Development of an Event-Specific Hydrolysis Probe Quantitative Real ...

Article pubs.acs.org/JAFC

Development of an Event-Specific Hydrolysis Probe Quantitative Real-Time Polymerase Chain Reaction Assay for Embrapa 5.1 Genetically Modified Common Bean (Phaseolus vulgaris) Diana Treml,† Gustavo L. Venturelli,† Fábio C. A. Brod,† Josias C. Faria,‡ and Ana C. M. Arisi*,† †

Departamento de Ciência e Tecnologia de Alimentos, Centro de Ciências Agrárias, Universidade Federal de Santa Catarina, Rod. Admar Gonzaga 1346, 88034-001 Florianópolis, Santa Catarina, Brazil ‡ Embrapa Arroz e Feijão, Caixa Postal 179, 75375-000 Santo Antônio de Goiás, Goiás, Brazil S Supporting Information *

ABSTRACT: A genetically modified (GM) common bean event, namely Embrapa 5.1, resistant to the bean golden mosaic virus (BGMV), was approved for commercialization in Brazil. Brazilian regulation for genetically modified organism (GMO) labeling requires that any food containing more than 1% GMO be labeled. The event-specific polymerase chain reaction (PCR) method has been the primary trend for GMO identification and quantitation because of its high specificity based on the flanking sequence. This work reports the development of an event-specific assay, named FGM, for Embrapa 5.1 detection and quantitation by use of SYBR Green or hydrolysis probe. The FGM assay specificity was tested for Embrapa 2.3 event (a noncommercial GM common bean also resistant to BGMV), 46 non-GM common bean varieties, and other crop species including maize, GM maize, soybean, and GM soybean. The FGM assay showed high specificity to detect the Embrapa 5.1 event. Standard curves for the FGM assay presented a mean efficiency of 95% and a limit of detection (LOD) of 100 genome copies in the presence of background DNA. The primers and probe developed are suitable for the detection and quantitation of Embrapa 5.1. KEYWORDS: common bean, qPCR, TaqMan, SYBR Green, GMO

■

three intact copies of AtAhas gene. It is flanked by Phaseolus genomic sequences and interspersed with one nuclear and three chloroplastic genomic sequences.4 In 2011, the Brazilian National Technical Commission on Biosafety (CTNBio) approved this GM event for cultivation and consumption in Brazil. Legislation in Brazil demands the labeling of food and feed products consisting of or containing “more than 1% genetically modified organisms”.5 The European Union (EU) requires compulsory labeling for food products containing more than 0.9% authorized genetically modified organism (GMO).6 The European Commission published regulations for low-level presence of non-EUapproved events that were considered safe by the European Food Safety Authority (EFSA). For such events there is a tolerance for the presence of up to 0.1% in feed.7,8 Thus, suitable and reliable methods for GMO quantitation are highly required for meeting the legal requirements. Quantitative realtime polymerase chain reaction (PCR) targeting specific DNA fragments is currently the method of choice for GMO identification and quantitation. In particular, event-specific PCR, which targets the unique junction sequence between host genomic DNA and inserted DNA, is being widely used for determining the relative DNA amount in GM foods.9−13

INTRODUCTION Common bean (Phaseolus vulgaris) is a source of protein in the diet of over a billion people worldwide. Golden mosaic of common bean is a disease caused by bean golden mosaic virus (BGMV) and it is one of the greatest constraints on bean production in Latin America, with significant yield losses. Expression of the AC1 viral gene was silenced by use of RNA interference (RNAi) constructs in order to silence the AC1 viral gene in transgenic common bean.1 In these genetically modified (GM) plants, the sequence-specific degradation of target mRNA interferes with viral replication, reducing or preventing viral DNA accumulation and, consequently, appearance of symptoms.1 Twenty-two lines were obtained with an intronhairpin construct designed to induce post-transcriptional gene silencing of the AC1 gene. These lines were first evaluated under greenhouse conditions. Two of these GM lines (named Embrapa 2.3 and Embrapa 5.1) showed high resistance to BGMV (∼93% of the plants were symptom-free) upon inoculation at high pressure (>300 viruliferous whiteflies/ plant during the plant’s entire life cycle) and at a very early stage of plant development.2 Homozygous progeny of both events showed complete resistance.3 Embrapa 5.1 GM common bean event was the first commercial GM plant developed in Latin America by the Brazilian Agricultural Research Corporation (Embrapa). Detailed molecular characterization of Embrapa 5.1 event was recently published.4 Identification of a transgene insert confirmed the presence of a single locus corresponding to two intact copies of RNAi cassette in opposite orientation and © 2014 American Chemical Society

