Development of a single base extension-tag microarray for the ...

Appl Microbiol Biotechnol (2011) 89:1979–1990 DOI 10.1007/s00253-010-2959-7

METHODS AND PROTOCOLS

Development of a single base extension-tag microarray for the detection of pathogenic Vibrio species in seafood Wanyi Chen & Shuijing Yu & Chunxiu Zhang & Jilun Zhang & Chunlei Shi & Yu Hu & Biao Suo & Huan Cao & Xianming Shi

Received: 18 June 2010 / Revised: 20 September 2010 / Accepted: 18 October 2010 / Published online: 16 December 2010 # Springer-Verlag 2010

Abstract In this study, a single base extension-tag array on glass slides (SBE-TAGS) microarray was established to detect the seven leading seafood-borne pathogens, including Vibrio parahaemolyticus, Vibrio cholerae, Vibrio vulnificus, Vibrio mimicus, Vibrio alginolyticus, Vibrio anguillarum, and Vibrio harveyi. Three multiplex PCR assays were developed to specifically target the following species with individual gene markers, which are aadS, tdh, and trh for V. parahaemolyticus; col, toxR, and vvh for V. alginolyticus, V. mimicus, and V. vulnificus; and empA, vhh1, and tcpA for V. anguillarum, V. harveyi, and V. cholerae, respectively. The purified PCR products were Electronic supplementary material The online version of this article (doi:10.1007/s00253-010-2959-7) contains supplementary material, which is available to authorized users. W. Chen : S. Yu : C. Shi : Y. Hu : B. Suo : X. Shi Joint Sino-US Food Safety Research Center & Bor Luh Food Safety Center, School of Agriculture & Biology, Shanghai Jiao Tong University, 800 Dongchuan Rd., Shanghai 200240, China C. Zhang : H. Cao National Engineering Center for Biochip at Shanghai, 151 Libing Rd., Shanghai 201203, China J. Zhang Shanghai Entry–Exit Inspection and Quarantine Bureau, 1208 Minsheng Rd., Shanghai 200135, China X. Shi (*) Department of Food Science and Technology, Shanghai Jiao Tong University, 800 Dongchuan Rd., Shanghai 200240, China e-mail: [email protected]

used as template DNA for single base extension-tag reactions, labeled with Cy3 fluorescent dye and hybridized to DNA microarrays. The detection specificity of this microarray method was 100%, with the sensitivity for pure genomic DNA at 200 fg to 2 pg per reaction. Application of the DNA microarray methodology to 55 naturally contaminated seafood samples (shrimp, fish, and oysters) revealed the presence of V. parahaemolyticus at 50.9% and V. alginolyticus at 32.7%. This corresponds with traditional assays (microbiological and biochemical tests) except one sample which was identified as negative in V. parahaemolyticus by the microarray assay but as positive by the conventional method. Therefore, a combination of multiplex PCR with DNA microarray hybridization based on SBE-TAGS ensures rapid and accurate detection of pathogenic Vibrio species in seafood, thereby providing safer seafood products for consumers at a low financial burden to the aquaculture industry. Keywords Vibrio species . Single base extension-tag on glass slides (SBE-TAGS) . Microarray . Multiplex PCR

Introduction Seven Vibrio species, Vibrio parahaemolyticus, Vibrio cholerae, Vibrio vulnificus, Vibrio mimicus, Vibrio alginolyticus, Vibrio anguillarum, and Vibrio harveyi, have been identified as key pathogens for various reared aquatic animals, especially oysters and penaeid shrimp (Hong et al. 2007; Nhung et al. 2007; Sithigorngul et al. 2007). Consequently, Vibrio infections are more frequently encountered in coastal states such as Japan and the USA (Wittlinger et al. 1995; Mead et al. 1999). Human infections caused by Vibrio species often result from raw, under-

1980

cooked, or improperly processed molluscan shellfish, especially oysters (Lozano-Leon et al. 2003). Early detection for the initiation of treatment is essential, particularly for cholera and invasive Vibrio infections that can result in death within days (Kaper et al. 1995). At present, detection and identification methods for pathogenic Vibrio species in aquaculture systems are imprecise, time consuming, and labor intensive. Conventional detection methods for different Vibrio species are often not able to discriminate among closely related species (Kwok et al. 2002) due to the lack of variable biochemical characteristics (Thompson et al. 2004). The existence of atypical phenotypes in strains isolated from clinical samples as well as from the environment has both been reported (Vieira et al. 2001; Tarr et al. 2007). The diverse phenotypes of isolated strains further complicate identification of Vibrio species by phenotypic characteristics. On the contrary, molecular methods have provided significant advances over conventional methods for the identification and differentiation of closely related Vibrio species. During the last decade, many genetic-based methods for the identification of Vibrio species have been reported (Kim et al. 1999; Nandi et al. 2000; Panicker et al. 2004). Detection of pathogenic Vibrio species by PCR has been shown to be more precise and less time consuming. However, most studies have been focused on identifying specific individual Vibrio species (Kim et al. 1999; Nandi et al. 2000). A rapid yet accurate molecular method for identifying multiple species in a single assay would be an invaluable tool for clinical laboratories. For example, multiplex polymerase chain reaction (multiplex PCR) assays for the identification of three, four, or five different species have recently been developed (Di Pinto et al. 2005; Nhung et al. 2007; Tarr et al. 2007; Teh et al. 2010). A single assay that allows detection of amplicons from all of the pathogenic Vibrio species would increase the speed of detection of potentially harmful seafood. However, comprehensive detection of all of the aforementioned pathogenic Vibrio species is unreliable by conventional multiplex PCR. Furthermore, a real-time PCR using TaqMan probes is limited to detecting only four fluorophores in a single reaction. Recently, the DNA microarray hybridization approach was shown to be effective for the detection of amplicons generated by PCR from multiple food-borne microorganisms including pathogenic strains (Wilson et al. 2002; Keramas et al. 2003; Wang et al. 2007; Suo et al. 2010). This has been proven to be a more specific, sensitive, and accurate detection method compared to multiplex PCR (Kerouanton et al. 2010) with fewer false positive results (Chagovetz and Blair 2009). The other most merit lies in its high throughput, which means multiple pathogens are simultaneously detected in a single test. A single base extension–tag array on glass slides (SBETAGS) method was used for parallel genotyping based on

