Development of a simultaneous high resolution typing ...

Gene 564 (2015) 228–232

Contents lists available at ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

Methods paper

Development of a simultaneous high resolution typing method for three SLA class II genes, SLA-DQA, SLA-DQB1, and SLA-DRB1 and the analysis of SLA class II haplotypes MinhThong Le a,1, Hojun Choi a,1, Min-Kyeung Choi a, Hyesun Cho a, Jin-Hoi Kim a, Han Geuk Seo a, Se-Yeon Cha b, Kunho Seo c, Hailu Dadi a,⁎, Chankyu Park a,⁎ a b c

Department of Animal Biotechnology, Konkuk University, Hwayang-dong, Kwangjin-gu, Seoul, South Korea College of Veterinary Medicine, Chonbuk National University, South Korea College of Veterinary Medicine, Konkuk University, Seoul, South Korea

a r t i c l e

i n f o

Article history: Received 2 January 2015 Received in revised form 13 March 2015 Accepted 25 March 2015 Available online 28 March 2015 Keywords: SLA DQA DQB1 and DRB1 Swine

a b s t r a c t The characterization of the genetic variations of major histocompatibility complex (MHC) is essential to understand the relationship between the genetic diversity of MHC molecules and disease resistance and susceptibility in adaptive immunity. We previously reported the development of high-resolution individual locus typing methods for three of the most polymorphic swine leukocyte antigens (SLA) class II loci, namely, SLA-DQA, SLADQB1, and SLA-DRB1. In this study, we extensively modified our previous protocols and developed a method for the simultaneous amplification of the three SLA class II genes and subsequent analysis of individual loci using direct sequencing. The unbiased and simultaneous amplification of alleles from the all three hyperpolymorphic and pseudogene containing genes such as MHC genes is extremely challenging. However, using this method, we demonstrated the successful typing of SLA-DQA, SLA-DQB1, and SLA-DRB1 for 31 selected individuals comprising 26 different SLA class II haplotypes which were identified from 700 animals using the single locus typing methods. The results were identical to the known genotypes from the individual locus typing. The new method has significant benefits over the individual locus typing, including lower typing cost, use of less biomaterial, less effort and fewer errors in handling large samples for multiple loci. We also extensively characterized the haplotypes of SLA class II genes and reported three new haplotypes. Our results should serve as a basis to investigate the possible association between polymorphisms of MHC class II and differences in immune responses to exogenous antigens. © 2015 Elsevier B.V. All rights reserved.

1. Introduction The major histocompatibility complex (MHC) class II genes encode heterodimeric molecules on the cell surface, which are responsible for presenting foreign antigens to CD4 lymphocytes, thereby activating the immune system against specific exogenous antigens (Lechler et al., 1991). It has been suggested that the genetic diversity of MHC molecules was increased and maintained by pathogen-driven selection (Hughes and Nei, 1989; Takahata and Nei, 1990). Therefore, the variations of Abbreviations: MHC, the major histocompatibility complex; SLA, swine leukocyte antigen; ISAG, International Society for Animal Genetics; IPD, Immuno Polymorphism Database; GSBT, genomic sequence base typing; PCR, polymerase chain reaction; KNP, Korean native pig; SNU, Seoul National University; EDTA, ethylenediaminetetraacetic acid; SDS, sodium dodecyl sulfate; ACP, annealing control primer. ⁎ Corresponding authors at: Department of Animal Biotechnology, Konkuk University, Hwayang-dong, Kwangjin-gu, Seoul 143-701, South Korea. E-mail addresses: [email protected] (H. Dadi), [email protected] (C. Park). 1 MT Le and H Choi contributed equally to this work.

http://dx.doi.org/10.1016/j.gene.2015.03.049 0378-1119/© 2015 Elsevier B.V. All rights reserved.