Received: Revised: Accepted: Published: 11994

August 14, 2014 November 10, 2014 November 15, 2014 November 15, 2014 dx.doi.org/10.1021/jf503928m | J. Agric. Food Chem. 2014, 62, 11994−12000

Journal of Agricultural and Food Chemistry

Article

Chemicals. DNA extraction performed with DNeasy plant minikit used all reagents provided by Qiagen (Valencia, CA): buffer AP1, RNase A, buffer P3, QIAshredder spin column, buffer AW1, DNeasy mini spin column, buffer AW2, and buffer AE. Ethanol, chloroform, and sodium chloride were purchased from Synth (São Paulo, Brazil); 2-propanol was purchased from Vetec (Rio de Janeiro, Brazil), proteinase K was from Promega (Madison, WI), and CTAB was from USB (Cleveland, OH). qPCR reagents (2× SYBR Green master mix and 2× TaqMan universal PCR master mix) were purchased from Applied Biosystems (Foster City, CA). The primer pair, named BeanF/VectorR, was synthesized by IDT (Coralville, IA) and the TaqMan probe, named FGM, was synthesized by Life Technologies (Foster City, CA). Real-Time PCR Conditions. Quantitative real-time polymerase chain reaction (qPCR) was performed in ABI PRISM 7500 detection system (Applied Biosystems, Foster City, CA). The amplification reactions were carried out in a final volume of 25 μL containing 12.5 μL of 2× SYBR Green master mix or 2× TaqMan universal PCR master mix, primer pair, probe, water, and 50 ng of template DNA. All reactions were carried out in duplicate under the following cycling conditions: 2 min at 50 °C; 10 min at 95 °C; 40 cycles of 15 s at 94 °C and 1 min at 60 °C. All real-time PCR runs were evaluated separately by using the automatic software settings for each run. Tested and optimized primer pair and probe concentrations are presented in Table 2.

We have previously developed a construct-specific method for detection and quantitation of Embrapa 5.1 GM common bean, named OLA assay.14,15 However, it is necessary to develop an event-specific assay in order to distinguish authorized and unauthorized GM events containing the same inserted DNA. OLA assay was unable to differentiate between Embrapa 2.3 and Embrapa 5.1 events. The present work reports the development of an event-specific method for detection and quantitation of Embrapa 5.1 GM common bean. In the present work, we designed a primer pair and a hydrolysis probe targeting a junction sequence between the common bean genomic DNA and the inserted DNA of Embrapa 5.1 GM common bean. This event-specific DNA assay, named FGM assay, was the first assay successfully developed for specific realtime PCR quantitation of Embrapa 5.1 event.