Appl Microbiol Biotechnol (2011) 89:1979–1990

human single-nucleotide polymorphisms (SNPs) (Hirschhorn et al. 2000). Due to its simplicity, low cost, high specificity, and accuracy (>99%), it has been successfully introduced for rapid detection of food-borne pathogens (Lu et al. 2009). With the increasing incidences of seafood-related illnesses caused by pathogenic Vibrio species, the rapid detection and discrimination of Vibrio species would help to ensure a steady supply of seafood that is safe for consumers and provide long-term financial stability for the aquaculture industry. This study presents an improved method for the comprehensive detection of V. parahaemolyticus, V. cholerae, V. vulnificus, V. mimicus, V. alginolyticus, V. anguillarum, and V. harveyi found in seafood by coupling multiplex PCR with a DNA microarray based on SBE-TAGS.

Materials and methods Bacterial strains and media The bacterial strains used in the present study consisted of 263 strains in 13 Vibrio species and 40 non-Vibrio strains from 10 different genera (Table 1). All Vibrio strains were cultured on tryptic soy agar (TSA) supplemented with 3.5% (w/v) NaCl at a temperature range of 30 °C to 35 °C, while non-Vibrio bacterial strains were grown on TSA at 37 °C. After overnight incubation, bacterial cells were collected by centrifugation and subjected to genomic DNA extraction. Genomic DNA extraction The DNA extraction from bacterial cells was carried out based on a procedure described by Ausubel et al. (1987). Briefly, genomic DNA was extracted from overnight cultures grown on tryptic soy broth (TSB) with 3.5% (w/v) NaCl at 35 °C with phenol–chloroform–isoamyl alcohol (25:24:1) followed by ethanol precipitation. Dried DNA pellets were dissolved in Tris–EDTA (TE) buffer (pH 8.0) and used as DNA templates for PCR. Both the quantity and quality of the purified DNA was determined using a NanoDrop ND-100 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA) by measuring A260 and the ratio of A260/ A280, respectively. Determination of the targeted genes The V. parahaemolyticus species-specific target sequences were mined by the methods developed in our lab (Yu et al. 2010). One of the specific CDSs, D-amino acid dehydrogenase, small subunit (aadS) was chosen to design primers. The other eight target genes were selected based on previous reports (Bej et al. 1999; Bi et al. 2001; Lee et al. 2003; Rivera et al. 2003; Conejero and Hedreyda 2004; Di

Appl Microbiol Biotechnol (2011) 89:1979–1990

1981

Table 1 Bacterial strains used in this study Bacterial species

Strain no.

No. of strains

Vibrio parahaemolyticus V. parahaemolyticus Vibrio cholera Vibrio vulnificus Vibrio vulnificus Vibrio mimicus Vibrio mimicus Vibrio alginolyticus

ATCC17802/33846 SJTUF30001-30238a SJTUF31001-30004a ATCC27562 SJTU37001a ATCC33653 SJTU39001 SJTUF32001-32002a

2 238 4 1 1 1 1 2

Vibrio anguillarum Vibrio harveyi Vibrio harveyi Vibrio campbellii Vibrio fluvialis Vibrio fluvialis Vibrio metschnikovii EL Tor vibrio Vibrio damsela V. sub-group of freshwater Aeromonas hydrophila Pseudomonas fluorescens Pseudomonas aeruginosa Pseudomonas putida Salmonella spp. Staphylococcus aureus Staphylococcus spp. Listeria monocytogenes Escherichia coli O157:H7

SJTUF33001a ATCC33842 BB152, BB170 ATCC33863 ATCC33810 SJTUF36001-36002a SJTUF38001-38002a SJTUF35001a SJTUF34001a SJTUF35001a SJTUF60001-60003a CICC23248 IQCC12625 ATCC17485 ATCC, CMCC ATCC13565 SJTUF40001-40005a ATCC ATCC43889

1 1 2 1 1 2 2 1 1 1 3 1 1 1 14 1 5 9 1

Shigella sonnei Campylobacter jejuni Bacillus cereus Yersinia enterocolitica

CMCC51334 ATCC29428 OX10D C1220 ATCC27729

1 1 1 1

150–500 bp. SBE primers were designed to be 23–25 bp length with a Tm of approximately 68 °C. Probes were selected using Primer Quest software targeting each gene within the amplified segments. All the probes were synthesized with HPLC purification by Invitrogen Corporation (Shanghai, China). Furthermore, BLASTN (http:// blast.ncbi.nlm.nih.gov/Blast.cgi) was utilized to ensure distinct genetic identities. Fabrication of microarrays All of the microarray probes were adjusted to 25 mM in 50% dimethylsulfoxide (DMSO) and printed on glass slides coated with aldehyde groups (CapitalBio Corporation, Beijing, China) using an OmniGrid Accent Microarrayer (GeneMachine, San Carlos, CA, USA) with SMP4 pins (Telechem International, Inc., Sunnyvale, CA, USA). Each microarray chip was imprinted with eight identical arrays, which consisted of 56 dots. Nine target-specific oligonucleotide probes were utilized. One tag was synthesized as a negative control, which comprised of less than 60% genetic similarity to the targeted bacterial strains, and one tag served as positive control that consisted of a complimentary strand of synthesized DNA. The full-length reverse complements of the remaining tags were spotted on the slide in triplicate to create the test array. In addition, two blanks of 50% DMSO were spotted. These different probes were printed in triplicate. This positive control was printed 14 times occupying both the first column and the first row. The schematic diagram of the microarray design and probe locations is shown in Fig. 1. After printing and drying, the microarray chips were incubated at 37 °C to covalently link the oligonucleotides to the substrate-coated slides. Optimization of multiplex PCR

a

Isolates kept in the Department of Food Science and Technology, Shanghai Jiao Tong University

