Development of a Reverse Transcriptase PCR–Enzyme-Linked ...

JOURNAL OF CLINICAL MICROBIOLOGY, May 1997, p. 1251–1254 0095-1137/97/$04.0010 Copyright q 1997, American Society for Microbiology

Vol. 35, No. 5

Development of a Reverse Transcriptase PCR–Enzyme-Linked Immunosorbent Assay for Quantification of Human Immunodeficiency Virus Type 1 RNA in Plasma: Comparison with Commercial Quantitative Assays MARY-ANNE TRABAUD,1† GILLES AUDOLY,1 KARINE LERICHE,1 LAURENT COTTE,2 JACQUES RITTER,3 MAURICE SEPETJAN,3 AND CHRISTIAN TREPO1,2* ˆpital Hotel Dieu, INSERM U271, 69424 Lyon Cedex 03,1 Service d’He´patogastroente´rologie, Ho 69002 Lyon,2 and Laboratoire d’Hygie`ne, Faculte´ de Me´decine, 69373 Lyon Cedex 08,3 France Received 3 September 1996/Returned for modification 6 December 1996/Accepted 3 February 1997

A quantitative reverse transcriptase PCR assay with automated detection by nonradioactive hybridization was developed for the determination of human immunodeficiency virus (HIV) type 1 RNA levels. This assay is based on the use of an external standard curve with an internal standard. The accuracy of quantification was verified by comparison with reference commercial tests, the Chiron branched-DNA and Roche AMPLICOR HIV MONITOR assays. This assay was able to quantify viremia in patients with CD4 cell numbers below and above 500/mm3 and to quantify some HIV strains which could not be titrated by the MONITOR assay. 489-bp PCR fragment were carried out with two sets of primers, MZ139-Std3 and Std4-MZ149. Antisense primer Std3 (59CGTATGCGTGATCATCCAAGCATTGATGGTCTCTTT TAAC-39) and sense primer Std4 (59-CTTGGATGATCACG CATACGAGAGTGCATCCAGTGCATGC-39) are 40 nucleotides in length, of which the 20 nucleotides at the 59 end correspond to a nonviral sequence and the 20 nucleotides at the 39 end correspond to a viral sequence; these sequences are separated by 20 nucleotides and are in the gag region. The 20 nucleotides of viral sequence, which are deleted in the IS, are used as the probe for the wild-type and ES RNA PCR products, and the nonviral sequence, which replaces the viral sequence in the IS, is used for the IS-specific probe. After purification, approximately equal quantities of these two PCR products were annealed, elongated, and amplified with primers MZ139 and MZ149. The IS PCR fragment was reamplified with primers MZ139 and MZ149 and cloned into pCRTA II (TA cloning; Invitrogen, San Diego, Calif.). The sequence of the insert was verified by the dideoxy chain termination reaction. The wild-type 489-bp fragment obtained after the first PCR was also cloned into pCRTA II to prepare the ES RNA for the standard curve. RNAs were prepared by in vitro transcription with a commercial kit (Stratagene, La Jolla, Calif.). The RNA concentration was determined by spectrophotometry. RNA was extracted from 200 ml of plasma by the method of Chomczynski and Sacchi (1). The RNA was denatured for 10 min at 708C and then reverse transcribed and amplified by PCR (3) with primers SK145 and SK431 (4) and 25 mM digoxigenin-labelled dUTP (Boehringer Mannheim, Mannheim, Germany). PCR was performed by coamplification of 500 copies of IS RNA with the material extracted from 100 ml of plasma and, in parallel, five increasing quantities of ES RNA, from 25 to 2.5 3 105 copies. Amplification was detected by using the Enzymun test DNA detection kit (Boehringer Mannheim) in the Enzymun System (ES 300) analyzer, according to the manufacturer’s instructions. Two hybridization reactions were run in parallel, one with viral probe 102-13 (59-BiotinAGGAAGCTGCAGAATGGGAT-39) and one with the Std mimic probe (59-Biotin-CTTGGATGATCACGCATACG-39).