■

MATERIALS AND METHODS

Plant Material. Two Embrapa 5.1 GM common bean lines, namely GM Pérola and GM Pontal, derived from the cultivars Pérola and Pontal, respectively, were used as positive controls. Non-GM Pérola, non-GM Pontal, 44 different Phaseolus vulgaris L. non-GM varieties, cowpea (Vigna unguiculata L.), lima bean (Phaseolus lunatus), and sword bean (Canavalia gladiata) were used as negative controls. The GM common bean Embrapa 2.3, a noncommercial event that contains the same construct of Embrapa 5.1, was used as the main negative control. Seeds of these samples were provided by Embrapa Arroz e Feijão (Santo Antônio de Goiás, GO, Brazil). Non-GM soybean and pea grains were purchased from local markets in Florianópolis, SC, Brazil. Certified reference materials (CRM) from RR soybean (5%, BF410), MON810 (5%, BF413f), Bt11 (4.89%, BF412f) and Bt176 (5%, BF411f) were purchased from IRMM (Institute for Reference Material and Measurements, Geel, Belgium). Leaf material was obtained as follows: Two seeds of each sample were placed on moistened germination paper and germinated in a growth chamber at 25 °C without light for 2 days. Afterward, seeds were transferred to seedling pots containing soil and cultivated in a controlled environment growth chamber, adjusted to 12 h photoperiod, photosynthetic active radiation of 150 μmol·m−2·s−1, at 25 °C, watered daily. After 11 days, leaves were collected and stored at −80 °C. Powder seed material was obtained as follows: Embrapa 5.1 GM common bean seeds were cryo-ground in an analytical mill (IKA model A11 basic), followed by manual crushing with mortar and pestle in the presence of liquid nitrogen. DNA Extraction. Genomic DNA was extracted from frozen leaf material by two protocols: cetyltrimethylammonium bromide (CTAB) and DNeasy plant minikit (Qiagen).16 Genomic DNA was extracted from seed material by use of DNeasy plant minikit (Qiagen). DNA was extracted at least twice for each sample. DNA concentration was estimated from measurements at 260 and 280 nm on a Thermo Scientific NanoDrop 2000 spectrophotometer (Wilmington, DE). Primers and Probe Design. Primers and probe were designed on the basis of the Embrapa 5.1 GM common bean DNA sequence that was provided by EMBRAPA (Figure S1, Supporting Information). Primer Express 3.0 software (Applied Biosystems) was used for designing the primers and the probe in the border junction sequence of common bean DNA and inserted DNA (Table 1).

Table 2. Primers and FGM Probe Concentrations Used for Event-Specific qPCR of Embrapa 5.1 GM Common Bean SYBR Green Tested Concentrations (nmol/L) BeanF/VectorR primers 100, 200, 300, 400, 500 FGM probe Optimized Concentrations (nmol/L) BeanF/VectorR primers 300 FGM probe

a

oligonucleotide

sequence 5′−3′ CTGATTCAATCGACGCCTTACTT CGCGGTATTATCCCGTATTGAC VIC-TTAATAAATAAGTGGATCTCTTGCC-MGB

300 150, 250 300 250

Specificity of Primer Pair and Probe. The specificity of SYBR Green assay was assessed by use of DNA extracted from soybean, pea, non-GM common beans Pérola and Pontal, GM common bean Embrapa 2.3, and two GM common beans Embrapa 5.1 (GM Pérola and GM Pontal). Primer specificity was evaluated under the PCR conditions described in the previous section. In order to evaluate the specificity of FGM assay, negative samples were tested, including 46 P. vulgaris varieties (including non-GM Pérola and Pontal), one P. lunatus, one V. unguiculata, one C. gladiata, and Embrapa 2.3 GM. Primers and probe concentrations were respectively 300 and 250 nM. Construction of Standard Curves. Genomic DNA isolated from leaves of Embrapa 5.1 GM common bean was used for serial dilution in water, to final concentrations from 105 to 100 DNA copies, or in DNA solution of non-GM common bean, to final concentrations of 102 and 101 DNA copies. The number of genome copies was calculated from the equation m = n(660)(1/6.023 × 1023), incorporating the 1C value of 637 Mbp for P. vulgaris L., the molecular weight of DNA (660 Da/bp), and Avogadro’s constant. Therefore, the estimated number of genome copies in standard curves ranged from 105 to 100 copies of haploid genome, corresponding to mass quantities of 69.8 to (6.98 × 10−4) ng of DNA that were used as template in PCR. Amplification efficiency values were calculated from the equation E = (10−1/S − 1) × 100, where E is the efficiency (percent) and s is the slope obtained from the standard curve. qPCR Assay Repeatability. Repeatability of the TaqMan FGM assay for DNA samples extracted with DNeasy plant minikit was evaluated by two approaches. In the first approach, DNA samples extracted from Embrapa 5.1 GM Pérola and Embrapa 5.1 GM Pontal were analyzed in three PCR runs, on different days, in duplicate. The second approach was performed with three DNA extracts from

Table 1. Primers and FGM Probe Sequences Designed for Event-Specific qPCR of Embrapa 5.1 GM Common Beana BeanF primer VectorR primer FGM probe