Pinto et al. 2005; Xiao et al. 2009). Primer 3.0 was used to design nine PCR prime sets and nine internal probe sequences (Rozen and Skaletsky 2000).These nine target genes and their accession numbers in GenBank are listed in Table 2. These were used to design both primers and probes for detection. Design of primers and probes The targeted genes, PCR primers, single base extension (SBE) primers, and probes which were used for detecting each of the seven pathogenic Vibrio species are listed in Table 2. The design of PCR primers were based on the following parameters: a Tm near 60 °C, a G-C content of 40–60%, a length of 16–25 bp, and generating a product of

Multiplex PCR reactions used in this study were divided into three groups. The target gene aadS was used to detect all V. parahaemolyticus strains. To distinguish pathogenic strains, tdh and trh were applied. Col, toxR, and vvh were identifiers for V. alginolyticus, V. mimicus, and V. vulnificus, respectively. Additionally, empA, vhh1, and tcpA served as markers for V. anguillarum, V. harveyi, and V. cholera, respectively. The multiplex PCR composition and reaction conditions were optimized based on the electrophoresis results. Each multiplex PCR was performed in 20 μl of solution, consisting of 20 ng of purified genomic DNA from each reference strain, 200 μM deoxynucleoside triphosphates, 1 U of AmpliTaq DNA polymerase, and 1× PCR buffer. The multiplex PCR cycling conditions were as follows: 95 °C for 5 min for denaturation and activation of AmpliTaq DNA polymerase; 30 cycles of denaturation at 94 °C for 30 s, annealing at 60 °C for 60 s, and extension at

1982

Appl Microbiol Biotechnol (2011) 89:1979–1990

Table 2 Primer sequences for PCR amplification and fluorescence labeling Bacteria

Target gene

Primer sequences(5′ to 3′)a

GenBank accession no.

Amplicon size (bp)

V. parahaemolyticus

aadS

aadS-F: TTAAGATGGATGGTTCACTGCTG aadS-R: GGGTTTATTGTATGTCCTGTTTCTG Z1-aadS: AGCGAGCATACGGCAATACTACG TCGGATTTCGTTTTGCGTCC tdh-F: GGTACTAAATGGCTGACATC tdh-R: CCACTACCACTCTCATATGC Z2-tdh:TCAGTCCATCTTGCTACAGGGCTCTT ATAGCCAGACACCGCTGCC trh-F: TTGGCTTCGATATTTTCAGTATCT trh-R: CATAACAAACATATGCCCATTTCCG Z3-trh: GTTTCAGCACATGTCGAGACCTGCC ATCCATACCTTTTCCTTCTCC tcpA-F: GTCTCAGCGGGTGTTGTT tcpA-R: TCCTGGTGCAATGGACTT

BA000031

199

M10069

269

S67850

500

EU649677

475

AY046900

313

EF693743

263

X62635

201

L02528

207

AF217649

279

tdh

trh

V. cholerae

tcpA

V. vulnificus

vvh

V. mimicus

toxR

V. alginolyticus

col

V. anguillarum

empA

V. harveyi

vhh1

a

Z4-tcpA: GACGAGTATATGCATCTGCGGCATT TGCGTTTGCGGTAG vvh-F: GGCTGGGTATTTGATAAGACGA vvh-R: CGTTCTCACCATAAACATCCAG Z5-vvh: CGTTGCCGAGTTTCCATGTATGCAC GATAGTTGAGTTTCACGCCC toxR-F: CAAAACGACATGGATGAGGTA toxR-R: ATAGGCATATTGACGGCTACA Z6-toxR: AACGCTTGGTCTAAACTCCCTCGC TTTTGTCTGCCCGAGGTTGG col-F: CCTTCGCCAACGTCGTAGTGT col-R: AAAGCCTTGATGAGTCGAGCAC Z7-col: CTGAATCCTCCATCCGTGTTCGCGC CCTGACTTAAAATTTCGCTG empA-F: TTCCGTGCTACTGGCGAGGTT empA-R: CGGCTGATACTGGTAGTGCTG Z8-empA: TTGACGCTACAGGTGACGATACT TACATCCAATCAACCACCAGCG vhh1-F: CGTACGCCGCAAACTTAATG vhh1-R: GCGTTGTTTGACTTGCCATAC Z9-vhh1: GATGATCGCTCTACGTGACAAGTC CCAATGTTCATCGGTTTGAGTATCCC

The underlined sequences are the TAG sequences

72 °C for 60 s; and a final extension at 72 °C for 7 min. The amplified DNA fragments were separated in a 2% agarose gel stained with ethidium bromide. SBE-TAGS and DNA labeling The SBE-TAGS array method was described based on Hirschhorn’s methods (2000). The tags are specific sequences with a length of 20–22 bp, and each was genetically unique as well as heterogonous to the known detected genes. Each initial SBE primer was paired with one of the tags to generate a SBE-TAGS sequence with a length of 45–47 bp

binding at the 5′ end. The complementary sequence of the tags was imprinted on the slide to create the tags array. DNA fragments amplified by multiplex PCR were purified and used as templates for the multiplex SBE-TAGS reactions, and labeled with the Cy3 fluorescent dye. The PCR products (5 μl) from each reaction tube were mixed with 1 U SAP and 2 U Exo I and incubated at 37 °C for 30 min. The SAP and Exo I were deactivated at 85 °C for 15 min, and this was followed by the labeling reaction consisting of 5 μmol Cy3ddATP and 1.0 U Thermo Sequence DNA Polymerase. The SBE reactions consisted of 45 cycles of 96 °C for 30 s, 68 °C for 30 s, and 72 °C for 30 s.

