Development of a Real-Time PCR Method (Taqman ... - Springer Link

J. Ocean Univ. China (Oceanic and Coastal Sea Research) DOI 10.1007/s11802-012-1911-0 ISSN 1672-5182, 2012 11 (3): 366-374 http://www.ouc.edu.cn/xbywb/ E-mail:[email protected]

Development of a Real -Time PCR Method (Taqman) for Rapid Identification and Quantification of Prorocentrum donghaiense YUAN Jian1), 4), 5), MI Tiezhu2), 4), *, ZHEN Yu2), 4), and YU Zhigang3), 5) 1) College of Marine Life Sciences, Ocean University of China, Qingdao 266003, P. R. China 2) College of Environmental Science and Engineering, Ocean University of China, Qingdao 266100, P. R. China 3) College of Chemistry and Chemical Engineering, Ocean University of China, Qingdao 266100, P. R. China 4) Key Laboratory of Marine Environment and Ecology, Ministry of Education, Ocean University of China, Qingdao 266100, P. R. China 5) Key Laboratory of Marine Chemistry Theory and Technology, Ministry of Education, Ocean University of China, Qingdao 266100, P. R. China (Received November 14, 2011; revised February 16, 2012; accepted March 26, 2012) © Ocean University of China, Science Press and Springer-Verlag Berlin Heidelberg 2012 Abstract Prorocentrum donghaiense is a dinoflagellate that is widely distributed in the East China Sea and has become increasingly involved in Harmful Algal Blooms (HABs). Therefore, it is necessary to study this dinoflagellate to monitor HABs. In this study, 13 pairs of primers specific to P. donghaiense (within its internal transcribed spacer (ITS) regions) were designed for SYBR Green I real-time PCR. As the SYBR Green I real-time PCR could not identify P. donghaiense in a specific manner, a Taqman real-time PCR method was developed by designing a set of specific primers and a Taqman probe. A 10-fold serial dilution of recombinant plasmid containing ITS regions of P. donghaiense was prepared as standard samples and the standard curve was established. Additionally, we quantified the genomic DNA in P. donghaiense cells and utilized this DNA to prepare another 10-fold serial dilution of standard sample and accordingly set up the standard curve. The mathematic correlation between the cell number and its corresponding plasmid copy number was also established. In order to test the efficiency of the real-time PCR method, laboratory samples and P. donghaiense HAB field samples were employed for identification and quantitative analysis. As to laboratory samples, as few as 102 cells of P. donghaiense could be quantified precisely utilizing both centrifugation and filtration techniques. The quantification results from field samples by real-time PCR were highly similar to those by light microscopy. In conclusion, the real-time PCR could be applied to identify and quantify P. donghaiense in HABs. Key words

Prorocentrum donghaiense; Harmful Algal Blooms (HABs); internal transcribed spacer (ITS); recombinant plasmid; real-time PCR

1 Introduction Harmful Algal Blooms (HABs), or red tides, in the sea have become common marine disasters nowadays due to their considerable harm to marine environment, fisheries, tourism and human health (Anderson, 1989; Smayda, 1997). Although HABs are natural phenomena and have frequently occurred in history, greater attention has been paid to them only during recent years because of their frequent disastrous impact. Prorocentrum donghaiense is a dinoflagellate belonging to Prorocentrum, Dinophyceae, Dinophyta. It is an HAB species and mainly distributed in the estuary of Yangtze River and the coastal water of Zhejiang Province * Corresponding author. Tel: 0086-532-66781940 E-mail: [email protected]

in China. The HABs of P. donghaiense always occur in spring these years (Chen et al., 2006; Zhou et al., 2006; Zhang et al., 2007). When they explode, they can cover a considerably large sea area (more than 1000 km2) and last over a month. The density of P. donghaiense can reach 3.6 × 108 cells L-1 (Lu et al., 2005). Because the HABs of P. donghaiense can lead to severe ecological and biological hazards, it is crucial to develop an accurate and rapid method for identification and quantification of this species. The traditional identification and quantification methods include light microscopy (LM) and scanning electronic microscopy (SEM). Although these two methods have been widely used, they are time-consuming and labor-tedious, and demand knowledge on microalgae morphology and taxonomy. In some cases, an inexperienced operator could be confused by morphologically similar species and tend to make mistakes in recognition. Therefore, new detection methods need to be developed. Re-

YUAN et al. / J. Ocean Univ. China (Oceanic and Coastal Sea Research) 2012 11 (3): 366-374