MHC genes have been shown to affect the survival and evolution of vertebrate population under influence from environmental selection (Reusch et al., 2001; Penn, 2002; Wegner et al., 2003). It has been denoted that the dynamic evolution of the SLA not only actively occurs in natural selection but also maintained under artificial selection (Groenen et al., 2012). Consequently, MHC genes have been exploited as one of the best candidates for population genetic studies, especially molecular mechanisms of adaptation (Potts and Wakeland, 1993; Hedrick, 1994; Bernatchez and Landry, 2003). MHC or swine leukocyte antigen (SLA) genes have been reported to be associated with the MHC-mediated immune response (Lumsden et al., 1993) as well as production traits (Gautschi and Gaillard, 1990). Currently, there is increasing evidence for pigs as ideal large animal models for biomedical research (Vodicka et al., 2005; Meurens et al., 2012; Lee et al., 2014) and potential xenotransplantation donors for humans (Mezrich et al., 2003). Considering these diverse developments, a rapid, accurate, and convenient assessment of SLA polymorphisms is necessary.

M. Le et al. / Gene 564 (2015) 228–232

Among SLA class II genes, genetic diversity is highest for DQB1 and DRB1 which are the beta (β) chains of DQ and DR, and followed by their alpha (α) chain genes, DQA and DRA (Ho et al., 2009). The current Immuno Polymorphism Database of SLA (IPD-SLA) (http://www.ebi.ac. uk/ipd/mhc/sla) contains 82 DRB1, 44 DQB1, 20 DQA, and 13 DRA alleles and 21 SLA class II haplotypes. Parallel with other vertebrates, such polymorphisms create challenges for the identification and classification of the genetic variations of SLA genes. For the efficient typing of these molecules, we previously reported the development of individual locus typing methods by using genomic PCR, followed by direct sequencing for the high-resolution typing of SLA-DQA, SLA-DQB1, and SLA-DRB1 (Park et al., 2010; Thong et al., 2011; Le et al., 2012). These methods have important advantages compared to other available typing methods, including comprehensive allelic coverage, no requirement of preexisting allelic diversity, use of genomic DNA, and removal of cloning steps, which can be applicable to field samples without much difficulty. In multiplex PCR, more than one pair of primers are used to specifically amplify multiple targets in the same reaction to reduce time and effort in the laboratory (Chamberlain et al., 1988). It would be ideal if we could simplify the amplification processes of the three SLA class II genes. In this study, we attempted to introduce multiplex PCR for the high resolution typing of three SLA class II genes and achieved the successful typing results by systematically modifying the previous individual locus typing. We also noticed that our multiplex PCR based typing method showed improvement in robustness of the typing by sufficient elimination of SLA-DRB1-related pseudogenes. In addition, we extensively characterized the haplotypes of SLA class II genes and reported three new haplotypes.

2. Materials and methods 2.1. Animals and DNA isolation To maximize the genetic diversity of the three SLA class II genes, SLADQA, DQB1 and DRB1, in the typing population, we selected 31 individuals including 29 outbred (Landrace × Yorkshire) pigs, one Korean native pig (KNP) (Park et al., 2009) and one Seoul National University (SNU) miniature pig derived from Chicago Medical University (Setcavage and Kim, 1976). The single locus typing information of SLA class II genes for animals were based on the results of previous studies obtained by genomic PCR and direct sequencing that we have developed for each locus (Park et al., 2010; Thong et al., 2011; Le et al., 2012). Genomic DNA was extracted from 0.5 g of ear notch using the standard extraction technique. Briefly, ear tissues were incubated at 55 °C for 6 h in the lysis buffer [10 mM Tris–HCl (pH 8.0) and 0.1 M EDTA] containing 0.5% SDS and 20 μl of 20 mg/ml proteinase K (Promega, Madison, WI). The supernatant was purified with phenol/ chloroform extraction, and DNA pellets were obtained by alcohol precipitation.