Different techniques have been developed for the quantification of human immunodeficiency virus (HIV) RNA, including competitive reverse transcriptase PCR (RT-PCR) (5, 6, 8, 10), branched-DNA (bDNA) signal amplification (7, 11), and nucleic acid sequence-based amplification (NASBA) (12). Some of these assays are now commercially available (AMPLICOR HIV MONITOR RT-PCR assay [Roche Diagnostic Systems, Branchburg, N.J.], bDNA assay [Chiron, Emeryville, Calif.], and NASBA assay [Organon]). Their main advantage is the standardization of the protocol and reagents used, resulting in better reproducibility, especially between laboratories. However, they are still expensive, restricting the use of these clinically relevant tests. We have developed and evaluated a quantitative RT-PCR– enzyme-linked immunosorbent assay (Q-RT-PCR–ELISA) to measure HIV RNA levels in plasma with a PCR-ELISA kit (Boehringer Mannheim, Mannheim, Germany), using the incorporation of digoxigenin-labelled dUTP during amplification and the detection of the digoxigenin-labelled PCR product by hybridization with biotinylated probes. The assay is based on coamplification of an internal standard (IS) RNA and the wild-type HIV RNA of the sample. A standard curve is established from parallel coamplification of increasing amounts of external standard (ES) wild-type RNA and the same quantity of the IS. The RNA copy number is calculated from the signal ratio of the wild type to the IS. A 489-bp gag fragment was PCR amplified from the DNA of chronically HIV-infected CEM cells with primers MZ139 and MZ149 (13). The IS was constructed by using the method of gene splicing by overlap extension (2) to obtain a PCR fragment with the same length as the wild-type HIV fragment but with 20 internal nucleotides replaced by an unrelated sequence. To achieve this, two PCR amplifications from the first * Corresponding author. Mailing address: INSERM U271, 151 cours Albert Thomas, 69424 Lyon Cedex 03, France. Phone: 33/472 68 19 70. Fax: 33/472 68 19 71. † Present address: Laboratoire d’Hygie`ne, Faculte´ de Me´decine, 69373 Lyon Cedex 08, France. 1251

1252

NOTES

FIG. 1. Comparison of plasma HIV RNA levels obtained by the Q-RT-PCR– ELISA and the bDNA assay in 81 samples from HIV-infected patients. Linear regression was determined by the equation y 5 0.72x 1 0.37. eq, equivalents.

The probes were previously diluted in the hybridization buffer to a final concentration determined to yield progressively increasing optical density (OD) values, from about 1 with 25 copies of ES and IS RNA to more than 6 with 250,000 copies of ES and IS RNA after separate amplification and hybridization with their respective specific probes. By amplification of 1 mg of DNA from peripheral blood mononuclear cells of 21 HIV-infected patients and 22 uninfected subjects, we have verified that the Std probe does not cross-react with specific amplified products and that neither 102-13 nor the Std probe reacts with nonspecific amplified products in a context of cellular genomic DNA. From these results a cutoff OD has been defined as the mean OD of negative samples plus three times the standard deviation. This cutoff was 0.25. DNA was extracted from cells of the 8E5 line, containing one copy of proviral HIV DNA per cell, and serially diluted in water containing herring sperm DNA (1 mg/PCR) to finally obtain one copy equivalent of DNA per PCR. Amplification and detection were performed on each dilution and repeated three times intra- and interassay. We found that our method is able to detect one copy of HIV DNA. Quantitative analyses were then performed on plasma RNA. The calibration templates were included in each assay. The signal ratio of ES to IS was plotted against the initial number of ES copies. The linearity was checked in each experiment, and the coefficients of correlation (r2) of the equation ranged from 0.987 to 0.999. Three samples with low, medium, and high levels of HIV RNA were repeatedly tested by the Q-RT-PCR–ELISA, five times each in the same experiment and in five different experiments. Taking into account all the steps from extraction to detection, standard deviations of mean intra- and interassay titers ranged from 0.04 to 0.11 and 0.08 to 0.15 log units, respectively. Blood samples from 53 HIV-infected patients were collected with the patients’ consent at the Hotel Dieu Hospital, Lyon, France, into EDTA tubes. Levels of HIV RNA from 81 plasma samples from these 53 patients were measured in parallel by the bDNA assay (Quantiplex HIV-RNA 1.0; Chiron) (7) and the Q-RT-PCR–ELISA. The titers obtained by the two tests correlated well (Fig. 1) for the samples in which HIV RNA was detectable by both (Spearman’s rank correlation coefficient [r] 5 0.89; P , 0.0001). Nineteen samples (24%) had an HIV RNA level below the bDNA cutoff (,104 copy equivalents/ml).