cently, the molecular biological methods are becoming increasingly popular. In these methods, the nucleic acids of microalgae are involved and specific primers or probes matching the sequences of target species are always designed (Sako et al., 2004; Yu et al., 2006). Compared to the traditional methods, these new methods can save time and labor considerably and the results are more reliable. The ribosomal DNA (rDNA) has been well studied in the field of environmental microbial research because of its high conservation, so different species can be distinguished by recognizing their specific rDNA (Medina et al., 2001; Marín et al., 2001). The rDNA includes many copies of a transcription unit consisting of the 18S rDNA, 5.8S rDNA (including flanking internal transcribed spacers, ITS), 28S rDNA and the external transcribed spacer (ETS) located between two adjacent units. Generally, the rDNA copies of a microalgae species are relatively constant. Therefore, they are closely correlated with the cell numbers of the species. In addition, the two ITS regions separating the 18S, 5.8S and 28S rDNA vary for different species and thus, they are good markers for discrimination of microalgae species (Connell, 2002). The Polymerase Chain Reaction (PCR) is an imperative tool in the fields of diagnostics and molecular biology. PCR is often used to identify microscopic cells whose morphological features are difficult to be distinguished mutually in microbiology. For example, it was used in the detection of pathogenic bacteria like Salmonella (Cocolin et al., 1998; Löfström et al., 2004). It was also developed for the detection of HAB species (Haley et al., 1999; Penna and Magnani, 1999, 2000). However, it is impossible for us to attain high sensitivity, specificity and reproducibility by conventional PCR, because its operation is subject to a high risk of contamination and the verification of products depends on rough analysis by electrophoresis. Besides, the products are analyzed only after the amplifications are completed, which can lead to difficulty in quantification of initial templates while the PCR process has reached a plateau. The real-time PCR can indicate the amount of the PCR products during the whole PCR process by fluorescence emitted by fluorescent dyes bound to template DNA or labeled with specific probe. It has unique advantages compared to conventional PCR, including less contamination, more accurate quantification and higher sensitivity. Therefore, it has been widely applied to the studies of gene expression (Cherry et al., 2004), pathogenic organisms (Bell and Ranford-Cartwright, 2002), cancer (Schnürch et al., 1998; Xu and Miller, 2004), immunology (Lang et al., 1997), polymorphism and gene mutations research (Walburger et al., 2001), prokaryote and virus detection (Broberg et al., 2003; Luo et al., 2004). The real-time PCR has also been developed for the detection of some HAB species such as Thalassiosira rotula (He et al., 2007), Skeletonema costatum (He et al., 2006), Gymnodinium sanguineum (He and Yu, 2009), Heterosigma akashiwo (He et al., 2008), Pfiesteria (Zhang and Lin, 2005; Bowers et al., 2000), Karenia (Casper et al., 2004), Ostreococcus (Countway and Caron, 2006) and Alexan-

367

drium (Hosoi-Tanabe and Sako, 2005; Kamikawa et al., 2007; Galluzzi et al., 2004; Dyhrman et al., 2005). All these studies have highlighted the potential of real-time PCR in the field of identification and quantification of HAB microalgae. Till now, scientists have done lots of studies in the research of P. donghaiense with molecular biological and biochemical methods, including conventional PCR amplification and cloning (Wang et al., 2005), immunofluorescence (Wang et al., 2007), FITC-conjugated lectin probe (Hou et al., 2008), PCR-DGGE (Sun et al., 2010) and PCR-RFLP (Zhang et al., 2009). However, these studies have only concerned the identification and distinction of P. donghaiense. Recently, real-time PCR has been used as a precise molecular quantification technology for quantitative analysis of P. donghaiense. Zhao (2009) reported that the Proliferating Cell Nuclear Antigen (PCNA) gene is a good potential molecular marker for evaluating the growth of P. donghaiense by analyzing the expression amount of PCNA gene in different stages during the whole growth cycle through real-time PCR. In this study, we designed a set of specific primers and a Taqman probe, and developed a real-time PCR method to identify and quantify P. donghaiense. In comparion with the SYBR Green I real-time PCR method, we verified the potential of the Taqman method. Then the cells of P. donghaiense were quantified using the standard curves established by real-time PCR with 10-fold serial dilutions of both recombinant plasmids and algal cells.

2 Materials and Methods 2.1 Cultures P. donghaiense was collected in the East China Sea. To ensure the specificity of the real-time PCR method, we chose five other species from the genus Prorocentrum and several microalgae species (Table 1), which can widely be found in the East China Sea according to the annual report on HABs distribution compiled by the State Oceanic Administration, P. R. China. Each species was cultured in f/2 or f/2-Si medium formulated with seawater, which had been filtered by 0.22 μm mixed-fiber membranes and autoclaved at 121℃ and 0.1MPa for 30 min. The cells were cultured at 20℃with a photon flux density of 75 μmol·m-2·s-1 and a 12:12-h light-dark cycle. The cells were collected when they grew to the exponential phase. 2.2 Preparation of DNA The algal cell collection method was implemented as follows: Centrifuging the cells at 7270 g for 10 min and then suspending them with 250 μL TE buffer (10 mmol L-1 Tris-HCl, pH 8.0; 1 mmol L-1 EDTA, pH 8.0). Next, 500 μL extraction buffer (3% (weight/volume) CTAB; 1% (weight/volume) sarkosyl; 20 mmol L-1 EDTA, pH 8.0; 1.4 mmol L-1 NaCl; 0.1 mmol L-1 Tris-HCl, pH 8.0; 1% (weight/volume) α-mercaptoethanol) preheated to 55℃were added into the mixture, and the suspended cells were incubated at 55℃ for 1 h with gentle inversion for

368


Table 1 The names, classes, media and sources of the algae Species

Class

Medium †

Source

Prorocentrum donghaiense

dinoflagellate

f/2-Si

East China Sea

P. minimum

dinoflagellate

f/2-Si

South China Sea

P. micans

dinoflagellate

f/2-Si

South China Sea

P. triestinum

dinoflagellate

f/2-Si

South China Sea

P. lima

dinoflagellate

f/2-Si

South China Sea

P. sigmoides

dinoflagellate

f/2-Si

South China Sea

Karenia mikimotoi

dinoflagellate

f/2-Si

South China Sea

Gymnodinium catenatum

dinoflagellate

f/2-Si

South China Sea

Scrippsiella trochoidea

dinoflagellate

f/2-Si

East China Sea

Alexandrium tamarense

dinoflagellate

f/2-Si

South China Sea

Skeletonema costatum

diatom

f/2

CCMP1332††

Thalassiosira rotula

diatom

f/2

CCMP1647

Chaetoceros socialis Heterosigma akashiwo

diatom

f/2

East China Sea

rhaphidophyte

f/2-Si

South China Sea

Notes: † f/2-Si medium is f/2 medium without Na2SiO3; ††CCMP is the national culture collection of marine phytoplankton for the USA.

