Agricultural Sciences in China
October 2011
2011, 10(10): 1624-1629
Development of a Multiplex PCR for Diagnosis of Staphylococcus aureus, Escherichia coli and Bacillus cereus from Cows with Endometritis SUN Dong-bo, WU Rui, HE Xian-jing, WANG Shuang, LIN Yun-cheng, HAN Xu, WANG Yue-qiang, GUO Ting-ting, WU Guo-jun and YANG Ke-li College of Animal Science and Veterinary Medicine, Heilongjiang Bayi Agricultural University, Daqing 163319, P.R.China
Abstract Staphylococcus aureus, Escherichia coli and Bacillus cereus are the major agents of cow endometritis in dairy cows. A multiplex PCR (SEB-mPCR) was established based on the conserved genes of S. aureus, E. coli and B. cereus, and the detection limits were 103, 102 and 103 CFU mL-1, respectively. SEB-mPCR could not amplify genomic DNA of pathogenic bacteria of other common bovine diseases. A total of 309 vaginal discharge samples from cows with endometritis were tested by SEB-mPCR. Of the samples, 23.95% had the three kinds of bacteria detected, 17.15% had S. aureu and E. coli, 9.39% had E. coli and B. cereus, and 9.71% had S. aureus and B. cereus. The rates of infections with S. aureus, E. coli and B. cereus were 11.35, 16.18 and 9.06%, respectively. Therefore, SEB-mPCR has a potential as a diagnosis tool for endometritis in dairy cows. Key words: bovine endometritis, multiplex PCR, S. aureus, E. coli, B. cereus
INTRODUCTION Reproductive performance is the major determinant of dairy production management (Del Vecchio et al. 1992; Dubuc et al. 2010). Diagnosis and treatment of postpartum uterine disease, and its potential impact on reproductive performance have traditionally been attracted considerable attention from veterinarians and producers (Liu et al. 1993; Du et al. 2010; Mallick and Prakash 2011). Endometritis of dairy cattle, a localized inflammation of the uterine lining, is a frequently-occurring disease of post-puerperal cow caused by single infections and coinfections with bacteria, virus, fungus, mycoplasma, and so on (Griffin et al. 1974; Coleman et al. 1985; Dubuc et al. 2011). The disease as a risk factor for cystic ovarian disease, anoestrus and other repro-
ductive disorder, is characterized by impact of dairy production performance and causes serious economic loss (Ruder et al. 1981; Bicalho et al. 2010). LeBlance et al. (2002) reported that endometritis prolongs average calving-to-first insemination and calving-to-conception intervals, and reduces the first service pregnancy rate after calving in dairy cows. The effect of endometritis on reproductive performance in dairy cow is different among varied regions or countries because of differences in general managemant, environment and herd health control conditions (Martinez and Thibier 1984; Grohn et al. 1990; Markusfeld and Ezra 1993). At present, dairy industry is one of the most important industries in China. The incidence of endometritis (2050%) is higher than that of other countries and regions (16.9-22.4%) due to feeding conditions and secondary infections of pathogens (Coleman et al. 1985; Xu et al.
Received 24 August, 2010 Accepted 2 March, 2011 SUN Dong-bo, Ph D, E-mail:
[email protected]; Correspondence WU Rui, Professor, Tel: +86-459-6819191, Fax: +86-459-6819191, E-mail: fuhewu@126. com © 2011, CAAS. All rights reserved. Published by Elsevier Ltd. doi:10.1016/S1671-2927(11)60160-0
Development of a Multiplex PCR for Diagnosis of Staphylococcus aureus, Escherichia coli and Bacillus cereus from Cows
2008). So, early diagnosis and timely treatment after diagnosis is essential for symptom alleviation and restoration of endometritis. Pathogenic factors of endometritis are very complicated. Most studies suggested that pathogenic bacteria play an important role in the process of occurrence and deterioration of endometritis (Adney et al. 1989; Li et al. 2011). In these pathogens, Staphylococcus aureus, Escherichia coli and Bacillus cereus are the most common pathogenic bacteria (Xu et al. 1998). At present, the diagnostic methods of endometritis of dairy cattle are mainly relied on clinical symptoms, pathogens isolation, sulfur amino acid test method, silver nitrate test, blood test, and enzyme activity test, and so on. Although these diagnostic methods are being used as an effective means to confirm endometritis, they are time-consuming, low sensitive and complicated. Thus, all these methods are not suitable to be a candidate for early diagnosis of cow endometritis in practice. In contrast, multiplex polymerse chains reaction (mPCR) is faster, sensitive and cheaper (Xiao et al. 2007; Maataoui et al. 2011). In particular, it needs less sample preparation than those reported diagnosis methods for endometritis. The advantage of mPCR is that it combines sensitivity and rapidity of PCR, and avoids to test clinical specimens separately for each pathogen (Cao et al. 2005; Giammarioli et al. 2008). In this study, the multiplex PCR was developed and evaluated for simultaneous detection of the genomic DNA from cow endometritis which was caused by S. aureu, E. coli and B. cereus.