J. CLIN. MICROBIOL.

The RT-PCR titer found for these 19 samples ranged from 0.01 3 104 to 3.3 3 104 copies/ml, only three of them being above 104 copies/ml. For the samples with a measurable bDNA titer (.104 copy equivalents/ml), the ratio of RT-PCR to bDNA copy numbers varied from 0.17 to 3.32, with a mean value of 1.63. A maximum twofold difference (60.3 log unit) between the two titers was found for 68% of the samples (42 of 62); 95% (59 of 62) differed by less than 0.5 log unit, and none differed by 1 log unit or more. However, only four had a Q-RT-PCR–ELISA copy number lower than that of the bDNA assay. This trend towards an overestimation of the titer may be linked to the determination of the standard RNA concentration. In a subset of 42 specimens the viral load was also measured by the AMPLICOR HIV MONITOR assay (Roche Diagnostic Systems) (6). A good correlation between the MONITOR and Q-RT-PCR–ELISA HIV RNA titers, as well as between the MONITOR and bDNA HIV RNA titers, was observed (r 5 0.74 and 0.61, respectively; P , 0.0001). However, two samples with high bDNA HIV RNA levels (610 3 103 and 256 3 103 copy equivalents/ml) yielded very low MONITOR HIV RNA titers (1.2 3 103 and 0.3 3 103 copies/ml, respectively). The HIV RNA in these two samples was well detected by the Q-RT-PCR–ELISA (556 3 103 and 61 3 103 copies/ml, respectively). These two samples were reassayed by the two quantitative RT-PCR techniques, and the results were confirmed. For the first of these patients an available subsequent sample was also evaluated by the three assays, and titers of 57.5 3 103, 61.8 3 103, and 0.8 3 103 HIV RNA copies/ml were obtained by the bDNA assay, the Q-RT-PCR–ELISA, and the MONITOR assay, respectively. Such differences have been reported for samples comparatively analyzed by the bDNA, MONITOR, and NASBA assays (9). This variation could result from sequence heterogeneity in the virus strains of these specimens, impairing annealing or hybridization with the primers or probes used. Moreover, it has been shown that HIV strains of subtype A, found in African patients, are not detected as well by the MONITOR assay as by the bDNA assay (11). Sequence analysis of the viruses of these two patients would be necessary to determine the viral subtype and to analyze the variability between the results obtained by the Q-RT-PCR–ELISA and the MONITOR assay. The Q-RTPCR–ELISA and the MONITOR assay use similar oligonucleotides as primers and probes, but with minor variations. While the primers for the Q-RT-PCR–ELISA are SK145 and SK431, those for the MONITOR assay are SK462 and SK431. SK462, originating from the ARV-2 strain, differed from SK145 by two nucleotide mutations at positions 4 (G3T) and 7 (G3A) from the 59 end (6). Another difference pertains to the SK102 probe, which has been shortened at the 59 end to 20 nucleotides for the Q-RT-PCR–ELISA. Discrepancies between these two RT-PCR assays might also be explained by the different experimental conditions used, including different annealing temperatures or the use of different polymerases. A correlation between HIV RNA levels and CD4 cell numbers has been found (r 5 20.48; P , 0.0001), as already observed (7, 8). The viremia could be measured throughout the patient population, whose CD4 cell counts varied from 6 to 844 cells/mm3; this further illustrates the clinical relevance of this test. Virus burden changes in response to treatment were monitored in three patients. The evolution of HIV RNA levels found by the Q-RT-PCR–ELISA and the bDNA assay in parallel with that of CD4 counts is shown in Fig. 2. Similar time courses of viremia were obtained with these HIV RNA quan-

VOL. 35, 1997

NOTES

1253

The reproducible and accurate HIV RNA titration necessary for monitoring therapy in HIV-infected patients may be achieved by the quantitative RT-PCR assay described here. The use of an ES curve with an IS yields quantitative values comparable to those obtained by standardized reference commercial techniques, such as the bDNA or AMPLICOR HIV MONITOR assay. Competitive PCR is generally based on the coamplification of several dilutions of IS with a given amount of the target nucleic acids so that three to five tubes per sample are needed, reducing the number of samples that can be assayed in each run. In the Q-RT-PCR–ELISA, the control of tube-to-tube variability by the IS has been preserved without the need of coamplification of several concentrations of IS and the sample to calculate the titer, allowing tests of a number of samples, which is consistent with routine use. Its advantage compared to the commercial assays is its lower cost (it has been estimated to cost about 100 F per test, compared with 600 to 730 F per test for the commercial assays). To improve the standardization and validation of this quantitative test, we still need to optimize the production of the standard RNAs; to evaluate its sensitivity, specificity, and reproducibility with a greater number of samples, taking into account the effects of sample collection, storage, and processing on quantification; and to investigate its ability to measure viral load from other biologic compartments. We thank Boehringer Mannheim (Meylan, France) for providing the Enzymun DNA detection kits and the ES 300 analyzer and Roche Diagnostic Systems (Neuilly-sur-Seine, France) and Chiron Diagnostics (Cergy Pontoise, France) for providing AMPLICOR HIV MONITOR and bDNA assay kits, respectively. We are grateful to P. Andre´ for helpful discussion and to M. Desroud for technical assistance. REFERENCES

FIG. 2. Effect of therapy on HIV RNA levels and CD4 cell counts (E). Three patients (no. 1 through 3) were monitored during treatments with different antivirals in combination, which are indicated above the graph for each patient. Plasma viral loads were measured by Q-RT-PCR–ELISA (F) and bDNA assay (h). AZT, zidovudine; ddI, dideoxyinosine; IFN, interferon; 3TC, 3-thiacydine.

titative assays. For patient 3 the higher sensitivity of RT-PCR permitted a better estimation of the reduction rate of the viral load and an earlier detection of the viremia rebound than those obtained by the bDNA assay.

1. Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156–159. 2. Diviacco, S., P. Norio, L. Zentilin, S. Menzo, M. Clementi, G. Biamonti, S. Riva, A. Falaschi, and M. Giacca. 1992. A novel procedure for quantitative polymerase chain reaction by coamplification of competitive templates. Gene 122:313–320. 3. Escaich, S., J. Ritter, P. Rougier, D. Lepot, J. P. Lamelin, M. Septjan, and C. Trepo. 1991. Plasma viremia as a marker of viral replication in HIVinfected individuals. AIDS 5:1189–1194. 4. Lynch, C. E., R. Madej, P. H. Louie, and G. Rodgers. 1992. Detection of HIV-1 DNA by PCR: evaluation of pair concordance and sensitivity of a single primer pair. J. Acquired Immune Defic. Syndr. Hum. Retrovirol. 5: 433–440. 5. Menzo, S., P. Bagnarelli, M. Giacca, A. Manzin, P. E. Varaldo, and M. Clementi. 1992. Absolute quantitation of viremia in human immunodeficiency virus infection by competitive reverse transcription and polymerase chain reaction. J. Clin. Microbiol. 30:1752–1757. 6. Mulder, J., N. McKinney, C. Christopherson, J. Sninsky, L. Greenfield, and S. Kwok. 1994. Rapid and simple PCR assay for quantitation of human immunodeficiency virus type 1 RNA in plasma: application to acute retroviral infection. J. Clin. Microbiol. 32:292–300. 7. Pachl, C., J. A. Todd, D. G. Kern, P. J. Sheridan, S.-J. Fong, M. Stempien, B. Hoo, D. Besemer, T. Yeghiazarian, B. Irvine, J. Kolberg, R. Kokka, P. Neuwald, and M. S. Urdea. 1995. Rapid and precise quantification of HIV-1 RNA in plasma using a branched DNA signal amplification assay. J. Acquired Immune Defic. Syndr. Hum. Retrovirol. 8:446–454. 8. Piatak, M., M. S. Saag, L. C. Yang, S. J. Clark, J. C. Kappes, K. C. Luk, B. H. Hahn, G. M. Shaw, and J. D. Lifson. 1993. High levels of HIV-1 in plasma during all stages of infection determined by competitive PCR. Science 259: 1749–1754. 9. Revets, H., D. Marissens, S. De Wit, P. Lacor, N. Clumeck, S. Lauwers, and G. Zissis. 1996. Comparative evaluation of NASBA HIV-1 RNA QT, AMPLICOR-HIV Monitor, and QUANTIPLEX HIV RNA assay, three methods for quantification of human immunodeficiency virus type 1 RNA in plasma. J. Clin. Microbiol. 34:1058–1064. 10. Scadden, D. T., Z. Wang, and G. E. Groopman. 1992. Quantitation of plasma human immunodeficiency virus type 1 RNA by competitive polymerase chain reaction. J. Infect. Dis. 165:1119–1123.

1254

NOTES

11. Todd, J., C. Pachl, R. White, T. Yeghiazarian, P. Johnson, B. Taylor, M. Holodniy, D. Kern, S. Hamren, D. Chernoff, and M. Urdea. 1995. Performance characteristics for the quantitation of plasma HIV-1 RNA using branched DNA signal amplification technology. J. Acquired Immune Defic. Syndr. Hum. Retrovirol. 10:S35–S44. 12. Van Gemen, B., R. Van Beuningen, A. Nabbe, D. Van Strijp, S. Jurrians, P.

J. CLIN. MICROBIOL. Lens, and T. Kievit. 1994. A one-tube quantitative HIV-1 RNA NASBA nucleic acid amplification assay using electroluminescent (ECL) labelled probes. J. Virol. Methods 49:157–168. 13. Zazzi, M., L. Romano, A. Brasini, and P. E. Valensin. 1992. Nested polymerase chain reaction for detection of human immunodeficiency virus type 1 DNA in clinical specimens. J. Med. Virol. 38:172–174.