20−30 times every 10 min. The suspension after incubation was cooled at 4℃ for 3 min. Then 1 mL mixture of chloroform/isoamyl alcohol (24:1, volume/volume) was added into the suspension and mixed thoroughly by gentle inversion for 20−30 times until emulsion was formed. After its centrifugation at 14240 g for 10 min at 4℃, the supernatant was pipetted into a new microtube and mixed together with cold ethanol and sodium acetate solution about 2-fold and 10% the volume of the supernatant, followed by storage at –80℃ for 1−2 h. Finally, the precipitate of DNA in the microtube was rinsed with cold 70% alcohol, dried at room temperature, dissolved in 20−40 μL TE buffer and stored at –20℃.

2.3 ITS Cloning and Sequencing The ITS (including the 5.8S rDNA) region of P. donghaiense was amplified by conventional PCR with the following primers: For 5’-GTCGTCGACGTAGGTGAACCTGCAGAAGGATCA and Rev 5’-CCTGCAGTCGACATATGCTTAAATTCAGCAGG (Zhang et al., 2004). In the PCR mixture, the concentrations of each primer, MgCl2 and each dNTP were 0.2 μmol L-1, 2 mmol L-1 and 0.4 mmol L-1, respectively. The PCR mixture also contained 1.25U of Taq DNA polymerase, 2.5 μL of Taq buffer and 18.75 μL of ddH2O for a final volume of 25 μL. The PCR procedure was as follows: 95℃ for 5 min; 35 cycles of 94℃ for 45 s, 58℃ for 45 s and 72℃ for 45 s; 72℃ for 10 min. A 1.0% agarose gel was used for electrophoresis. The amplification products were purified and ligated into the pMD 18-T vector (Takara Bio Inc., Japan). Recombinant vectors were transmitted into Escherichia coli DH5α competent cells by transformation, and the cells were screened by blue-white colony selection. Following 12 h of culturing, we selected and transplanted the white colonies into new LB media mixed with ampicillin. We extracted and purified the plasmids and began the enzymatic digestion after another 12 h of culturing the bacteria. The 20 μL digestion mixture consisted of 1 μL of EcoRI, 1 μL of HindIII, 2 μL of 10× EcoRI buffer, 2 μL of 10×

buffer R (Fermentas International Inc., Canada), 1 μL of recombinant plasmid solution and 13 μL of ddH2O and was incubated at 37℃ for 12 h. Finally, both the transformed bacteria and plasmid solutions were sent to Beijing Genomics Institute (BGI, Beijing, China) for sequencing, and the remaining plasmid solution was prepared for standard samples in real-time PCR.

2.4 Comparison Between SYBR Green I and Taqman Method The retrieved ITS sequences of P. donghaiense were compared with sequences of the other algae used in the experiment downloaded from Genbank. Based on the alignment, 13 pairs of specific P. donghaiense primers were designed and their specificities were tested by SYBR Green I real-time PCR. In each reaction, 25 μL of FastStart Universal SYBR Green Master (ROX) (Roche Ltd., Germany), 23 μL of ddH2O, 1 μL of template DNA, 0.05 μmol forward primer and 0.05 μmol reverse primer were mixed together. The reactions were run on an ABI 7500 Real Time PCR System (Applied Biosystems, USA) and the mixtures were preheated at 95℃ for 10 min, followed by 40 cycles of 95℃ for 15 s, 60℃ for 60 s and a final dissociation stage was automatically run by the equipment. Meanwhile, the new specific P. donghaiense primers and Taqman probe were also designed. The primers PDF: 5’-CCAGGCTCAGACCGTCTTC, PDR: 5’- CCACTCAGAACAAATTGGAACATACAG and probe PDP: 5’CTTGTCCTTGCTGCCAGCGTCTG were synthesized and their specificities were tested by real-time PCR with the following formula: PDF, PDR and PDP (10 μmol L-1 each), 1 μL, respectively; DNA template, 1 μL; Premix Ex Taq (Takara Bio Inc., Japan), 25 μL; ROX Reference DyeⅡ, 1 μL; ddH2O, 20 μL. The reactions were carried out on the same equipment with the following procedures: preheating at 95℃ for 30 s; 36 cycles of 95℃ for 5 s and 60℃ for 34 s. These formula and procedures were also adopted in the following establishment of standard curves


and validation.