MATERIALS AND METHODS Bacterial strains The three pathogenic reference strains shown in Table 1 were collected from the American Type Culture Collection (Manassas, VA, USA) (ATCC). The 7 field pathogenic isolates from cattle, B. cereus, S. aureu, E. coli, Pasteurella, Enterococcus faecalis, Streptococcus, and Listeria, were identified by conventional culture and biochemical tests. The cultures were stocked in Clinical Veterinary Laboratory, College of Animal Science and Veterinary Medicine, Heilongjiang Bayi Agricultural University, China.
1625
Table 1 Reference strains used in this study Reference strains
GenBank accession no.
B. cereus S. aureus E. coli
ATCC 14579 ATCC 25923 ATCC 35218
Sources of field specimens Cases of cow endometritis were identified by typical clinical symptoms and sulfur amino acid diagnostic method. Furthermore, pathogenic bacteria of the cow endometritis cases were isolated and identified according to the conventional culture and biochemical tests. Pathogenicity of isolates from the cow endometritis cases was evaluated with experimental infection of BALB/c mice. According to the above methods, a total of 309 vaginal discharge specimens were collected in endometritis cow. These samples of the vaginal discharge were diluted with 1:10 in phosphate buffered saline (PBS, pH 7.4), and then the diluted samples were aliquoted and freezed in a refrigerator at -20°C.
DNA extraction Genomic DNA from reference strains and field isolates was extracted using a DNeasy Tissue Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol.
Primers of the SEB-mPCR Three specific pairs of oligonucleotide primers were designed using oligo 6.0 software based on nucleotide sequences of S. aureus 16S rRNA gene (GenBank accession no. U39769), E. coli 16S rRNA gene (GenBank accession no. V00331) and B. cereus hblA gene (GenBank accession no. L20441). All these primers were synthesized at Shanghai Sangon Biological Engineering Technology & Services Co. Ltd. (Shanghai, China). The sequences of the primers are shown in Table 2.
Reaction conditions of SEB-mPCR The concentration of reagents, annealing temperature and thermal cycling were optimized. The 25-μL PCR mixtures contained 1 μL (1 ng) diluted genomic DNA template (each strain), 1.5 mmol L-1 MgCl2, 20 mmol
© 2011, CAAS. All rights reserved. Published by Elsevier Ltd.
1626
SUN Dong-bo et al.
Table 2 Primer pairs designed to amplify each target genes Species S. aureus E. coli B. cereus
Primer sequence (5´
3´)
Target gene
S16S-F: TCTTCAGAAGATGCGGAATA S16S-R: TAAGTCAAACGTTAACATACG E16S-F: ATCAACCGAGATTCCCCCAGT E16S-R: TCACTATCGGTCAGTCAGGAG hblA-F: GCTAATGTAGTTTCACCTGTAGCAAC hblA-R: AATCATGCCACTGCGTGGACATATAA
L-1 Tris-HCl (pH 8.4), 50 mmol L-1 KCl, 0.2 mmol L-1 each dexoxynucleoside triphosphate (dNTP) (TaKaRa, Dalian, China), 0.5 μmol L-1 each primer, 0.5 U of Tag DNA polymerase (TaKaRa, Dalian, China) and ddH2O to make up final volume. Then PCR reactions were carried out in a thermocycler. The amplification conditions were 5 min of denaturation at 95°C, followed by 35 cycles of 95°C for 1 min, 50°C for 50 s, and 72°C for 1 min, and a final extension step of 72°C for 10 min. 5 μL of SEB-mPCR product was visualized by electrophoresis on 1% agarose gel.