Appl Microbiol Biotechnol (2011) 89:1979–1990

1983

Fig. 1 Layout of SBE-TAGS and oligonucleotide probes in the pathogen detection microarray. a A microarray chip was spotted with eight identical arrays. b A scanned image of Cy3-stained array shows the quality of microarray spots. Each array contains triplicate probe

array and the rectangle highlights a single set of probe array. c Oligonucleotide positions in a single set of probes. P positive probe, N negative probe, B blank (spotting buffer)

Hybridization

Sensitivity measurement

Prior to hybridization, each microarray slide was prehybridized at 37 °C for 1 h in a solution containing 2× saline–sodium citrate buffer (SSC), 0.2% sodium dodecyl sulfate (SDS), and 10% bovine serum albumin (BSA). For microarray hybridization, 10 μl Cy3-labeled DNA (approximately 50 μg/μl) from a SBE reaction was mixed with an equal volume of hybridization buffer consisting of 6× SSC, 0.2% SDS, 1 mg/ml Salmon Sperm DNA, and 2 nmol of the Cy3-labeled positive control probe. The DNA was then denatured at 96 °C for 5 min and chilled on ice for 10 min. It was then applied onto the surface of an array which was pre-framed with a 4×2 SmartGrid then covered by a SlipCover (Sigma, USA). Hybridization was performed in the dark at 48 °C for 2 h. After hybridization, slides were washed in 2× SSC/1% SDS at 48 °C for 6 min, then at room temperature washed in 1× SSC/0.5% SDS for 6 min and in 0.5× SSC for 3 min. Before scanning, the slides were rinsed with ddH2O for 1 min and dried briefly.

The sensitivity of the microarray detection was examined by hybridizing the multiplex PCR products amplified from a series of 10-fold diluted DNA mixtures. Genomic DNA was adjusted to a concentration of 20 ng/μl and then diluted in a 10-fold series. These DNA samples were used to perform multiplex PCR, the SBE reactions, chip hybridization, and finally scanned under the same conditions as described above. All these data were analyzed to determine the detection sensitivity limits.

Scanning All of the microarrays were scanned using a GenePix 4000B laser scanner (GeneMachines, USA) at an excitation wavelength of 532 nm for the Cy3 dye. Fluorescent signal of each spot along with the local background was quantified using the GenePix Pro 6.0 software. The average fluorescence of the triplicate probes was used to compare against the negative control. Any spot displaying fluorescence of a magnitude of 10 higher than the negative control present on the same array was considered as positive response.

Detection of Vibrio species in natural seafood samples Fifty-five seafood samples collected from shrimp, fish, and oysters sold at local supermarkets were tested within 12 h. Twenty-five grams of stomach tissue from each specimen was homogenized and put into 225 ml TSB with 3.5% (w/v) NaCl, and enriched at 35 °C for 6 h. One milliliter of aliquot from each sample was centrifuged at 12,000×g for 5 min, washed with 1 ml sterile water then again centrifuged at 12,000×g for 5 min. Precipitates were suspended in 200 μl sterile water and boiled for 10 min, then chilled at −20 °C for an additional 10 min. Following that, the samples were centrifuged at 12,000×g for 10 min. A 3-μl aliquot of the supernatant from each sample was used for PCR amplification and chip hybridization. All these tests were performed in triplicate. Subsequently, the sample homogenates were incubated for 18 h, and a loopful of the enrichment broth was streaked on thiosulfate citrate bile salt sucrose agar and CHROMagar Vibrio (CV) agar media. After being incubated at 37 °C for 18 h, suspected colonies were picked and subjected to a battery of biochemical tests for the identification of Vibrio spp., such as Gram staining, motility test,

1984

triple sugar iron (TSI) test, oxidase test, Voges–Proscauer test, halophilic characteristics (0%, 3%, 6%, 8%, and 10%) test, and finally confirmed by API 20E.

Results Optimization of the multiplex PCR The optimal primer concentration was adjusted based on the results from the agarose gel electrophoresis. The fixed ratios for each of the applied primers were 0.8:0.5:2.5 for trh/tdh/aadS, 1:1:1 for vvh/toxR/col, and 0.5:1:1 for vhh1/ empA/tcpA. Under these conditions, the multiplex PCR reaction provided an elevated amplification efficiency (Fig. 2). To further optimize the reaction, the annealing temperature was also evaluated. Any annealing temperature that was less than 55 °C decreased the specificity. Additionally, any temperature that was greater than 65 °C would decrease the sensitivity of the multiplex PCR. Therefore, 60 °C was determined to be the optimal annealing temperature for the multiplex PCR assay. To avoid producing non-specific amplification fragments that occurred frequently when the PCR program was run for more than 35 cycles (data not shown), only 30 cycles were used. Specificity and sensitivity of the multiplex PCR system A total of 303 bacterial strains including 13 Vibrio species and 10 non-Vibrio genera were tested against the aadS primer for specificity. All of the 240 V. parahaemolyticus strains yielded amplicons of 199 bp. However, none of 63 non-V. parahaemolyticus bacterial strains yielded an amplicon (see the electronic supplementary material). To determine the accuracy of multiplex amplifications, 20 ng of genomic DNA from each reference

Fig. 2 Multiplex PCR profiles of the reference strains. Each multiplex PCR contained three sets of primers and one or three genomic DNA from the following strains. Lane M 100-bp DNA ladder, lane 1 V. parahaemolyticus (trh), lane 2 V. parahaemolyticus (tdh), lane 3 V. parahaemolyticus (aadS), lane 4 V. parahaemolyticus (trh, tdh, aadS), lane 5 V. vulnificus (vvh), lane 6 V. alginolyticus (col), lane 7 V.

