 bp

Tm 55°C

References Dreier et al. (1995)

primer 1primer 2

Pseudomonas syringae pv. tomato

cfl

650 bp

67°C

Bereswill et al. (1994)

840 bp

62°C

Leite et al. (1994)

RST2-RST3

Xanthomonas campestris pv. vesicatoria

hrp

030_JPP286SC_495

25-06-2009

12:54

Pagina 497


results obtained, it was possible to choose the ratio of 1 (0.12 µMol l-1):2.5 (0.3 µMol l-1):3 (0.36 µMol l-1) for primer 1-primer 2, RST2-RST3 and CMM-5-CMM-6, respectively. After optimization of annealing temperature and primer concentration ratios, the sensitivity threshold of multiplex and single PCR was compared using pure cultures of the pathogens. In both single and multiplex PCR, each template was detected reliably for all three pathogenic bacteria at 3 CFU in 50 µl sterile distilled water. However, lower yields by a 10 factor were obtained in multiplex than in single PCR. In multiplex PCR, increasing Taq polymerase enzyme concentration 1.6 fold did not have any effect on amplification sensitivity. In addition, increasing the amount of Mg+2 concentration from 1.5 to 3 mMol l-1 did not increase amplification sensitivity. Previously, Özdemir (2005a) had studied simultaneous detection of C. m. subsp. michiganensis and X. a. pv. vesicatoria by multiplex PCR without performing sensitivity assays. Johnson and Walcott (2005) and Fessehaie and Walcott (2005) have shown the detection of Pepino mosaic virus and C. m. subsp. michiganensis by real-time PCR and Acidovorax avenea subsp. citrulli and Didymella bryoniae by multiplex real-time PCR. In this study, to prepare DNA templates, bacterial colonies were boiled as previously reported (Schaad et al., 1995) and no PCR inhibition was obtained during multiplex and single PCR assays. Further research would be desirable to develop a reliable DNA extraction method of bacterial template from seeds and a sensitive detection method of the three pathogens in the seeds using real-time PCR. ACKNOWLEDGEMENTS

Work supported by Adnan Menderes University research fund (ZRF 04015) and The Scientific and Technological Research Council of Turkey (TUBITAK) (TOGTAG 3505). REFERENCES Bereswill S., Bugert P., Volksch B., Ullrich M., Bender C.L., Geider K., 1994.Identification and relatedness of coronatine-producing Pseudomonas syringae pathovars by PCR analysis and sequence determination of the amplification products. Applied and Environmental Microbiology 60: 2924-2930. Bertolini E., Olmos A., López M.M., Cambra M., 2003. Multiplex nested reverse transcription–polymerase chain reaction in a single tube for sensitive and simultaneous detection of four RNA viruses and Pseudomonas savastanoi pv. savastanoi in olive trees. Phytopathology 93: 286-292. Chamberlain J.S., Chamberlain J.R., 1994. Optimization of multiplex PCRs. In: Mullis K.B., Ferré F., Gibbs R.A. Received June 11, 2008 Accepted February 18, 2009

Z. Özdemir

497

(eds). The Polymerase Chain Reaction, pp. 38-46. Birkhäuser, Boston, MS, USA. Dreier J., Bermpohl A., Eichenlaub R., 1995. Southern hybridization and PCR for specific detection of phytopathogenic Clavibacter michiganensis subsp. michiganensis. Phytopathology 85: 462-468. Elnifro E.M., Ashshi A.M., Cooper R.J., Klapper P.E., 2000. Multiplex PCR: optimization and application in diagnostic virology. Clinical Microbiology Reviews 13: 550-570. Fessehaie A., Walcott R., 2005. Simultaneous detection of Acidovorax avenae subsp. citrulli and Didymella bryoniae using multiplex real-time PCR. Phytopathology 95, S29. Glick D.L., Coffey C.M., Sulzinski M.A., (2002) Simultaneous PCR detection of the two major bacterial pathogens of geranium. Journal of Phytopathology 150: 54-59. Hiroyuki U., Tsuda S., 2005. A one-step reverse transcriptionpolymerase chain reaction system for the simultaneous detection and identification of multiple tospovirus infections. Phytopathology 95: 166-171. Johnson K., Walcott R., 2005. A real-time PCR assay for the simultaneous detection of Pepino mosaic virus and Clavibacter michiganensis subsp. michiganensis. Phytopathology 95: S50. Jones J.B., Lacy G.H., Bouzar H., Stall R.E., Schaad N.W., 2004. Reclassification of the xanthomonads associated with bacterial spot disease of tomato and pepper. Systematic and Applied Microbiology. 27: 755-762. King E.O., Ward M.K., Raney D.E., 1954. Two simple media for the demonstration of pyocyanin and fluorescein. Journal of Laboratory and Clinical Medicine 44: 301-307. Leite R.P.Jr., Minsavage G.V., Bonas U., Stall R.E., 1994. Detection and identification of phytopathogenic Xanthomonas strains by amplification of DNA sequences related to the hrp genes of Xanthomonas campestris pv. vesicatoria. Applied and Environmental Microbiology 60: 1068-1077. Menzel W., Jelkman W., Maiss E., 2002. Detection of four apple viruses by multiplex RT-PCR assays with coamplification of plant mRNA as internal control. Journal of Virological Methods 99: 81-92. Özdemir Z., 2005a. Development of a multiplex PCR assay for concurrent detection of Clavibacter michiganensis ssp. michiganensis and Xanthomonas axonopodis pv. vesicatoria. Plant Pathology Journal 4 : 133-137. Özdemir Z., 2005b. A multiplex PCR assay for detection of Clavibacter michiganensis subsp. michiganensis, Pseudomonas syringae pv. tomato and Xanthomonas axonopodis pv. vesicatoria. American Phytopathological Society, Northeastern Division Meeting, Geneva 2005: 44. Schaad N.W., Cheong S.S., Tamaki S., Hatziloukas E., Panapoulos N.J., 1995. A combined biological and enzymatic amplification (BIO-PCR) technique to detect Pseudomonas syringae pv. phaseolicola in bean seed extracts. Phytopathology 85: 243-248. Vidaver A.K., 1967. Synthetic and complex media for rapid detection of fluorescence of phytopathogenic pseudomonads: effect of the carbon source. Applied Microbiology 15: 1523-1524. Wilson E.E., Zeitoun F.M., Frederickson D.L., 1967. Bacterial phloem canker, a new disease of Persian walnut trees. Phytopathology 57: 618-621.

030_JPP286SC_495

25-06-2009

12:54

Pagina 498