2.5 Establishment of Standard Curves by RealTime PCR The concentration of the P. donghaiense recombinant plasmid solution was estimated by measuring the optical density at 260 nm. A series of plasmid standard samples (approximately 102−107 copies of recombinant plasmid) was prepared by 10-fold dilution of the P. donghaiense recombinant plasmid solution. Meanwhile, the genomic DNA of quantified P. donghaiense cells was extracted and a series of cell standard samples (approximately 1−105 cells) was also prepared by 10-fold dilution of the crude DNA solution. Two standard curves were established with the threshold cycle (Ct) values against the denary logarithms of the recombinant plasmid copy numbers (lgNplasmid) and cell numbers (lgNcell). The experiment with each standard sample concentration was run in triplicate. The correlative plasmid copy numbers of the cell samples were calculated from the two standard curves. Finally, a regression curve was constructed by plotting the cell numbers and the corresponding plasmid copy numbers. 2.6 Validation of the Method with Laboratory and Field Samples To test the efficiency of the method, several series of laboratory samples were prepared. The genomic DNA from 1.5 × 102, 1.5 × 103 and 1.5 × 104 cells of P. donghaiense collected by centrifugation was extracted and pipetted into microtubes, respectively. Besides, in order to investigate how acetate cellulose membranes (usually with mesh size of 0.45 μm) influence the DNA extraction efficiency and the following real-time PCR, another series of 1.5×102, 1.5×103 and 1.5× 104 cells of P. donghaiense were added into 100 mL seawater pretreated (as described above). Next, each aliquot of seawater was filtered through one piece of 0.45 μm acetate cellulose membrane. All the membrane pieces were aseptically scissored into small fragments after filtration and were transferred into microtubes, respectively. Finally, the DNA was extracted following the same protocol as described above, and all the samples were vortexed during extraction in order to separate the cells from membrane pieces. The extracted DNA was pipetted into new microtubes. Similarly, two series of 1.5 × 102, 1.5 × 103 and 1.5 ×104 P. donghaiense cells were mixed with the other algae used in the experiment (approximately 103 cells for each species). One series was collected by centrifugation, and the other was collected by filtration instead. Procedures for both samples were carried out as above and the extracted DNA was pipetted into new microtubes. The field samples were collected at station C2 (29˚30´30´Ń, 122˚37´5´É) in the East China Sea, where the HAB occurred in June 2011. The seawater from different layers at the depth of 0, 5, 10, 20 and 40 m was collected. It was filtered first through a 70 μm screen and then through a 0.45 μm cellulose acetate membrane. The

369

filtered membrane was stored at –20℃ until the experiment was completed. The following extraction procedures were identical to those mentioned above. Besides, 100 mL of seawater was also collected randomly with a plastic bottle and added to 500 μL of Lugol’s solution. The light microscopic enumeration was implemented with a 100 μL plankton counting chamber three times after condensation of the preserved seawater samples by subsidence in the laboratory. DNA solution (1 μL) from each sample was mixed with real-time PCR reagents in triplicate, and the reactions took place immediately. Only the standard curve of recombinant plasmid and the final regression curve were used in the quantification.

3 Results 3.1 Determination of ITS Sequences The ITS (including 5.8S rDNA) regions of P. donghaiense were amplified from genomic DNA with the forward (For) and reverse (Rev) primers. The P. donghaiense recombinant plasmids were confirmed by the positive results of conventional PCR verification with For and Rev primers shown by agarose gel electrophoresis (Fig.1). The 646bp P. donghaiense ITS sequence was submitted to Genbank with an issued accession number JN595869. According to the ITS sequence alignment (Fig.2), the sequences of PDF, PDR and PDP were obviously different from other algae. Thus, their specificity to P. donghaiense could be validated in real-time PCR.

Fig.1 ITS region amplification (left) and conventional PCR verification (right). M is 2000 bp DNA ladder marker (from bottom up, the size of each marker band is 2000, 1000, 750, 500, 250 and 100 bp, respectively).

3.2 Verification Results of SYBR Green I and Taqman Method After verifications of all the SYBR Green I primer pairs, the second pairs (Forward: 5’-CTTCCACTCTTTATCTTCTTACAAC; Reverse: 5’-ACAAACACACACAAGCATTCC) were proved to have the best specificities. However, they were still not able to specifically distinguish P. donghaiense because P. minimum could also be amplified and interfere with the detection and quantification of P. donghaiense accordingly (Fig.3).

370


Fig.2 The ITS sequence alignment of P. donghaiense and other algae used in this study (partially). Prorocentrum sigmoides and Chaetoceros socialis are unaligned due to the lack of their ITS sequences in NCBI. The right arrow, left arrow and black line indicate PDF, PDR and PDP, respectively.

Meanwhile, we used PDF, PDR and PDP to amplify the genomic DNA, recombinant plasmids of P. donghaiense and the genomic DNA of the other algae used in this experiment by real-time PCR. As the results in Fig.4 show, these primers and the probe were specific to P. donghaiense.

Fig.3 Verification of SYBR Green I method. 1, amplification curve of P. donghaiense; 2, amplification curve of P. minimum; 3, no template control.

3.3 Standard Curves for Recombinant Plasmids and P. donghaiense Cells The standard curves for recombinant plasmids and P. donghaiense cells were established according to the linear relationship between the threshold cycles (Ct) values and the denary logarithms of the plasmid copy numbers and cell numbers based on the real-time PCR results (Table 2). Table 2 The real-time quantitative PCR results Sample

Fig.4 Verification of Taqman method. 1, amplification curve of P. donghaiense recombinant plasmids; 2, amplification curve of P. donghaiense genomic DNA; 3, amplification curve of genomic DNA from the other 13 algae, each curve representing one species; 4, no template control.