Appl Microbiol Biotechnol (2011) 89:1979–1990

strain was tested using the optimized multiplex PCR systems described above. All of the nine target genes from the seven major Vibrio species were specifically amplified as shown in Fig. 2. These tests supports the claim that aadS (199 bp) is able to identify V. parahaemolyticus. These bacteria were further distinguished as pathogenic subspecies using tdh (269 bp) and trh (500 bp) markers (Fig. 2, lanes 1–4). Target genes vvh (313 bp), col (201 bp), and toxR (263 bp) for V. vulnificus, V. alginolyticus, and V. mimicus, respectively, and target genes vhh1 (279 bp), empA (207 bp), and tcpA (475 bp) for V. harveyi, V. anguillarum, and V. cholera, respectively, were amplified as expected (Fig. 2, lanes 5–12). The sensitivity of the multiplex PCR was evaluated using a mixture of three pairs of primers. Genomic DNA of V. parahaemolyticus was diluted to 20 ng, and a series of 10-fold dilutions ranging from 20 to 2×10−5 ng/μl were used for the multiplex PCR assay. As shown in Fig. 3, the targeted genes aadS, tdh, and trh of V. parahaemolyticus were simultaneously amplified in a single reaction with a detection limit of 2 pg (approximately 350 V. parahaemolyticus genome equivalents) (Bej et al. 1991) (Fig. 3, lane 5). Specificity of oligonucleotide probes used in DNA microarray hybridization A typical hybridization pattern for a microarray with the capture probes in triplicate and the hybridization of amplicons from the three multiplex PCR reactions to the DNA microarray are shown in Fig. 1a and b. Both individual and multiplexed targets from the seven Vibrio species were hybridized to their complementary probes (100% specificity) at a hybridization temperature (48 °C) for 2 h (Figs. 4 and 5). When two DNA templates from any two reference strains were combined randomly and used in multiplex PCR, the amplicons were detected with high specificity by microarray

mimicus (toxR), lane 8 V. vulnificus (vvh), V. alginolyticus (col), V. mimicus (toxR), lane 9 V. harveyi (vhh1), lane 10 V. anguillarum (empA), lane 11 V. cholerae (tcpA), lane 12 V. harveyi (vhh1), V. anguillarum (empA), V. cholerae (tcpA). The amplified PCR products were resolved in a 2.0% agarose gel

Appl Microbiol Biotechnol (2011) 89:1979–1990

1985

V. harveyi, V. anguillarum, and V. cholera, respectively (Fig. 5f). All nine target genes for positive hybridization are shown along with the products from the three multiplex PCR in Fig. 5g. Sensitivity of the oligonucleotide probes in DNA microarray hybridization

Fig. 3 Sensitivity of multiplex PCR amplification. A series of 10-fold diluted genomic DNA of V. parahaemolyticus was used for sensitivity evaluations. Each multiplex PCR tube contained three sets of primers. Lane M 100-bp DNA ladder, lanes 1–7 10-fold series dilutions of the genomic DNA mixtures ranging from 20 to 2×10−5 ng of DNA, lane 8 ddH2O

detection (Fig. 5a–c). As expected, three targets (aadS, tdh, and trh) in V. parahaemolyticus were detected simultaneously (Fig. 5d). Gene segments of vvh, col, and toxR in V. vulnificus, V. alginolyticus, and V. mimicus were specifically hybridized to their respective probes (Fig. 5e); similar results were observed with targeted genes vhh1, empA, and tcpA for Fig. 4 Specificity of microarray in detecting individual seafood-borne pathogen with multiplex targets. Genomic DNA from each of the following strains was used for the amplification in the multiplex PCR and then detected by the microarray. a V. parahaemolyticus (trh); b V. parahaemolyticus (tdh); c V. parahaemolyticus (aadS); d V. vulnificus (vvh); e V. alginolyticus (col); f V. mimicus (toxR); g V. harveyi (vhh1); h V. anguillarum (empA); i V. cholerae (tcpA)

The sensitivity of the microarray detection was examined by hybridizing the oligonucleotide probes with the multiplex PCR products amplified from a series of 10-fold diluted genomic DNA from a single strain or a mixture. The DNA mixtures consisted of 20 ng to 2×10−5 ng of genomic DNA from each reference strain. For all the probes printed at 25 mM, the sensitivity of the microarray detection was 200 fg from one pathogen (Fig. 6) while set at 2 pg of genomic DNA for a mixture of several DNA samples (Fig. 7). A positive fluorescent signal in the array was obtained even at a DNA concentration of 2×10−5 ng/μl corresponding to four genome equivalents (data not shown). This method has shown to be more sensitive than

1986

Appl Microbiol Biotechnol (2011) 89:1979–1990

Fig. 5 Specificity of microarray in detecting multiple pathogenic Vibrio species with multiplex targets. a V. harveyi (vhh1), V. anguillarum (empA); b V. mimicus (toxR), V. alginolyticus (col); c V. mimicus (toxR), V. vulnificus (vvh); d V. parahaemolyticus (trh, tdh, aadS); e V. vulnificus (vvh), V. alginolyticus (col), V. mimicus (toxR); f V. harveyi (vhh1), V. anguillarum (empA), V. cholerae (tcpA); g V. parahaemolyticus (trh, tdh, aadS), V. vulnificus (vvh), V. alginolyticus (col), V. mimicus (toxR), V. harveyi (vhh1), V. anguillarum (empA), V. cholerae (tcpA)

the singleplex and multiplex PCR (Bej et al. 1991; Lee et al. 2003). Detection of Vibrio species in natural seafood samples by microarray The identity of PCR-amplified target genes from 55 seafood samples (oysters, fish, and shrimp) enriched for 6 h was confirmed by DNA microarray hybridization Fig. 6 Sensitivity of microarray in detecting one pathogenic Vibrio species with multiplex targets. Genomic DNA was extracted from V. anguillarum. A series of 10-fold diluted DNA ranging from 20 ng to 2× 10−5 ng of DNA (a–g) was used as a template in the multiplex PCR amplification followed by the microarray analysis. h ddH2O