TaqMan

Amplicon size is 77 bp. 11995

dx.doi.org/10.1021/jf503928m | J. Agric. Food Chem. 2014, 62, 11994−12000

Journal of Agricultural and Food Chemistry

Article

Embrapa 5.1 GM Pérola. The PCR runs were performed in 4 days, by use of the three DNA extracts, in duplicate. Repeatability of the TaqMan assay for samples extracted with CTAB was performed with one DNA sample extracted from Embrapa 5.1 GM Pérola and one DNA sample extracted from Embrapa 5.1 GM Pontal in four qPCR runs, in duplicate.

and the results obtained in the specificity tests, the primer concentration of 300 nM was selected to be used in further experiments. qPCR Parameters for TaqMan Assay of Leaf DNA. Standard curves were obtained for 250 and 150 nM FGM probe concentrations, 300 nM BeanF/VectorR primer pair, and GM Pérola and GM Pontal samples extracted from leaf material with DNeasy plant minikit. Curves for 250 nM FGM probe showed efficiency values close to 100%, and this concentration was selected to be used in further experiments (Figure 1). The specificity of FGM probe was assessed under optimized conditions of primers and probe concentrations. For P. vulgaris varieties, only 35 out of 158 reactions (22%) presented a positive signal. For Embrapa 2.3 GM event, only six out of 26 reactions (23%) present a positive signal (Table 4). All positive results presented a late Cq, higher than 37. Repeatability of TaqMan Assay. The repeatability assay was performed in four PCR runs with three GM Pérola DNA extracts (Table 5). Each DNA extract resulted in a standard curve obtained from a 10-fold serial dilution. The efficiency values ranged from 85% to 101%. A mean standard curve was generated by use of all data obtained from this experiment (n = 24). The mean efficiency value was 95% and the correlation coefficient was 0.998 (Figure 2). Repeatability of the TaqMan assay was also assessed for one DNA extract of Embrapa 5.1 GM Pérola and one DNA extract of Embrapa 5.1 GM Pontal, in 3 days. Efficiency values ranged from 90% to 103% for GM Pérola and from 94% to 98% for GM Pontal (Figure S2, Supporting Information). DNA samples extracted by the CTAB method were also used to verify the repeatability of the TaqMan assay. Efficiency values for GM Pérola and GM Pontal were 89% and 86%, respectively. Both curves presented a correlation coefficient of 0.97 (Figure 3). Limit of Detection of qPCR Assay. The limit of detection (LOD) for FGM assay was determined through the repeatability test: four qPCR runs for three DNA extracts (A, B, and C), in duplicate. The limit of detection also was assessed with DNA from Embrapa 5.1 diluted with non-GM common bean DNA and compared with results obtained in the construct-specific OLA assay (Table 6). Embrapa 5.1 DNA extracted with DNeasy plant minikit and diluted in water was detected in 24 out of 24 reactions (100%) to 101 DNA copy number. Positive reactions were observed in 14 out of 24 (58%) for 100 DNA copy number. For samples extracted with CTAB, Embrapa 5.1 DNA diluted in water was detected in 16 out of 16 reactions (100%) for 102 DNA copy number. A positive signal was observed in 12 out of 16 reactions (75%) for 101 DNA copy number. Embrapa 5.1 DNA diluted in non-GM common bean was detected in all 12 reactions (100%) evaluated up to the dilution of 102 for FGM assay and in 11 out of 12 reactions (92%) for OLA assay. OLA assay showed positive signal in 21 out 24 reactions (87.5%) for 101 DNA copies while FGM probe showed 22 out of 24 reactions (92%) for 101 DNA copies (Table 6). qPCR Parameters for TaqMan Assay of Seed DNA. Standard curves were also obtained for four DNA extracts from bean material. DNA was extracted from powder seeds by use of DNeasy plant minikit. Standard curve with 250 nM FGM probe and 300 nM primers showed mean efficiency value of 100% (Figure 4).