229

2.2. Multiplex PCR for the simultaneous amplification of SLA-DQA, DQB1 and DRB1 Simultaneous amplification reactions of SLA-DQA, DQB1 and DRB1 were carried out in a 25-μl reaction mixture containing 50 ng of genomic DNA, 0.32 μM DQA primers (DQAi1F3 and DQAe3R5), 0.12 μM DQB1 primers (DQB1F-119 and DQB1R + 295), 1 μM DRB1 primers (DRB1F-22 and DRB1R + 284) (Table 1), 0.5 U of Super-Therm DNA polymerase (JMR Holdings, Kent, UK) in 1.2× PCR reaction buffer (1.5 mM MgCl2) and 0.1 mM dNTPs. The amplification profile consisted of an initial denaturation at 95 °C for 5 min, followed by 35 cycles of 1 min at 95 °C, 1 min at 65 °C, 1 min at 72 °C and a 5-min final extension at 72 °C by using T3000 Thermocycler (Biometra, Germany). PCR products were checked by electrophoresis on 1% agarose gel in 1.5× Tris-acetateEDTA (TAE) buffer. The gel was stained with ethidium bromide and visualized under ultraviolet (UV) light. 2.3. Direct sequencing and allelic determination of SLA-DQA, DQB1 and DRB1 Direct sequencing of multiplex PCR products was carried out in the same way as previously described for single locus typing (Park et al., 2010; Thong et al., 2011; Le et al., 2012). Briefly, for degrading remained primers and dephosphorylate dNTPs, 5 μl of amplified products was incubated for 30 min at 37 °C together with 4 U of exonuclease I (Fermentas, Canada), and 0.8 U of shrimp alkaline phosphatase (USB Corporation, USA) in 1.5× reaction buffer, then stopped after 15-min incubation at 80 °C. Sequencing reactions were separately performed for each locus using ABI PRISM BigDye™ Terminator Cycle Sequencing Kits (Applied Biosystem, USA) following the manufacturer's manual. Sequencing primers for each locus are described in Table 1. Sequencing results with quality values N 20 were then imported into the CLC Workbench (CLC Bio, Arhus N, Denmark). The entire exon 2 sequences of each locus were used for National Center for Biotechnology (NCBI) BLAST analysis to identify the genotype. For new alleles, PCR products were cloned and sequenced as described previously (Park et al., 2010; Thong et al., 2011; Le et al., 2012). Briefly, PCR products were gelpurified using QIAquick™ Gel Extraction Kits (Qiagen, Hilden, Germany), and ligated into pGEM-T Easy Vector (Promega, Madison, WI). The ligation products were transformed into DH10B cells (Invitrogen, Carlsbad, CA) using MicroPulser (Biorad, CA). Isolated plasmids from positive colonies were sequenced using vector primers (T7 and SP6) to determine the sequence of the inserts. A minimum of eight clones were sequenced for each locus in both forward and reverse directions. Unreported sequences were submitted to the SLA Nomenclature Committee of the International Society for Animal Genetics (ISAG) to assign official allele names (Ho et al., 2009). 2.4. Determination of SLA class II Haplotypes The haplotype analysis was conducted using the Pypop program (Lancaster et al., 2007) and manual examinations. Initially, haplotypes

Table 1 Primers used for multiplex PCR and direct sequencing of SLA-DQA, SLA-DQB1, and SLA-DRB1. Usage

Primer name

Primer sequence (5′–3′)

Product size (bp)

SLA-DQA exon 2

Genotyping Sequencing Genotyping

SLA-DRB1 exon 2

Sequencing Genotyping

CTAGAGACTGTGCCACAGATGAAG ACAGATGAGGGTGTTGGGCTGA GTMAAGTTCTCTTGTCAC GCGGCGGGTTTCAGGTGGATG aaccctcactaaagACCCACTCTCTCYGCGCGGWGTCTC AACCCTCACTAAAG gaatgctgcgactacctgTGGATCATTGCTGTCCACGCAGMG tctaccaggcattcgcttcatiiiiiCYSCSGGCVGCSCA TAGCTGAATTCGAATGCTGCGACTA

898

SLA-DQB1 exon 2

DQAi1F3 DQAe3R1 DQAi1F4 DQB1F-119 DQB1R + 295 Sq-mul-DQB1 DRB1F-22 DRB1R + 284 Sq-mul-DRB1

Sequencing

Note: i, Inosine. Primer tails with random nucleotides are indicated as lowercase letters.