Ct 7

Plasmid copy numbers (copies)

1.4 × 10 1.4 × 106 1.4 × 105 1.4 × 104 1.4 × 103 1.4 × 102

17.22 ± 0.36 22.00 ± 0.19 25.52 ± 0.42 28.39 ± 0.21 31.69 ± 0.08 34.47 ± 0.25

cell numbers (cells)

2.7 × 105 2.7 × 104 2.7 × 103 2.7 × 102 2.7 × 10 2.7

17.47 ± 0.20 20.56 ± 0.20 24.69 ± 0.11 27.93 ± 0.14 30.75 ± 0.13 33.10 ± 0.14

The regression equation for recombinant plasmids was y = –3.312 x + 42.072 (R2 = 0.995), in which x indicates the denary logarithm of plasmid copy number (lgNplasmid) and y the Ct value (Fig.5). The regression equation for cells ·

371


was y = –3.118 x + 35.032 (R2 = 0.990), in which x indicates the denary logarithm of cell numbers (lgNcell) and y the Ct value (Fig.6). ·

Finally, the regression curve was established according to the linear relationship between the cell numbers and its correlative plasmid copy numbers (Fig.7). The regression equation was y = 0.994 x + 2.25 (R2 = 0.990), in which x and y indicate the denary logarithms of cell number and correlative plasmid copy number, respectively. ·

Fig.5 The standard curve of P. donghaiense recombinant plasmids. lgNplasmid is the denary logarithm of plasmid copy number. Fig.7 The regression curve of P. donghaiense recombinant plasmids and cells. lgNplasmid and lgNcell are the denary logarithms of plasmid copy numbers and cell numbers respectively.

Fig.6 The standard curve of P. donghaiense cells. lgNcell is the denary logrithm of the cell number.

3.4 Validation of the Method with Laboratory and Field Samples The experiment results of laboratory samples are shown in Tables 3 and 4. Because the results of t-test for all samples were smaller than the critical value of 4.30 (P=0.05, n=3), the quantification results of the real-time PCR method could be accepted statistically. Because the field samples were collected in an area where the HAB of P. donghaiense occurred, the cell densities were extremely high (greater than 106 cells L-1) according to the enumeration by light microscopy (LM).

Table 3 Experiment results for laboratory centrifugation samples Sample P. donghaiense only

LM (cells) †

Ct value

PCR (cells) † †

t-test

2

32.96 ± 0.11

(1.28 ± 0.10) × 102

1.27

1.5 × 103

29.86 ± 0.58

(1.18 ± 0.47) × 103

0.39

4

1.70

2

0.61 0.03 0.41

1.5 × 10 1.5 × 10

P. donghaiense mixed with other algae

4

26.7 ± 0.23

(1.03 ± 0.16) × 10

2

32.93 ± 0.21 (1.31 ± 0.18) × 10 1.5 × 10 1.5 × 103 29.43 ± 0.18 (1.51 ± 0.18) × 103 4 1.5 × 10 26.2 ± 0.07 (1.45 ± 0.07) × 104 † †† Notes: cell number counted by LM; cell number calculated by the real-time PCR method. t-test: P=0.05, n=3.

Table 4 Experiment results for laboratory filtration samples Sample

LM (cells) †

P. donghaiense only

2

1.5 × 10 1.5 × 103 1.5 × 104

P. donghaiense mixed with other algae

1.5 × 102 1.5 × 103 1.5 × 104

Notes: Same to those of Table 3.

Ct value

PCR (cells) † †

t-test

33.16 ± 0.27 29.71 ± 0.14 26.29 ± 0.16

2

(1.12 ± 0.20) × 10 (1.25 ± 0.12) × 103 (1.36 ± 0.14) × 104

1.10 1.20 0.58

33.01 ± 0.25 29.39 ± 0.13 26.64 ± 0.34

(1.24 ± 0.22) × 102 (1.56 ± 0.15) × 103 (1.08 ± 0.25) × 104

0.68 0.23 0.97

372


Other microalgal species could hardly be found. The maximal and minimal densities appeared at 5 m and 40 m, respectively. The cell densities were also calculated by the former regression equation established by real-time PCR. The results were similar at each depth (Fig.8).

Fig.8 Comparison of field sample results by light microscopy (LM) and real-time PCR. The field samples were collected at station C2 (29˚30´30´Ń, 122˚37´5´É) in the East China Sea in June 2011.

4 Discussion Ever since it was reported that P. donghaiense is different from P. dentatum and they could be considered as a single species based on morphology and taxonomy (Lu et al., 2003; Lu et al., 2005), P. donghaiense has been the focus for molecular research on HABs. The cDNA library of P. donghaiense has been constructed with its EST analyzed (Zhang et al. 2006). The 5.8S rDNA and ITS regions of P. donghaiense have been cloned with their sequences analyzed (Zhang et al., 2004). There are several methods to emit fluorescence in real-time PCR technology. The SYBR Green I and Taqman probe are most common. Although SYBR Green I is simpler and more economical, the Taqman method has superior specificity compared with the former because an extra probe labeled with fluorescent dye will bind to the amplicon and emit fluorescence during hydrolysis in real-time PCR. Moreover, the probe could detect the mutation of one single nucleotide leading to the application in SNP (single nucleotide polymorphism). In this study, all the primers of the SYBR Green I method failed to detect P. donghaiense specifically and they were abandoned consequently. The set of primers and Taqman probe were eventually applied to the detection of P. donghaiense with better specificity. At present, recombinant plasmids have been used as standard samples in real-time PCR by more researchers (Galluzzi et al., 2004; Baxa et al., 2010). Because of the simplicity and convenience of extraction and stability in storage, the recombinant plasmids are more commonly applied as standard samples than genomic or mitochondrial DNA from microalgae cells. Genomic and mitochondrial DNA degrades easily after frequent freezing