■

RESULTS qPCR Parameters for SYBR Green Assay. In order to test the specificity of the primers, SYBR Green assays were performed at four primer concentrations: 400, 300, 200, and 100 nM with negative and positive control samples. Low variation in Cq values of positive samples (GM Pérola and GM Pontal) was observed for primer concentrations of 400, 300, and 200 nM (Table S1, Supporting Information). For primer concentration of 100 nM, quantitation cycle (Cq) values of the positive samples were higher than Cq values at other primer concentrations. Regarding the negative controls (pea, GM and non-GM soybean, GM maize, non-GM Pérola, non-GM Pontal, and Embrapa 2.3), amplification signals with late Cq were verified for GM and non-GM soybean, GM maize, and non-GM common bean Pontal samples at primer concentration of 400 nM and for non-GM common bean Pérola, GM and non-GM soybean, and GM maize at primer concentration of 200 nM. For 300 nM primer concentration, no amplification signals were observed for the large majority of negative controls. In this case, only five positive signals were observed out of 25 with late Cq (Cq > 34.9) (Table S1, Supporting Information). Standard curves were obtained at five primer concentrations (500, 400, 300, 200, and 100 nM) with DNA samples extracted with DNeasy plant minikit from Embrapa 5.1 GM Pérola and GM Pontal. Efficiency values ranged from 95% to 110% for GM Pérola and from 94% to 112% for GM Pontal (Table 3). Primer Table 3. qPCR Efficiency Values and R2 of SYBR Green Assaya Embrapa 5.1 Pérola [primer] (nmol/L) 500 400 300 200 100 300 200

efficiency (%)

R2

Embrapa 5.1 Pontal efficiency (%)

DNA from DNeasy Plant Minikit 95 0.987 106 1.000 110 0.997 104 0.999 106 0.993 DNA from CTAB Method 107 1.000 104 0.999

R2

103 94 110 100 112

0.999 0.998 1.000 1.000 0.988

104 110

0.993 0.991

a Template DNA came from Embrapa 5.1 GM Pérola and Embrapa 5.1 GM Pontal common bean varieties, extracted by DNeasy plant minikit or CTAB method..

concentrations of 300 and 200 nM showed suitable efficiency values, and they were selected to obtain standard curves for GM Pérola and GM Pontal samples extracted by the CTAB method. For GM Pérola the amplification efficiency values were 107% and 104%, respectively, and for GM Pontal the efficiencies were 104% and 110%, respectively (Table 3). For primer concentrations of 200 and 300 nM, amplification efficiency values presented standard deviation of 4.55 and 2.52, respectively, for the samples extracted with both DNA extraction methods. Given the amplification efficiency values 11996

dx.doi.org/10.1021/jf503928m | J. Agric. Food Chem. 2014, 62, 11994−12000

Journal of Agricultural and Food Chemistry

Article

Figure 1. TaqMan FGM assay stardard curves for two FGM probe concentrations (250 and 150 nM) and template DNA extracted by use of DNeasy plant minikit from leaves of two GM common beans. (A) Embrapa 5.1 GM Pérola DNA and 150 nM FGM probe (n = 4); (B) Embrapa 5.1 GM Pérola DNA and 250 nM FGM probe (n = 4); (C) Embrapa 5.1 GM Pontal DNA and 150 nM FGM probe (n = 2); (D) Embrapa 5.1 GM Pontal DNA and 250 nM FGM probe (n = 2). Assays were performed with 300 nM BeanF/VectorR primer pair.

Table 4. Specificity Test for TaqMan FGM Assay with Optimized Primers and Probe Concentrations

a

DNA samplea

positive/total

mean Cq

SD

Embrapa 5.1 GM Pérola Embrapa 5.1 GM Pontal P. vulgaris non-GM Pérola non-GM Pontal C. gradiata P. lunatus V. unguiculata Embrapa 2.3 common bean

4/4 4/4 28/134 4/12 3/12 0/2 0/2 1/4 6/26

21.20 21.81 37.28 38.47 38.73

0.21 0.20 0.79 0.63 0.63

38.44 38.05

0.89

Figure 2. TaqMan FGM assay stardard curves performed in four qPCR runs on different days with three DNA extracts from leaves of Embrapa 5.1 GM Pérola in duplicate (n = 24). Samples were extracted by use of DNeasy plant minikit.

DNA was extracted by use of DNeasy plant minikit.