Cloning and sequencing of PCR products In order to further determine the validity of SEB-mPCR products, three amplified products from 16S rRNA gene of S. aureus, 16S rRNA gene of E. coli and hblA gene of B. cereus were purified by QIAquick® Gel Extration Kit (Qiagen, Hilden, Germany). The purified products were cloned into the vector pMD-18T (TaKaRa, Dalian, China) and the recombinant plasmids were sequenced with dideoxy method at Shanghai Sangon Biological Engineering Technology & Services Co., Ltd. (Shanghai, China).
Specificity test To evaluate the specificity of SEB-mPCR, the field isolates, B. cereus, S. aureus or E. coli used as positive controls, were detected with SEB-mPCR. At the same time, the field isolates, Pasteurella, E. faecalis, Streptococcus or Listeria were used as negative controls. All reaction conditions of PCR were carrried out according to foregoing protocol. PCR products were analyzed by electrophoresis on 1% agarose gel.
Sensitivity test The three reference strains, B. cereus, S. aureus and
Amplification size (bp)
16S rRNA
418
16S rRNA
231
hblA
874
E. coli were cultured according to the recommended methods. The fresh cultures of each strain were dilluted from 10 -1 to 10-10 in phosphate buffered saline (PBS, pH 7.4). Then colony forming units (CFU) of fresh cultures of three reference strains were measured using conventional methods. Genomic DNA of diluted bacteria from 10-5 to 10-10 for each strain was extracted using a DNeasy Tissue Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. The extracted genomic DNA as template was tested according to the procedure of SEB-mPCR. Products of SEBmPCR were analyzed by electrophoresis on 1% agarose gel. The minimum concentrations (CFU mL-1) for the detection of S. aureus, E. coli and B. cereus were calculated based on the results of SEB-mPCR.
Detection of field samples In order to evaluate the feasibility of the SEB-mPCR method, a total of 309 vaginal discharge samples from endometritis cow were collected at 13 cattle farms of Heilongjiang Province, Northeast China. Genomic DNA of each sample was extracted and detected using the SEB-mPCR according to the procedure described earlier. Single infection rate and coinfection rate of the three pathogens were calculated based on the results of the SEB-mPCR. The positive samples were further identified by bacterium isolation.
RESULTS Sepecificity of the SEB-mPCR In specific experiments, the field isolates, B. cereus, S. aureus and E. coli, showed positive amplification, and the sizes of amplified products were 874, 418 and 231 bp, respectively. For field isolates of Pasteurella, E. faecalis, Streptococcus, and Listeria, no amplificon
© 2011, CAAS. All rights reserved. Published by Elsevier Ltd.
Development of a Multiplex PCR for Diagnosis of Staphylococcus aureus, Escherichia coli and Bacillus cereus from Cows
was demonstrated in results of the SEB-mPCR (Fig. 1).
In order to evaluate the sensitivity of SEB-mPCR, the genomic DNA from these diluted bacteria of each strain was tested according to the procedure of the SEBmPCR. The detection limits of the SEB-mPCR for S. aureus, E. coli and B. cereus were 103, 102 and 103 CFU mL-1, respectively (Fig. 2).
1627
Application and field validation of the SEB-mPCR In clinical experiments, 309 samples of the vaginal discharge from endometritis cow were tested using the SEB-mPCR. As the Table 3 shows, S. aureus, E. coli and B. cereus infections were 11.35, 16.18 and 9.06%, respectively. Coinfections with S. aureu and E. coli, E. coli and B. cereus, and S. aureus and B. cereus were 17.15, 9.39 and 9.71%, respectively. Coinfections with the three bacteria were 23.95%. 10 samples (3.23%) showed non-specific amplification for any of S. aureus, E. coli or B. cereus. The further results of bacterium isolation were consistent with the results of the SEBPCR.