(Fig. 8). V. parahaemolyticus was found to be present in 28 samples (50.9%), V. alginolyticus in 18 samples (32.7%), and only two samples were contaminated by V. harveyi (Table 3). Of all samples, there were 18 samples which contained V. parahaemolyticus and V. alginolyticus. None of the samples tested positive for the tcpA, vvh, empA, and toxR targeted genes, suggesting that no V. cholerae, V. vulnificus, V. mimicus, and V. anguillarum was present in these seafood samples. To verify the microarray

Appl Microbiol Biotechnol (2011) 89:1979–1990

1987

Fig. 7 Sensitivity of microarray in detecting V. parahaemolyticus with three targets. Genomic DNA was extracted from V. parahaemolyticus. A series of 10-fold diluted DNA ranging from 2 ng to 2×10−5 ng of DNA (a–f) was used as a template in the multiplex PCR amplification followed by the microarray analysis

results, the same enriched seafood samples were examined for each of these pathogens using the conventional assays (biochemical tests); the results are shown in Table 3. One sample that was positive for V. parahaemolyticus by traditional microbiological and biochemical methods was not detected by the SBE-TAGS microarray method. Fig. 8 Application of the microarray detection in 55 naturally contaminated seafood samples. a Microarray hybridization results from seven pathogenic reference strains used in this study. b Microarray hybridization results from sample no. 5. c Microarray hybridization results from sample no. 7. d Microarray hybridization results from s ample no. 16. e Microarray hybridization results from sample no. 42. f ddH2O

Discussion Conventional methods for detection of food-borne pathogens include culture enrichment, selective plating for pathogen isolation, followed by biochemical identification and serological confirmation. It typically takes 5–7 days to

1988 Table 3 DNA microarray detection of 55 naturally contaminated seafood samples compared with biochemical tests

ND not detected

Appl Microbiol Biotechnol (2011) 89:1979–1990 Strains

V. V. V. V. V. V. V. V.

parahaemolyticus cholerae vulnificus mimicus alginolyticus anguillarum harveyi parahaemolyticus+V. alginolyticus

complete the whole procedure for each species. To simultaneously detect multiple pathogenic Vibrio species in seafood, conventional methods have proven ineffective, often misidentifying pathogens with similar microbiological or biochemical characteristics. In this study, a DNA microarray coupled with multiplex PCR based on SBETAGS was established to detect the seven leading pathogenic Vibrio species in seafood. This method presents a valid alternative molecular approach for the specific and rapid detection of these seven species, i.e., V. parahaemolyticus, V. cholerae, V. vulnificus, V. mimicus, V. alginolyticus, V. anguillarum, and V. harveyi. In the present approach, only 16 h was needed to achieve a detection result of V. parahaemolyticus in seafood, which was much shorter than the conventional methods. By the end of March 2010, the sequence information on the complete genomics of 1,052 bacteria are available in public databases, which provides a tool for us to mine new more species-specific target genes. Computational genomics has led the way to efficient and customized mining of genomes for species-specific nucleotide sequences. The BLAST program, a frequently used tool for nucleotide sequence comparison, has been applied to identify specific targets for the detection and identification of bacterial pathogens (Oggioni and Pozzi 2001; Kim et al. 2006, 2008). In this study, we identified a new speciesspecific gene encoding D-amino acid dehydrogenase, small subunit (aadS) for V. parahaemolyticus by searching against the local database of standalone BLAST (Yu et al. 2010). To aadS, col, and empA, they were found to be specific for V. parahaemolyticus, V. alginolyticus, and V. anguillarum by the online BLAST alignment, and their specificity was further verified by the PCR assay (see the electronic supplementary material, Fig. S1–Fig. S20), which indicated that these target genes were reliable to be served as the target genes for V. parahaemolyticus, V. alginolyticus, and V. anguillarum. This demonstrated the powerful potential of bioinformatics in the development of methods for detection of food-borne pathogens.

Biochemical tests

Microarray

Positive

Negative

Positive

Negative

29 0 0 0 18 0 ND 18

26 0 0 0 37 0 ND 37

28 0 0 0 18 0 2 18

27 0 0 0 37 0 53 37

Previous studies showed that it was necessary to target multiple genes for PCR amplification in order to simultaneously identify several potentially pathogenic strains (Di Pinto et al. 2005; Nhung et al. 2007; Tarr et al. 2007; Teh et al. 2010). However, some researchers chose a consensus gene found in many pathogenic bacteria, designing only a single pair of universal primers for the amplicons of the conserved stretches of the DNA fragments (Wang et al. 2007). The conserved stretches were then distinguished from each other by specific oligonucleotide probes, which targeted the variable regions, bound on the gene chip. The conserved consensus genes including the 16S ribosomal RNA, 23S rRNA, and 16S–23S rRNA spacer region have commonly been used. The drawback is that the 16S rRNA genes share high sequence similarity which results in low discriminatory ability, particularly in some closely related bacteria. Specifically, the 16S rRNA gene sequences among the Vibrionaceae family showed more than 90% nucleotide sequence similarity by analyzing this gene in 34 Vibrio strains (Urakawa et al. 1997). In the current study, seven species-specific genes and corresponding probes based on SBE-TAGS ensure high levels of specificity and accuracy, reducing pseudo-positive results from multiplex PCR. SBETAGS arrays, while historically used for parallel genotyping of generating human SNPs, have a great potential for pathogenic detection as a method that is simple, reliable, and inexpensive (Hirschhorn et al. 2000). The sensitivity of the multiplex PCR determines the detection limits of the DNA microarray. Factors such as the selection of the species-specific targeted genes, design of primers and probes, concentration and ratio of primers, and the reaction conditions of the multiplex PCR all must be considered carefully to achieve the lowest possible detection limit. Several DNA labeling methods have been reported for PCR products. A well-established fluorescent label, Cy3 fluorophore, predominantly for microarray technology (Ahn and Walt 2005), was used in this study for the DNA microarray scanning, which increased sensitivity detection limits 10- to 100-fold compared to PCR methods.