478

364

230

M. Le et al. / Gene 564 (2015) 228–232

were determined from animals homozygous for all three loci, DQB1, DRB1 and DQA. For heterozygotes, previously reported or known haplotypes were separated out from allele combinations of the three loci. The haplotypes which appeared from more than one individual were accepted as confirmed haplotypes. 3. Results and discussion 3.1. Successful development of primers for SLA-DQA, DQB1 and DRB1 multiplex PCR To enable the multiplex genomic PCR-based SLA class II typing, it is necessary to overcome the difficulty of co-amplifying these extremely polymorphic loci, while eliminating several pseudogenes with high sequence homologies and without nonspecific amplification. For example, DRB1 neighbors 4 homologous pseudogenes (Lunney et al., 2009). Because the minimum criteria for SLA class II typing are the availability of the complete sequence information of exon 2 (Smith et al., 2005), we focused on the simultaneous amplification of complete exon 2 regions from SLA-DQA, SLA-DQB1, and SLA-DRB1. We first started with five samples for optimizing the primers of multiplex PCR. For DQA, no changes were made from the previously reported DQA primers for single locus PCR (Le et al., 2012). For DQB1 and DRB1, major changes have been made because the amplification results were not acceptable for these two loci in multiplex PCR conditions and the primers yielded non-specific amplifications, poor sequencing chromatograms from the subsequent direct sequencing, and allelic dropout. Several DQB1 forward and reverse primers were redesigned until successful amplifications of SLA-DQB1 were obtained in the multiplex PCR conditions. Finally, the forward primer, DQB1F-119, which was designed to contain the region with higher sequence conservation than the previous single reaction primer, and the reverse primer, DQB1R + 295, which is 3 base pairs longer in the 3′ direction with nucleotide degenerations W (A or T) and R (G or A) at two positions over the previous single reaction primer, showed satisfactory amplification of SLA-DQB1 in multiplex PCR conditions (Supplementary Fig. 1). For the optimization of SLA-DRB1 primers for multiplex PCR, the first focus is to eliminate the DRB2 pseudogene which shows very high sequence homology to functional DRB1 (Thong et al., 2011). Among several primers designed, the best result was yielded when DRB1F-22 and DRB1R + 284 were used as forward and reverse primers, respectively. DRB1F-22 was designed at the region near the 5′ end of DRB1 exon 2 where the sequence difference between DRB1 and related pseudogens is the largest. We also added a tail with 18 base non-specific nucleotides at the 5′ end of the primer to minimize information loss at the beginning