DISCUSSION
Fig. 1 Sepecificity of the SEB-mPCR. M, DL2000 DNA marker (TaKaRa, Dalian, China). 1, amplification products of B. cereus hblA gene; 2, amplification products of S. aureus 16S rRNA gene; 3, amplification products of E. coli 16S rRNA gene; 4-6, amplification products of mixed genomic DNA with B. cereus, S. aureus and E. coli; 7, amplification products of Pasteurella genomic DNA; 8, amplification products of E. faecalis genomic DNA; 9, amplification products of Streptococcus genomic DNA; 10, amplification products of Listeria genomic DNA.
Fig. 2 Sensitivity of the SEB-mPCR. M, DL2000 DNA marker (TaKaRa, Dalian, China). 1, amplification products of mixed genomic DNA of 10-5 dilution bacteria with B. cereus, S. aureus and E. coli; 2, amplification products of mixed genomic DNA of 10-6 dilution bacteria with B. cereus, S. aureus and E. coli; 3, amplification products of mixed genomic DNA of 10 -7 dilution bacteria with B. cereus, S. aureus and E. coli; 4, amplification products of mixed genomic DNA of 10-8 dilution bacteria with B. cereus, S. aureus and E. coli; 5, amplification products of mixed genomic DNA of 10-9 dilution bacteria with B. cereus, S. aureus and E. coli; 6, amplification products of mixed genomic DNA of 10-10 dilution bacteria with B. cereus, S. aureus and E. coli.
In northeast China, cow endometritis is a common and high incidence disease due to cold climate and improper management. Epidemiology survey indicates that cow endometritis incidence could reach 20-50%, and 6095% of the cow infertility caused by endometritis (Ruder et al. 1981; Xu et al. 2008; Cheong et al. 2011). Early etiology diagnosis is essential and can provide a theoretical basis for effective treatment of the cow endometritis. In multi-PCR different nucleotide fragments are simultaneously amplified by the specific primers in the same PCR reaction system (Suksai et al. 2010; Kao et al. 2010; Taniuchi et al. 2011). Thus, it is suitable to detect coinfections cases caused by a variety of pathogenic microorganisms. Multi-PCR has many advantages. It could not only be used to simultaneously detect various pathogens, but also is equal sensitive and specific to conventional PCR. What’s more, it is timesaving and cheaper. In this study, a multiplex PCR (SEB-mPCR) was established for the rapid diagnosis of S. aureus, E. coli and B. cereus causing cow endometritis. In the primer design, the conserved gene 16S rRNA gene was chosen as the specific amplification fragment of S. aureus (GenBank accession no. U39769) and E. coli (GenBank accession no. V00331). Similarly, the conserved gene hblA was chosen as the amplification fragment of B. cereus. In order to facilitate the determination of the multiplex PCR results, the amplified fragments were designed to be of different length. To evaluate the specificity of SEB-mPCR, the © 2011, CAAS. All rights reserved. Published by Elsevier Ltd.
1628
SUN Dong-bo et al.
Table 3 The detection of clinical samples by SEB-mPCR Farms A B C D E F G H I J K L M Total Percentage (%)
Sample number 31 12 37 29 16 24 25 18 26 38 11 25 17 309
B1) 4 1 2 3 2 1 2 2 2 5 2 2 0 28 9.06
S2) 5 2 3 4 1 3 2 0 4 7 0 3 1 35 11.35
E 3) 6 1 5 3 2 4 5 3 5 8 1 5 2 50 16.18
B&S4)
B&E5)
2 2 5 2 0 2 2 1 2 5 3 4 0 30 9.71
E&S6)
3 1 4 4 4 1 2 0 4 2 0 1 3 29 9.39