Appl Microbiol Biotechnol (2011) 89:1979–1990

The enrichment of oyster tissue homogenates is a necessary step for the detection of V. vulnificus and V. parahaemolyticus (Blackstone et al. 2003). This method of enriching targeted pathogens in animal tissue homogenized samples was proven effective. However, a possible inhibition effect occurred when samples were applied to the DNA microarray producing a single false negative result. As previously reported, oysters and other bivalve shellfish are inherently complicated matrices for molecular detection of pathogens due to high levels of naturally incurring inhibitors (Furuya et al. 2009). In future work, it may be possible to use internal amplification control (De Medici et al. 2009) to detect the presence of PCR inhibitors. Once identified, an improved DNA extraction method could also decrease the affect of inhibitors. In summary, the oligonucleotide microarray hybridization protocol based on SBE-TAGS described herein provides a sensitive and specific method. The cost of each sample for this assay was approximately $7 or less. However, seven key pathogenic Vibrio species simultaneously were detected in a single test, and V. parahaemolyticus was further capable of being discriminated to virulent or non-virulent strains by the hybridization results, and this assay is suitable for large-scale testing of multiple pathogens in the seafood industry. To our knowledge, this is the first description of a comprehensive DNA microarray based on SBE-TAGS for the detection of seven leading pathogenic Vibrio species in seafood samples. This method is also highly adaptable for the detection and identification of other food-borne pathogens. The specific target spectra of this gene chip may be expanded through the addition of newly designed oligonucleotide probes to the microarray. Acknowledgments This study was supported by grants No. 2009BAK43B31 and 2009BADB9B01 from the Ministry of Science & Technology of China, and grant No. 31000063 from the National Natural Science Foundation of China, and grant No. 09142201200 from Science & Technology Commission of Shanghai Municipality.

References Ahn S, Walt DR (2005) Detection of Salmonella spp. using microsphere-based, fiber-optic DNA microarrays. Anal Chem 77:5041–5047 Ausubel FM, Brent R, Kingston RE, Moore DD, Sideman J, Smith J, Struhl K (1987) Current protocols in molecular biology. Wiley, New York Bej AK, Mahbubani MH, Atlas RM (1991) Amplification of nucleic acids by polymerase chain reaction (PCR) and other methods and their applications. Crit Rev Biochem Mol Biol 26:301–334 Bej AK, Patterson DP, Brasher CW, Vickery MC, Jones DD, Kaysner CA (1999) Detection of total and hemolysin-producing Vibrio parahaemolyticus in shellfish using multiplex PCR amplification of tl, tdh and trh. J Microbiol Methods 36:215–225

1989 Bi K, Miyoshi SI, Tomochika KI, Shinoda S (2001) Detection of virulence associated genes in clinical strains of Vibrio mimicus. Microbiol Immunol 45:613–616 Blackstone GM, Nordstrom JL, Vickery MC, Bowen MD, Meyer RF, DePaola A (2003) Detection of pathogenic Vibrio parahaemolyticus in oyster enrichments by real time PCR. J Microbiol Methods 53:149–155 Chagovetz A, Blair S (2009) Real-time DNA microarrays: reality check. Biochem Soc Trans 37:471–475 Conejero MJ, Hedreyda CT (2004) PCR detection of hemolysin (vhh) gene in Vibrio harveyi. J Gen Appl Microbiol 50:137–142 De Medici D, Anniballi F, Wyatt GM, Lindstrom M, Messelhausser U, Aldus CF, Delibato E, Korkeala H, Peck MW, Fenicia L (2009) Multiplex PCR for detection of botulinum neurotoxinproducing clostridia in clinical, food, and environmental samples. Appl Environ Microbiol 75:6457–6461 Di Pinto A, Ciccarese G, Tantillo G, Catalano D, Forte VT (2005) A collagenase-targeted multiplex PCR assay for identification of Vibrio alginolyticus, Vibrio cholerae, and Vibrio parahaemolyticus. J Food Prot 68:150–153 Furuya S, Suzuki S, Kobayashi H, Saito S, Takayanagi T (2009) Rapid method for detecting resistance to a QoI fungicide in Plasmopara viticola populations. Pest Manag Sci 65:840–843 Hirschhorn JN, Sklar P, Lindblad-Toh K, Lim YM, Ruiz-Gutierrez M, Bolk S, Langhorst B, Schaffner S, Winchester E, Lander ES (2000) SBE-TAGS: an array-based method for efficient singlenucleotide polymorphism genotyping. Proc Natl Acad Sci U S A 97:12164–12169 Hong GE, Kim DG, Bae JY, Ahn SH, Bai SC, Kong IS (2007) Species-specific PCR detection of the fish pathogen, Vibrio anguillarum, using the amiB gene, which encodes Nacetylmuramoyl-L-alanine amidase. FEMS Microbiol Lett 269:201–206 Kaper JB, Morris JG Jr, Levine MM (1995) Cholera. Clin Microbiol Rev 8:48–86 Keramas G, Bang DD, Lund M, Madsen M, Rasmussen SE, Bunkenborg H, Telleman P, Christensen CB (2003) Development of a sensitive DNA microarray suitable for rapid detection of Campylobacter spp. Mol Cell Probes 17:187–196 Kerouanton A, Marault M, Petit L, Grout J, Dao TT, Brisabois A (2010) Evaluation of a multiplex PCR assay as an alternative method for Listeria monocytogenes serotyping. J Microbiol Methods 80:134–137 Kim YB, Okuda J, Matsumoto C, Takahashi N, Hashimoto S, Nishibuchi M (1999) Identification of Vibrio parahaemolyticus strains at the species level by PCR targeted to the toxR gene. J Clin Microbiol 37:1173–1177 Kim HJ, Park SH, Lee TH, Nahm BH, Chung YH, Seo KH, Kim HY (2006) Identification of Salmonella enterica serovar Typhimurium using specific PCR primers obtained by comparative genomics in Salmonella serovars. J Food Prot 69:1653–1661 Kim HJ, Park SH, Lee TH, Nahm BH, Kim YR, Kim HY (2008) Microarray detection of food-borne pathogens using specific probes prepared by comparative genomics. Biosens Bioelectron 24:238–246 Kwok AY, Wilson JT, Coulthart M, Ng LK, Mutharia L, Chow AW (2002) Phylogenetic study and identification of human pathogenic Vibrio species based on partial hsp60 gene sequences. Can J Microbiol 48:903–910 Lee CY, Panicker G, Bej AK (2003) Detection of pathogenic bacteria in shellfish using multiplex PCR followed by CovaLink NH microwell plate sandwich hybridization. J Microbiol Methods 53:199–209 Lozano-Leon A, Torres J, Osorio CR, Martinez-Urtaza J (2003) Identification of tdh-positive Vibrio parahaemolyticus from an outbreak associated with raw oyster consumption in Spain. FEMS Microbiol Lett 226:281–284