regions of the sequence from sequencing. For the reverse primer, DRB1R + 284, the concept of annealing control primer (ACP) (Hwang et al., 2003) was adopted, and we successfully yielded SLA-DRB1 specific amplification in the multiplex condition (Supplementary Fig. 2). The ACP strategy helps in obtaining successful PCR results on high GC content regions and thus eliminates the amplification of DRB pseudogenes (DRB2 to DRB5). Because the DRB1 forward primer contains the first two bases of DRB1 exon 2, our DRB1 typing results failed to determine the two nucleotides at this position. Nevertheless, we were able to distinguish all currently reported DRB1 alleles without the two bases. If new alleles are identified and the identity of the missing two bases is necessary, the information can be obtained by SLA-DRB1 single locus typing (Thong et al., 2011) although no variations have been identified from the first two bases of DRB1 exon 2 of the currently reported alleles. 3.2. Optimizing multiplex PCR condition by adjusting primer and PCR buffer concentration A difficulty to develop multiplex PCR arises from difference in the amplification efficiency among multiple primer pairs, leading preferential amplification of one target sequence over another (Mutter and Boynton, 1995). Among the three pairs of primers, the amplification efficiency for DQA and DQB1 was higher than DRB1 due to the complexity of DRB1 primers, both forward and reverse. Therefore, an increased concentration of DRB1 primers over DQA and DQB1 was used in the multiplex condition. A series of PCR tests were conducted to find a quantitative balance among the primer pairs. In addition, the concentrations of other PCR components such as dNTPs, MgCl2, PCR buffer, and polymerase were adjusted to improve the results of multiplex PCR. We found that an increase in the concentration of the PCR reaction buffer to 1.2× gave the most desirable results, compared to other changes (data not shown). Finally, we were able to obtain successful multiplex PCR results with three specific bands of 898, 478, and 364 bp for SLA-DQA, SLA-DQB1, and SLA-DRB1, respectively, from a single PCR reaction (Fig. 1). The chromatograms from the multiplex PCR were of similar quality to those of individual locus PCR for all three loci (Fig. 2). 3.3. Verification of tying accuracy and the identification of three new SLA class II haplotypes To confirm the accuracy and efficiency of the new method, we selected 31 individuals consisting of 26 different haplotypes from our single locus typing results conducted using 700 animals (including our unpublished data) and compared the results of the two methods. The number of alleles included in the selected DNA panel was 13, 17, and

Fig. 1. Successful amplification of SLA-DQA, SLA-DQB1, and SLA-DRB1 by using multiplex PCR. Specific bands of 898, 478, and 364 bp for SLA-DQA, SLA-DQB1, and SLA-DRB1, respectively, were consistently amplified from samples with different SLA class II haplotypes. Locus names are indicated on the top. Lanes 2 to 4, amplified SLA class II genes using individual locus PCR. Lanes 5 to 10, products from the simultaneous amplification of the three SLA class II genes by using multiplex PCR from samples corresponding to the haplotypes Hp-0.2/Hp-0.3, Hp-0.1/ Hp-0.13, Hp-0.30/new_Hp-11, Hp-0.4/new_Hp-17, Hp-0.14/new_Hp-13, and Hp-0.11/new_Hp-19, respectively. L, 100-bp DNA ladder; N, negative control for PCR.

M. Le et al. / Gene 564 (2015) 228–232

231

DRB1-0201 /1001/kn01

Multiplex typing of DRB1-0201/1001

DQB1-0402/0701

Multiplex typing of DQB1-0402/0701

Fig. 2. Improvement of sequencing results with multiplex typing for SLA-DRB1 and DQB1. The upper shows the removal of signal of pseudogene allele DRB1*kn01 which is in linkage with alleles 1001. The lower indicate more equal amplification of DQB1*0402 and 0701 using multiplex typing primers (signal of 0701 was weaker before). The sequencing result of DQA is similar with single typing previously (not showed).