8 1 8 2 2 5 5 7 5 1 2 2 5 53 17.15
B&S&E7) 2 4 8 10 4 7 7 5 3 9 3 6 6 74 23.95
Negative 1 0 2 1 1 1 0 0 1 1 0 2 0 10 3.23
Single infection with B. cereus. Single infection with S. aureus. 3) Single infection with E. coli. 4) Coinfections with B. cereus and S. aureus. 5) Coinfections with B. cereus and E. coli. 6) Coinfections with E. coli and S. aureus. 7) Coinfections with B. cereus, S. aureus, and E. coli. 1)
2)
field isolates of B. cereus, S. aureus, E. coli, Pasteurella, E. faecalis, Streptococcus, and Listeria were detected with the SEB-mPCR. Pasteurella, E. faecalis, Streptococcus, and Listeria showed negative amplification, while B. cereus, S. aureus and E. coli showed positive amplification. In sensitivity assay, the detection limits of SEB-mPCR for B. cereus, S. aureus and E. coli were 103, 102 and 103 CFU mL-1, respectively. The results demonstrated that SEB-mPCR showed a higher degree of sensitivity than traditional method, just as the conventional PCR. For any diagnostic method, the ultimate goal is clinical application. To evaluate the feasibility of the SEBmPCR, a total of 309 vaginal discharge samples from cow with endometritis were collected from 13 cattle farms in Heilongjiang Province, Northeast China, and were detected using the SEB-mPCR method. Results indicated single infections and coinfections with B. cereus, S. aureus and E. coli were 96.77% (299/ 309), and other pathogenic microorganisms infections were 3.23% (10/309). These data suggested that B. cereus, S. aureus and E. coli might play a major role in cow endometritis infection in Heilongjiang Province of northeast China. This SEB-mPCR study reported here is a simple assay method and have a potential as a rapid, sensitive and cost-effective etiological diagnostic tool for B. cereus, S. aureus and E. coli causing cow endometritis.
Acknowledgements This work was supported by a grant from the Startup Foundation for Doctors of Heilongjiang Bayi Agricultural University, China (B2009-4).
References Adney S, McChesney A E. 1989. Effect of Actinomyces pyogenes and gram-negative anaerobic bacteria on the development of bovine pyometra. Theriogenology, 31, 979-989. Bicalho R C, Machado V S, Bicalho M L, Gilbert R O, Teixeira A G, Caixeta L S, Pereira R V. 2010. Molecular and epidemiological characterization of bovine intrauterine Escherichia coli. Journal of Dairy Science, 93, 5818-5830. Cao S, Chen H, Zhao J, Lv J, Xiao S, Jin M, Guo A, Wu B, He Q. 2005. Detection of porcine circovirus type 2, porcine parvovirus and porcine pseudorabies virus from pigs with postweaning multisystemic wasting syndrome by multiplex PCR. Veterinary Research Communications, 29, 263-269. Cheong S H, Nydam D V, Galvão K N, Crosier B M, Gilbert R O. 2011. Cow-level and herd-level risk factors for subclinical endometritis in lactating Holstein cows. Journal of Dairy Science, 94, 762-770. Coleman D A, Thayne W V, Dailey R A. 1985. Factors affecting reproductive performance of dairy cows. Journal of Dairy Science, 68, 1793-1803. Del Vecchio R P, Matsast D J, Inzanat T J, Sponenbergt D P, Lewis G S. 1992. Effect of intrauterine bacterial infusions and subsequent endometritis on prostaglandin F2α metabolite concentrations in postpartum beef cows. Journal of Animal
© 2011, CAAS. All rights reserved. Published by Elsevier Ltd.