and thawing, which might lead to a false result in quantifying the target genes. Concentrations of recombinant plasmids are easily calculated by measuring the optical densities even after long-time storage and frequent freezing and thawing. In this study, we applied the ITS regions of P. donghaiense to design specific primers and Taqman probe, and applied the real-time PCR method to identify and quantify P. donghaiense. We prepared two series of standard samples and established two standard curves in order to find the mathematic relationship between plasmid copy number and cell number. To balance the extraction efficiencies and accuracies of standard curves, we extracted the genomic DNA from large quantities of P. donghaiense (2.7 × 105 cells) and diluted the DNA storage solution into a 10-fold gradient solution series to serve as cell standard samples. We can enumerate the cells in unknown samples with plasmid standard samples and the independent relationship with P. donghaiense cell standard samples. This improvement will help in the preparation of standard samples. The quantification results of P. donghaiense in the samples mixed with other algae used in the experiment were similar to those only containing P. donghaiens for both centrifugation and filtration samples. The real-time PCR method was able to detect as few as 102 cells of P. donghaiense. Therefore, it could be implemented in identifying P. donghaiense HABs where the cell density is 106 cells L-1, and in natural environments where the densities are much lower. In addition, based on the comparison of the results acquired by light microscopy and real-time PCR, it was demonstrated that real-time PCR can be applied in the detection and quantification of P. donghaiense with specificity, sensitivity and repeatability. Comparing with traditional identification and quantification method, researchers are able to deal with large quantities of samples by real-time PCR in one batch (up to 96 samples simultaneously in our experiment), which takes only 2−3 h and is labor-saving. For instance, all the field samples in this study were treated only in one reaction. Although other molecular biological techniques can also be applied to the detection of microalgae, new trouble will be confronted. For instance, it is difficult to eliminate the autofluorescence of some microalgae during fluorescence in situ hybridization (FISH). The cells of some species, such as those in Heterosigma, may cluster together and disrupt the hybridization of probes to the cells. By contrast, such negative impact as brought by intact cells can be avoided in real-time PCR because the cells have been lysed. However, some procedures in the real-time PCR method still need to be improved. Firstly, the genomic DNA extraction protocols should be improved to increase the extraction efficiencies. Previous work showed that the amount of DNA was different with different extraction protocols (Foulds et al., 2001). In addition, acetate cellulose membrane could interfere with the output of DNA. Some researchers reported that they could detect microalgae directly from crude cell suspension or even a single


cell by real-time PCR methods (Hosoi-Tanabe and Sako, 2005), which could avoid loss of DNA during extraction with high sensitivity. Should the extraction efficiencies in our experiments be increased to the level for one single cell, the sensitivity would be greatly enhanced. Secondly, it is necessary to decrease any redundant dilution procedure (e.g. in standard sample preparation) because each time the plasmid solution is diluted, its concentration varies and may differ from the expected values. These unexpected concentrations can induce massive mistakes in the establishment of standard curves. Lastly, the real-time PCR operation conditions should be optimized, e.g. diluting the crude DNA solution to decrease the PCR inhibitors’ influence on the reactions, modifying the real-time PCR parameters (i.e., annealing temperature, cycle numbers and time span in each step). The results will be improved with appropriate optimizations.

Acknowledgements We sincerely thank Prof. Songhui Lv (Jinan University, Guangzhou, China) for providing the algae and thank Ms Quyuan Wang for field sample collection. We also appreciate the help from the crew of the research vessel ‘Runjiang I’. This research was supported by the National Basic Research Program of China (973 Program) (No. 2011CB403602), the National High Technology Research and Development Program of China (863 Program) (No. 2007AA09200111) and the National Marine Public Welfare Research Project (201205031-02).

References Anderson, D. M., 1989. Toxic algal blooms and red tides: a global perspective. In: Red Tides: Biology, Environmental Science and Toxicology. Okaichi, T., et al., eds., Elsevier, New York, 11-16. Baxa, D. V., Kurobe, T., Ger, K. A., Lehman, P. W., and The, S. J., 2010. Estimating the abundance of toxic Microcystis in the San Francisco Estuary using quantitative real-time PCR. Harmful Algae, 9: 342-349. Bell, A. S., and Ranford-Cartwright, L. C., 2002. Real-time quantitative PCR in parasitology. Trends in Parasitology, 18: 337-342. Bowers, H. A., Tengs, T., Jr. Glasgow, H. B., Burkholder, J. M., Rublee, P. A., and Oldach, D. W., 2000. Development of real-time PCR assays for rapid detection of Pfiesteria piscicida and related dinoflagellates. Applied and Environmental Microbiology, 66: 4641-4648. Broberg, E. K., Nygårdas, M., Salmi, A. A., and Hukkanen, V., 2003. Low copy number detection of herpes simplex virus type 1 mRNA and mouse Th1 type cytokine mRNAs by light cycler quantitative real-time PCR. Journal of Virological Methods, 112: 53-65. Casper, E. T., Paul, J. H., Smith, M. C., and Gray, M., 2004. Detection and quantification of the red tide dinoflagellate Karenia brevis by real-time nucleic acid sequence-based amplification. Applied and Environmental Microbiology, 70: 4727-4732. Chen, H. L., Lv, S. H., Zhang, C. S., and Zhu, D. D., 2006. A survey on the red tide of Prorocentrum donghaiense in East