Table 5. qPCR Parameters of TaqMan FGM Assay Standard Curves Based on Four PCR Runs and Three DNA Extracts DNA samplea A B C A B C A B C A B C mean SD

efficiency (%) PCR 91 94 85 PCR 90 94 99 PCR 99 101 91 PCR 97 98 96 95 5.0

slope

R2

−3.546 −3.477 −3.738

0.998 0.999 0.999

−3.582 −3.470 −3.353

1.000 1.000 0.999

−3.352 −3.305 −3.563

0.999 0.991 0.996

−3.387 −3.367 −3.427

0.998 0.996 0.998

−3.464 0.14

0.998 0.00

Comparison between OLA and FGM Assays. In order to compare the efficiency values of FGM and OLA assays, serial dilutions were prepared for DNA from Embrapa 5.1 GM Pérola, Embrapa 5.1 GM Pontal, and Embrapa 2.3 GM event samples and tested for both assays. The results showed that for OLA assay the efficiency values ranged from 90% to 97%, while for FGM assay the efficiency values were 95% and 113% (Table 7). As expected, the FGM assay did not present positive amplification signals for DNA extracted from Embrapa 2.3 common bean event.

Run 1

Run 2

■

Run 3

DISCUSSION Event-specific methods present the highest specificity in order to differentiate GMO events.17 Two GM common bean events obtained with the same construct (Embrapa 2.3 and Embrapa 5.1) showed high resistance to bean golden mosaic virus,2,18 but only Embrapa 5.1 GM common bean event was submitted for approval and approved for commercialization in Brazil. In order to develop an event-specific assay for Embrapa 5.1, common bean DNA was extracted from leaf tissue to be used as certified reference material. Seed powder for GMO analysis presented some limitations, such as limited quantitation range, inconvenient preparation procedures, and difficulty in obtaining homogeneous candidate samples.19 Furthermore, the genetic

Run 4

a

DNA from Embrapa 5.1 GM Pérola was extracted from leaves by use of DNeasy plant minikit.

11997

dx.doi.org/10.1021/jf503928m | J. Agric. Food Chem. 2014, 62, 11994−12000

Journal of Agricultural and Food Chemistry

Article

Figure 4. TaqMan FGM assay stardard curves performed in two qPCR runs on different days with four DNA extracts from seeds of Embrapa 5.1 GM Pérola in duplicate (n = 12). Samples were extracted by use of DNeasy plant minikit.

Table 7. Comparison of Amplification Efficiency Values and R2 for Two GM Events, Embrapa 2.3 and Embrapa 5.1a OLA assay

Figure 3. TaqMan FGM assay stardard curves performed in four qPCR runs on different days. Curves were generated for two DNA extracts from leaves: (A) Embrapa 5.1 GM Pérola (n = 8) and (B) Embrapa 5.1 GM Pontal (n = 8). Samples were extracted by the CTAB method.

efficiency (%)

DNA sample Embrapa 2.3 common bean Embrapa 5.1 Pérola Embrapa 5.1 Pontal

b

95 90b 97c

FGM assay R2

efficiency (%)

R2

1.000 0.980 0.924

113c 95c

0.998 0.993

a

qPCR was performed in TaqMan OLA (construct-specific) assay and FGM (event-specific assay for Embrapa 5.1). bLimit of detection at 100. cLimit of detection at 101.

purity of a powder produced from GM seeds is difficult to check.9 The specificity of the developed primers was assessed by SYBR Green assay. The results showed that Cq values were similar for Embrapa 5.1 DNA samples at 200, 300, and 400 nM primers. However, the 300 nM concentration detected the target with no cross-reaction with non-GM common bean. Efficiency values obtained in the SYBR Green assay, with five primer concentrations and samples extracted with DNeasy plant minikit or CTAB method, are in accordance with the European Network of Genetically Modified Organism Laboratory (ENGL).20 According to this guideline, the efficiency values of standard curves must range from 90% to 110%, and the correlation coefficient (R2) must be higher than 0.98. One efficiency value was out of this range (112%) and all correlation coefficients were higher than 0.98.