Development of a Multiplex PCR for Diagnosis of Staphylococcus aureus, Escherichia coli and Bacillus cereus from Cows
Science, 70, 3158-3162. Du J L, Qin J H, Chu J S, Xu L N, Ma Y Z. 2010. Effects of Yimu Shenghuasan on cytochrome P450 of endometrial cells and immune function in dairy cows. Scientia Agricultura Sinica, 43, 1248-1254. (in Chinese) Dubuc J, Duffield T F, Leslie K E, Walton J S, LeBlanc S J. 2010. Risk factors for postpartum uterine diseases in dairy cows. Journal of Dairy Science, 93, 5764-5771. Dubuc J, Duffield T F, Leslie K E, Walton J S, Leblanc S J. 2011. Effects of postpartum uterine diseases on milk production and culling in dairy cows. Journal of Dairy Science, 94, 13391346. Giammarioli M, Pellegrini C, Casciari C, de Mia G M. 2008. Development of a novel hot-start multiplex PCR for simultaneous detection of classical swine fever virus, African swine fever virus, porcine circovirus type 2, porcine reproductive and respiratory syndrome virus and porcine parvovirus. Veterinary Research Communications, 32, 255262. Griffin J F, Hartigan T P, Nunn W R. 1974. Nonspecific uterine infection and bovine fertility. I. Infection patterns and endometritis during the first seven weeks post-partum. Theriogenology, 3, 91-106. Grohn Y T, Erb H N, McCulloch C E, Saloniemi H S. 1990. Epidemiology of reproductive disorders in dairy cattle: associations among host characteristics, disease and production. Preventive Veterinary, 8, 25-39. Kao C C, Liu M F, Lin C F, Huang Y C, Liu P Y, Chang C W, Shi Z Y. 2010. Antimicrobial susceptibility and multiplex PCR screening of AmpC genes from isolates of Enterobacter cloacae, Citrobacter freundii, and Serratia marcescens. Journal of Microbiology, Immunology and Infection, 43, 180187. LeBlanc S J, Duffield T F, Leslie K E, Bateman K G, Keefe G P, Walton J S, Johnson W H. 2002. The effect of treatment of clinical Endometritis on reproductive performance in dairy cows. Journal of Dairy Science, 85, 2237-2249. Li L, Yang H J, Liu D C, He H B, Wang C F, Zhong J F, Gao Y D. 2011. Biofilm formation and analysis of associated genes involved in Staphylococcus isolates from bovine mastitis. Scientia Agricultura Sinica, 44, 160-166. (in Chinese) Liu X C, Wang Y Y, Zhang G W, Wang J L, Wang J X. 1993. Study on the diagnosis of clinical pathology to endometritis
1629
in dairy cows. Scientia Agricultura Sinica, 26, 7-13. (in Chinese) Maataoui N, Bidet P, Doit C, de Lauzanne A, Lorrot M, MarianiKurkdjian P, Faye A, Bingen E. 2011. A multiplex polymerase chain reaction method for rapid pneumococcal serotype determination in childhood empyema. Diagnostic Microbiology and Infectious Disease, 69, 245-249. Mallick S, Prakash B S. 2011. Effects of supplementation of Tinospora cordifolia to crossbred cows peripartum. Animal Reproduction Science, 123, 5-13. Markusfeld O, Ezra E. 1993. Body measurements, metritis, and postpartum performance of first lactation cows. Journal of Dairy Science, 76, 3771-3777. Martine J, Thibier M. 1984. Reproductive disorders in dairy cattle. II. Interrelationships between pre- or post-service infectious and functional disorders. Theriogenology, 21, 583590. Ruder C A, Sasser R G, Williams R J, Ely J K, Bull R C, Butler J E. 1981. Uterine infection in the postpartum cow. II. Possible synergistic effect of Fusobacterium necrophom and Corynebacterium pyogenes. Theriogenology, 66, 573-580. Suksai P, Sangkachai N, Chatsiriwech J, Kanthasaewee O, Sariya L, Chaichoun K. 2010. Development of multiplex polymerase chain reaction for detection of feline hemotropic mycoplasma in blood and tissue specimens. Southeast Asian Journal of Tropical Medicine & Public Health, 41, 1447-1453. Taniuchi M, Verweij J J, Noor Z, Sobuz S U, Lieshout L, Petri W A Jr, Haque R, Houpt E R. 2011. High throughput multiplex PCR and probe-based detection with Luminex beads for seven intestinal parasites. American Journal of Tropical Medicine and Hygiene, 84, 332-337. Xiao S M, Li G Q, Li W H, Zhou R Q, Yang J W. 2007. Development and application of nested PCR assay for detection of dairy cattle-derived Cyclospora sp. Agricultural Sciences in China, 6, 1511-1516. (in Chinese) Xu L M, Feng W Y, Wang Y, Wang Z M, Duan Y Y, Hou Z Z. 2008. Researchp progress of cow endometritis. Progress in Veterinary Medicine, 29, 71-74. Xu Y J, Su Q, Huang Y X. 1998. Exam ination of pathogenic bacteria of cow’s endometritis in Guangzhou. Chinese Journal of Animal and Poultry Infectious Diseases, 20, 129-131. (in Chinese) (Managing editor ZHANG Juan)
© 2011, CAAS. All rights reserved. Published by Elsevier Ltd.