20 for DQA, DQB1, and DRB1, respectively. Although we typed only 31 selected animals in this study, the number of selected alleles is larger than in previous single locus typing reports by approximately 480 animals in which there were 11 DQA, 11 DQB1, and 18 DRB1 alleles (Park et al., 2010; Thong et al., 2011; Le et al., 2012). The typing results using multiplex PCR showed not only the efficiency regarding to amplifying three SLA class II loci in a single reaction but also included improvement to overcome difficulties from previous single locus typing including pseudogene noise in DRB1 and the preferential amplification of specific alleles (*0701) in SLA-DQB1 (Fig. 2). All typing results were identical to those of individual locus typing (Supplementary Table 1). The separation of alleles from heterozygotes was carried out in the same way as our previous single locus typing (Park et al., 2010; Thong et al., 2011; Le et al., 2012). The criteria for determining the haplotypes were previously described (Le et al., 2012). Of the 26 haplotypes, three haplotypes, new_Hp-26, new_Hp27, and new_Hp-28, were previously unreported (Supplementary Table 1). Nine haplotypes were identical to those reported in IPD and 14 to those reported in our previous studies, indicating the validity of the results of our haplotype analysis. The three new haplotypes were also confirmed with more than one individual (data not shown). The selected alleles for this study cover all of the recently reported 2 digit sub-groups designated by the SLA Nomenclature Committee (Ho et al., 2009) (Supplementary Figs. 3, 4 and 5). Therefore, we propose that our multiplex typing for the three most polymorphic SLA class II loci, namely, SLA-DQA, SLA-DQB1, and SLA-DRB1, could be used to detect their allelic diversities, including unreported new alleles. With comprehensiveness in allelic coverage and the obtainment of the genetic information of three SLA class II genes simultaneously, our new method should be greatly useful for the haplotype analysis of SLA class II genes. The accumulated haplotype information could be used to help verify the accuracy of typing results by comparing the data to the existing breeds and haplotypes. 3.4. The advantages of multiplex SLA class II typing Various typing methods for MHC genes were developed with improving technical progress, but there is still no approach that is truly perfect for revealing the pros and cons of each method (Babik, 2010). The development and usage of methods for MHC typing depend on

the purpose, requirement as well as conditions for specific studies (Middelton, 2005). The main advantage of SLA-GSBT method was inherent from the convenience of using genomic DNA and the accuracy of the results through direct sequencing. In parallel with the SLA class II genes, a similar strategy can be applied to the SLA class I genes and has achieved certain results. However, due to the significantly higher complexity of SLA class I genes than that of the class II, the successful development of a simultaneous typing method without amplification biases for class I genes showed to be much more challenging. We were not able to achieve successful outcomes in our hands. Comparing to the previous versions of single locus typing (Park et al., 2010; Thong et al., 2011; Le et al., 2012), our new method in this report improved the previous difficulty in precise allele calling of heterozygotes due to weak signals of a few alleles with low amplification efficiency for SLA-DQB1 and co-amplification of pseudogenes for SLADRB1. Taken together with multiplex PCR, we believe that the benefits comprising lower typing cost, use of less biomaterial, fewer errors in handling large number of samples and less effort should contribute to study SLA class II genes at the level of population genetics, which shown to be difficult previously. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.gene.2015.03.049. Acknowledgements This work was supported by grants from the Next-Generation BioGreen 21 Program (No. PJ011130) and the “Cooperative Research Program for Agriculture Science & Technology Development (PJ009103)” of the Rural Development Administration, Republic of Korea. References Babik, W., 2010. Methods for MHC genotyping in non-model vertebrates. Mol. Ecol. Resour. 10, 237–251. Bernatchez, L., Landry, C., 2003. MHC studies in nonmodel vertebrates: what have we learned about natural selection in 15 years? J. Evol. Biol. 16, 363–377. Chamberlain, J.S., Gibbs, R.A., Ranier, J.E., Nguyen, P.N., Caskey, C.T., 1988. Deletion screening of the Duchenne muscular dystrophy locus via multiplex DNA amplification. Nucleic Acids Res. 16, 11141–11156. Gautschi, C., Gaillard, C., 1990. Influence of major histocompatibility complex on reproduction and production traits in swine. Anim. Genet. 21, 161–170.