1990 Lu C, Shi C, Zhang C, Chen J, Shi X (2009) Development of single base extension-tags microarray for the detection of food-borne pathogens. Sheng Wu Gong Cheng Xue Bao 25:554–559 Mead PS, Slutsker L, Griffin PM, Tauxe RV (1999) Food-related illness and death in the United States reply to Dr. Hedberg. Emerg Infect Dis 5:841–842 Nandi B, Nandy RK, Mukhopadhyay S, Nair GB, Shimada T, Ghose AC (2000) Rapid method for species-specific identification of Vibrio cholerae using primers targeted to the gene of outer membrane protein OmpW. J Clin Microbiol 38:4145–4151 Nhung PH, Ohkusu K, Miyasaka J, Sun XS, Ezaki T (2007) Rapid and specific identification of 5 human pathogenic Vibrio species by multiplex polymerase chain reaction targeted to dnaJ gene. Diagn Microbiol Infect Dis 59:271–275 Oggioni MR, Pozzi G (2001) Comparative genomics for identification of clone-specific sequence blocks in Streptococcus pneumoniae. FEMS Microbiol Lett 200:137–143 Panicker G, Call DR, Krug MJ, Bej AK (2004) Detection of pathogenic Vibrio spp. in shellfish by using multiplex PCR and DNA microarrays. Appl Environ Microb 70:7436–7444 Rivera IN, Lipp EK, Gil A, Choopun N, Huq A, Colwell RR (2003) Method of DNA extraction and application of multiplex polymerase chain reaction to detect toxigenic Vibrio cholerae O1 and O139 from aquatic ecosystems. Environ Microbiol 5:599–606 Rozen S, Skaletsky H (2000) Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S, Misener S, Misener S (eds) Bioinformatics methods and protocols: methods in molecular biology. Humana, Totowa, pp 365–386 Sithigorngul P, Rukpratanporn S, Pecharaburanin N, Suksawat P, Longyant S, Chaivisuthangkura P, Sithigorngul W (2007) A simple and rapid immunochromatographic test strip for detection of pathogenic isolates of Vibrio harveyi. J Microbiol Methods 71:256–264 Suo B, He Y, Paoli G, Gehring A, Tu SI, Shi X (2010) Development of an oligonucleotide-based microarray to detect multiple foodborne pathogens. Mol Cell Probes 24:77–86

Appl Microbiol Biotechnol (2011) 89:1979–1990 Tarr CL, Patel JS, Puhr ND, Sowers EG, Bopp CA, Strockbine NA (2007) Identification of Vibrio isolates by a multiplex PCR assay and rpoB sequence determination. J Clin Microbiol 45:134–140 Teh CS, Chua KH, Thong KL (2010) Simultaneous differential detection of human pathogenic and nonpathogenic Vibrio species using a multiplex PCR based on gyrB and pntA genes. J Appl Microbiol 108:1940–1945 Thompson FL, Iida T, Swings J (2004) Biodiversity of Vibrios. Microbiol Mol Biol Rev 68:403–431, table of contents Urakawa H, Kita-Tsukamoto K, Ohwada K (1997) 16S rDNA genotyping using PCR/RFLP (restriction fragment length polymorphism) analysis among the family Vibrionaceae. FEMS Microbiol Lett 152:125–132 Vieira VV, Teixeira LF, Vicente AC, Momen H, Salles CA (2001) Differentiation of environmental and clinical isolates of Vibrio mimicus from Vibrio cholerae by multilocus enzyme electrophoresis. Appl Environ Microbiol 67:2360–2364 Wang XW, Zhang L, Jin LQ, Jin M, Shen ZQ, An S, Chao FH, Li JW (2007) Development and application of an oligonucleotide microarray for the detection of food-borne bacterial pathogens. Appl Microbiol Biotechnol 76:225–233 Wilson WJ, Strout CL, DeSantis TZ, Stilwell JL, Carrano AV, Andersen GL (2002) Sequence-specific identification of 18 pathogenic microorganisms using microarray technology. Mol Cell Probes 16:119–127 Wittlinger F, Steffen R, Watanabe H, Handszuh H (1995) Risk of cholera among Western and Japanese travelers. J Travel Med 2:154–158 Xiao P, Mo ZL, Mao YX, Wang CL, Zou YX, Li J (2009) Detection of Vibrio anguillarum by PCR amplification of the empA gene. J Fish Dis 32:293–296 Yu S, Chen W, Wang D, He X, Zhu X, Shi X (2010) Species-specific PCR detection of the food-borne pathogen Vibrio parahaemolyticus using the irgB gene identified by comparative genomic analysis. FEMS Microbiol Lett 307:65–71