373

China Sea 2004. Ecologic Science, 25: 226-230 (in Chinese with English abstract). Cherry, J. M., Stewart, C., Frankenberger, C., Martin, K., Tudor, G., Owens, G., Bhat, N. K., and Munroe, D. J., 2004. Automated process of Q-PCR/gene expression. Journal of the Association for Laboratory Automation, 9: 28-34. Cocolin, L., Manzano, M., Cantoni, C., and Comi, G., 1998. Use of polymerase chain reaction and restriction enzyme analysis to directly detect and identify Salmonella typhimurium in food. Journal of Applied Microbiology, 85: 673-677. Connell, L., 2002. Rapid identification of marine algae (Raphidophyceae) using three-primer PCR amplification of nuclear internal transcribed spacer (ITS) regions from fresh and archived material. Phycologia, 41: 15-21. Countway, P. D., and Caron, D. A., 2006. Abundance and distribution of Ostreococcus sp. in the San Pedro Channel, California, as revealed by quantitative PCR. Applied and Environmental Microbiology, 72: 2496-2506. Dyhrman, S. T., Erdner, D., Du, J. L., Galac, M., and Anderson, D. M., 2005. Molecular quantification of toxic Alexandrium fundyense in the gulf of maine using real-time PCR. Harmful Algae, 5: 242-250. Foulds, I. V., Granacki, A., Xiao, C., Krull, U. J., Castle, A., and Horgen, P. A., 2001. Quantification of microcystin-producing Cyanobacteria and E. coli in water by 5’-nuclease PCR. Journal of Applied Microbiology, 93: 825-834. Galluzzi, L., Penna, A., Bertozzini, E., Vila, M., Garcés, E., and Magnani, M., 2004. Development of a real-time PCR assay for rapid detection and quantification of Alexandrium minutum. (a dinoflagellate). Applied and Environmental Microbiology, 70: 1199-1206. Haley, S. T., Cavender, J. F., and Murray, T. E., 1999. Detection of Alexandrium tamarensis by rapid PCR analysis. Biotechniques, 26: 88-91. He, S. Y., Cheng, G., Gou, W. L., Li, R. X., Mi, T. Z., and Yu, Z. G., 2006. Development of a real-time PCR for rapid detection of Skeletonema costatum. High Technology Letters, 16: 313-318 (in Chinese with English abstract). He, S. Y., and Yu, Z. G., 2009. A real-time PCR method for rapid detection of Gymnodinium sanguineum. Journal of Zhejiang University, 35: 119-126. He, S. Y., Yu, Z. G., and Mi, T. Z., 2007. Development of a real-time PCR method for Thalassiosira rotula rapid detection. Acta Oceanologica Sinica, 26: 133-139. He, S. Y., Yu, Z. G., and Mi, T. Z., 2008. Development of real-time PCR method for rapid detection and quantification of Heterosigma akashiwo. Journal of Harbin Institute of Technology, 15: 118-123. Hosoi-Tanabe, S., and Sako, Y., 2005. Species-specific detection and quantification of toxic marine dinoflagellate Alexandrium tamarense and A. catenella by real-time PCR assay. Marine Biotechnology, 7: 506-514. Hou, J. J., Huang, B. Q., Hu, J., Lin, L. Z., and Hong, H. S., 2008. Fourteen FITC-conjugated lectins as a tool for the recognition and differentiation of some harmful algae in Chinese coastal waters. Journal of Applied Phycology, 20:35-46 Kamikawa, R., Nagai, S., Hosoi-Tanabe, S., Itakura, S., Yamaguchi, M., Uchida, Y., Baba, T., and Sako, Y., 2007. Application of real-time PCR assay for detection and quantification of Alexandrium tamarense and Alexandrium catenella cysts from marine sediments. Harmful Algae, 6: 413-420. Lang, R., Pfeffer, K., Wagner, H., and Heeg, K., 1997. A rapid method for semiquantitative analysis of the human Vβ-repertoire using TaqmanR PCR. Journal of Immunological