232

M. Le et al. / Gene 564 (2015) 228–232

Groenen, M.A.M., Archibald, A.L., Uenishi, H., Tuggle, C.K., Takeuchi, Y., Rothschild, M.F., Rogel-Gaillard, C., Park, C., Milan, D., Megens, H.-J., Li, S., Larkin, D.M., Kim, H., Frantz, L.A.F., Caccamo, M., Ahn, H., Aken, B.L., Anselmo, A., Anthon, C., Auvil, L., Badaoui, B., Beattie, C.W., Bendixen, C., Berman, D., Blecha, F., Blomberg, J., Bolund, L., Bosse, M., Botti, S., Bujie, Z., Bystrom, M., Capitanu, B., Carvalho-Silva, D., Chardon, P., Chen, C., Cheng, R., Choi, S.-H., Chow, W., Clark, R.C., Clee, C., Crooijmans, R.P.M.A., Dawson, H.D., Dehais, P., De Sapio, F., Dibbits, B., Drou, N., Du, Z.-Q., Eversole, K., Fadista, J., Fairley, S., Faraut, T., Faulkner, G.J., Fowler, K.E., Fredholm, M., Fritz, E., Gilbert, J.G.R., Giuffra, E., Gorodkin, J., Griffin, D.K., Harrow, J.L., Hayward, A., Howe, K., Hu, Z.-L., Humphray, S.J., Hunt, T., Hornshøj, H., Jeon, J.-T., Jern, P., Jones, M., Jurka, J., Kanamori, H., Kapetanovic, R., Kim, J., Kim, J.-H., Kim, K.-W., Kim, T.-H., Larson, G., Lee, K., Lee, K.-T., Leggett, R., Lewin, H.A., Li, Y., Liu, W., Loveland, J.E., Lu, Y., Lunney, J.K., Ma, J., Madsen, O., Mann, K., Matthews, L., McLaren, S., Morozumi, T., Murtaugh, M.P., Narayan, J., Truong Nguyen, D., Ni, P., Oh, S.-J., Onteru, S., Panitz, F., Park, E.-W., et al., 2012. Analyses of pig genomes provide insight into porcine demography and evolution. Nature 491, 393–398. Hedrick, P.W., 1994. Evolutionary genetics of the major histocompatibility complex. Am. Nat. 143, 945–964. Ho, C.S., Lunney, J.K., Ando, A., Rogel-Gaillard, C., Lee, J.H., Schook, L.B., Smith, D.M., 2009. Nomenclature for factors of the SLA system, update 2008. Tissue Antigens 73, 307–315. Hughes, A.L., Nei, M., 1989. Nucleotide substitution at major histocompatibility complex class II loci: evidence for overdominant selection. Proc. Natl. Acad. Sci. U. S. A. 86, 958–962. Hwang, I.-T., Kim, Y.-J., Kim, S.-H., Kwak, C.-I., Gu, Y.-Y., Chun, J.-Y., 2003. Annealing control primer system for improving specificity of PCR amplification. BioTechniques 35, 1180–1184. Lancaster, A.K., Single, R.M., Solberg, O.D., Nelson, M.P., Thomson, G., 2007. PyPop update — a software pipeline for large-scale multilocus population genomics. Tissue Antigens 69, 192–197. Le, M.T., Choi, H., Choi, M.K., Nguyen, D.T., Kim, J.H., Seo, H.G., Cha, S.Y., Seo, K., Chun, T., Schook, L.B., Park, C., 2012. Comprehensive and high-resolution typing of swine leukocyte antigen DQA from genomic DNA and determination of 25 new SLA class II haplotypes. Tissue Antigens 80, 528–535. Lechler, R., Batchelor, R., Lombardi, G., 1991. The relationship between MHC restricted and allospecific T cell recognition. Immunol. Lett. 29, 41–50. Lee, K., Kwon, D.-N., Ezashi, T., Choi, Y.-J., Park, C., Ericsson, A.C., Brown, A.N., Samuel, M.S., Park, K.-W., Walters, E.M., Kim, D.Y., Kim, J.-H., Franklin, C.L., Murphy, C.N., Roberts, R.M., Prather, R.S., Kim, J.-H., 2014. Engraftment of human iPS cells and allogeneic porcine cells into pigs with inactivated RAG2 and accompanying severe combined immunodeficiency. Proc. Natl. Acad. Sci. 111, 7260–7265. Lumsden, J.S., Kennedy, B.W., Mallard, B.A., Wilkie, B.N., 1993. The influence of the swine major histocompatibility genes on antibody and cell-mediated immune responses to immunization with an aromatic-dependent mutant of Salmonella typhimurium. Can. J. Vet. Res. (Rev. Can. Rech. Vét.) 57, 14–18.