374


Methods, 203: 181-192. Löfström, C., Knutsson, R., Axelsson, C. E., and Rådström, P., 2004. Rapid and specific detection of Salmonella spp. In animal feed samples by PCR after culture enrichment. Applied and Environmental Biology, 70: 69-75. Lu, D. D., Goebel, J., Qi, Y. Z., Zou, J. Z., Han, X. T., Gao, Y. H., and Li, Y. G., 2005. Morphological and genetic study of Prorocentrum donghaiense Lu from East China Sea, and comparison with some related Prorocentrum species. Harmful Algae, 4: 493-505. Lu, D. D., Qi, Y. Z., Goebel, J., Zou, J. Z., and Gao, Y. H., 2003. Redescription of Prorocentrum donghaiense Lu and comparison with relevant Prorocentrum species. Chinese Journal of Applied Ecology, 14: 1060-1064 (in Chinese with English abstract). Luo, H., Yousef, A. E., and Wang, H. H., 2004. A real-time polymerase chain reaction based method for rapid and specific detection of spoilage Alicyclobacillus spp. in apple juice. Letters in Applied Microbiology, 39: 376-382. Marín, I., Aguilera, A., Reguera, B., and Abad, J. P., 2001. Preparation of DNA suitable for PCR amplification from fresh or fixed single dinoflagellate cells. Biotechniques, 30: 88-93. Medina, M., Collins, A. G., Silberman, J. D., and Sogin, M. L., 2001. Evaluating hypotheses of basal animal phylogeny using complete sequences of large and small subunit rRNA. Proceedings of the National Academy of Sciences of the United States of America, 98: 9707-9712. Penna, A., and Magnani, M., 1999. Identification of Alexandrium (Dinophyceae) using PCR and rDNA-targeted probes. Journal of Phycology, 35: 615-621. Penna, A., and Magnani, M., 2000. A PCR immunoassay method for the detection of Alexandrium (Dinophyceae) species. Journal of Phycology, 36: 1183-1186. Sako, Y., Hosoi-Tanabe, S., and Uchida, A., 2004. Fluorescence in situ hybridization using rRNA-targeted probes for simple and rapid identification of the toxic dinoflagellates Alexandrium tamarense and Alexandrium catenella. Journal of Phycology, 40: 598-605. Schnürch, H. G., Niederacher, D., An, H. X., Ellenberger, I., Roeyen, C. R. C. V., Cho, J. Y., and Beckmann, M. W., 1998. Multistep carcinogenesis of sporadic breast cancer. European Journal of Cancer, 34 (Suppl.): 17-17 (1). Smayda, T. J., 1997. Harmful algal blooms : their ecophysiology and general relevance to phytoplankton blooms in the sea. Limnology and Oceanography, 42: 1137-1153. Sun, J., Yu, Z. G., Zhen, Y., Zhao, T., Zhao, L. Y., Yuan, J., and Mi, T. Z., 2010. Difference analysis of 18S rDNA partial sequences of three species of Prorocentrum using PCR-DGGE. Periodical of Ocean University of China, 40 (2): 052-056. Walburger, D. K., Afonina, I. A., and Wydro, R., 2001. An improved real time PCR method for simultaneous detection of C282Y and H63D mutations in the HFE gene associated with hereditary hemochromatiosis. Mutation Research Genomics, 432: 69-78. Wang, D. Z., Huang, X. G., Chan, L. L., and Hong, H. S., 2007.

Development of an immunofluorescence technique for detecting Prorocentrum donghaiense Lu. Journal of Applied Phycology, 19: 325-332. Wang, P., Liang, J. R., Gao, Y. H., Gao, Y., Lv, S. H., Qi, Y. Z., Li, X. S., and Yu, Z. M., 2005. Identification of Prorocentrum donghaiense in genus Prorocentrum from the East China Sea based on partial LSU rDNA. Journal of Xiamen University (Natural Science), 44 (3): 437-440 (in Chinese with English abstract). Xu, M., and Miller, M. S., 2004. Determination of murine fetal Cyp lal and lbl expression by real-time fluorescence reverse transcription polymerase chain reaction. Toxicology and Applied Pharmacology, 201: 295-302. Yu, R. C., Tang, X. H., Zhang, Q. C., Chen, Y., Wang, Y. F., Yan, T., and Zou, M. J., 2006. Application of fluorescence in situ hybridization (FISH) method to detect ‘tamarense/catenella species complex’ (‘Temperate Asian’ ribotype) in genus Alexandrium along Chinese coast. Acta Scientiae Circum Stantiae, 26: 646-651 (in Chinese with English abstract). Zhang, B. Y., Wang, G. C., Zhang, Y., Han, X. T., Lv, S. H., Qi, Y. Z., Zou, J. Z., and Zeng, C. K., 2004. Cloning and sequence analysis of 5.8S and ITS region from Prorocentrum donghaiense and P. micans APBM. Oceanologia et Limnologia Sinica, 35: 264-272 (in Chinese with English abstract). Zhang, H., and Lin, S. J., 2005. Development of a cob-18S rRNA Gene Real-time PCR assay for quantifying Pfiesteria shumwayae in the natural environment. Applied and Environmental Microbiology, 71: 7053-7063. Zhang, L. Y., Yan, T., Han, G., and Zou, M. J., 2007. A shipboard study of the effects of HAB species Prorocentrum donghaiense on protozoan communities at three sites in the East China Sea, involving 72 h inoculation experiments to stimulate HAB bloom events. Acta Ecologica Sinica, 27: 1926- 1936 (in Chinese with English abstract). Zhang, T., Mi, T. Z., Lu, Q., Sun, J., Zhao, L. Y., Yuan, J., and Yu, Z. G., 2009. Distinct ion of red tide causing algae by using the PCR-RFLP technology. Periodical of Ocean University of China, 39 (Suppl.): 105-108. Zhang, X. F, Yang, G. P., Liu, Y. J., Liu, R. X., and Zhu, M. Y., 2006. Construction of the cDNA library and trial EST analysis of Prorocentrum donghaiense. Periodical of Ocean University of China, 36: 361-364 (in Chinese with English abstract). Zhao, L. Y., Mi, T. Z., Zhen, Y., Li, M. Y., He, S. Y., Sun, J., and Yu, Z. G., 2009. Cloning of proliferating cell nuclear antigen gene from the dinoflagellate Prorocentrum donghaiense and monitoring its expression profiles by real-time RT-PCR. Hydrobiologia, 627: 19-30. Zhen, Y., Mi, T. Z., and Yu, Z. G., 2009. Detection of several harmful algal species by sandwich hybridization integrated with a nuclease protection assay. Harmful Algae, 8: 651-657. Zhou, W. H., Yin, K. D., and Zhu, D. D., 2006. Phytonplankton biomass and high frequency of Prorocentrum donghaiense harmful algal blooms in Zhoushan sea area in spring. Chinese Journal of Applied Ecology, 17: 887-893 (in Chinese with English abstract). (Edited by Qiu Yantao)