Lunney, J.K., Ho, C.-S., Wysocki, M., Smith, D.M., 2009. Molecular genetics of the swine major histocompatibility complex, the SLA complex. Dev. Comp. Immunol. 33, 362–374. Meurens, F., Summerfield, A., Nauwynck, H., Saif, L., Gerdts, V., 2012. The pig: a model for human infectious diseases. Trends Microbiol. 20, 50–57. Mezrich, J.D., Haller, G.W., Arn, J.S., Houser, S.L., Madsen, J.C., Sachs, D.H., 2003. Histocompatible miniature swine: an inbred large-animal model. Transplantation 75, 904–907. Middelton, D., 2005. HLA typing from serology to sequencing era. Iran. J. Allergy Asthma Immunol. 4, 53–66. Mutter, G.L., Boynton, K.A., 1995. PCR bias in amplification of androgen receptor alleles, a trinucleotide repeat marker used in clonality studies. Nucleic Acids Res. 23, 1411–1418. Park, K., Dirisala, V.R., Oh, Y., Choi, H., Lee, K.T., Kim, J.H., Lee, H.T., Seo, K.H., Park, C., 2009. Reporting 678 putative cSNPs from full-length enriched cDNA sequences of the Korean native pig. J. Anim. Breed. Genet. (Z. Tierzücht. Züchtungsbiol.) 126, 127–133. Park, K., Choi, H., Thong, L.M., Kwon, O.J., Kim, J.H., Lee, H.T., Kim, Y.B., Park, S.B., Park, C., 2010. Simple and comprehensive SLA-DQB1 genotyping using genomic PCR and direct sequencing. Tissue Antigens 76, 301–310. Penn, D.J., 2002. The scent of genetic compatibility: sexual selection and the major histocompatibility complex. Ethology 108, 1–21. Potts, W.K., Wakeland, E.K., 1993. Evolution of MHC genetic diversity: a tale of incest, pestilence and sexual preference. Trends Genet. 9, 408–412. Reusch, T.B., Häberli, M.A., Aeschlimann, P.B., Milinski, M., 2001. Female sticklebacks count alleles in a strategy of sexual selection explaining MHC polymorphism. Nature 414, 300–302. Setcavage, T.M., Kim, Y.B., 1976. Variability of the immunological state of germfree colostrum-deprived Minnesota miniature piglets. Infect. Immun. 13, 600–607. Smith, D.M., Lunney, J.K., Ho, C.S., Martens, G.W., Ando, A., Lee, J.H., Schook, L., Renard, C., Chardon, P., 2005. Nomenclature for factors of the swine leukocyte antigen class II system, 2005. Tissue Antigens 66, 623–639. Takahata, N., Nei, M., 1990. Allelic genealogy under overdominant and frequencydependent selection and polymorphism of major histocompatibility complex loci. Genetics 124, 967–978. Thong, L.M., Choi, H., Kwon, O.J., Kim, J.H., Kim, Y.B., Oh, J.W., Seo, K., Yeom, S.C., Lee, W.J., Park, C., 2011. Systematic analysis of swine leukocyte antigen-DRB1 nucleotide polymorphisms using genomic DNA-based high-resolution genotyping and identification of new alleles. Tissue Antigens 77, 572–583. Vodicka, P., Smetana Jr., K., Dvoránková, B., Emerick, T., Xu, Y.Z., Ourednik, J., Ourednik, V., Motlík, J., 2005. The miniature pig as an animal model in biomedical research. Ann. N. Y. Acad. Sci. 1049, 161–171. Wegner, K.M., Kalbe, M., Kurtz, J., Reusch, T.B.H., Milinski, M., 2003. Parasite selection for immunogenetic optimality. Science 301, 1343-1343.