Because of its high specificity, a TaqMan probe was developed. FGM probe uses the minor-groove-binding (MGB) technology that allows the design of shorter probes with higher melting temperatures21 and with high specificity of the hybridization.22 When FGM probe was tested with nontarget samples, positive signals in 42 out of 192 samples (22%) were observed. The samples that showed a positive signal presented a late Cq (Cq > 37) for 50 ng of DNA, equivalent to 104.85 DNA copies. The Cq value of positive samples (GM Pérola and GM Pontal) with the same DNA quantity (50 ng) is approximately 21. The observed ΔCq of 16

Table 6. Cq Values Generated by qPCR TaqMan OLA (Construct-Specific) and FGM (Event-Specific) Assays for Mixed DNA Samples samples

GM Pérola + Pérolaa

GM Pérola + Pontala

GM Pontal + Pérolaa

GM Pontal + Pontala

31.78 ± 0.10 3/3

33.98 ± 2.17 2/3

35.38 ± 0.74 5/6

35.66 ± 0.92 5/6

33.02 ± 0.16 3/3

32.61 ± 0.37 3/3

36.07 ± 0.8 6/6

36.57 ± 1.59 6/6

2

Cq ± SD positive/total

31.91 ± 0.16 3/3

Cq ± SD positive/total

34.90 ± 1.28 5/6

Cq ± SD positive/total

32.12 ± 0.19 3/3

Cq ± SD positive/total

35.55 ± 0.73 5/6

OLA Assay, 10 DNA Copy Number 31.78 ± 0.10 3/3 OLA Assay, 101 DNA Copy Number 34.64 ± 0.73 6/6 FGM Assay, 102 DNA Copy Number 32.47 ± 0.39 3/3 FGM Assay, 101 DNA Copy Number 35.04 ± 0.84 5/6

a

Template DNA was mixed DNA: Embrapa 5.1 GM Pérola (102 or 101 DNA copies) in the presence of background DNA of non-GM common bean (Pérola and Pontal) varieties (10 ng or 14 327 copies) 11998

dx.doi.org/10.1021/jf503928m | J. Agric. Food Chem. 2014, 62, 11994−12000

Journal of Agricultural and Food Chemistry

Article

Recent reports have been published about development of GM event-specific qPCR assays for several new GMOs. Guertler et al.11 developed an assay for detection of Kefeng-6 GM rice. Event-specific assays were developed for specific detection of a GM herbicide-tolerant soybean, A2704-12 event,24 of GM Chinese cabbage25 and GM flax.12 Other authors also reported the development of event-specific assays.12,13,26−28 The method developed in the present work is reliable for detection and quantitation of Embrapa 5.1 GM common bean. Even when it is considered that some negative samples presented a positive signal, the Cq values were higher than the Cq value of the LOD, considered to be 100 DNA copies in the presence of background DNA. Both qPCR chemistries used in this work are suitable for quantitation of GM common bean Embrapa 5.1. A new endogenous reference gene assay, named LEC assay, was developed for quantitation of common bean DNA in food.29 The FGM assay developed here, together with the LEC assay, can be useful for surveys of compliance with GMO-labeling legislation by regulatory authorities in Brazil and in other countries.30 Moreover, this new event-specific assay is an important tool in GMO analysis because it allows specific quantitation of an authorized GM event.

is sufficient to propose that these amplifications of few negative samples were unspecific. Standard curves for quantitation of Embrapa 5.1 GM common bean by the FGM probe were prepared from serial dilutions of GM Pérola and GM Pontal leaf material. For GM Pérola, 14 out 15 (93%) efficiency values were between 90% and 110%, in accordance with ENGL. For GM Pontal, the efficiency values were between 94% and 98%. All curves presented R2 higher than 0.99. A mean standard curve was generated by the repeatability assay, using DNA samples of GM Pérola, presenting an efficiency of 95% and an R2 of 0.99. Dinon et al.14 reported an efficiency of 89% for the standard curve generated with OLA probe. By comparison of these results, FGM probe seems to be more suitable for detection and quantitation of Embrapa 5.1 GM common bean, as the efficiency of the assay was closer to 100% and mainly for being event-specific. The LOD is defined as the lowest amount of DNA that can be reliably detected. According to ENGL,20 qPCR methods should detect the presence of the analyte at least 95% of the time. For FGM assay, the LOD was 10 DNA copies based on the haploid genome of common bean for DNA extracted with DNeasy plant minikit diluted in water. The Cq value of 10 DNA copies (corresponding to 6.98 pg) is approximately 35.66. For Embrapa 5.1 DNA extracted by the CTAB method, FGM assay showed a LOD of 100 DNA copies. Wang et al.10 reported a LOD of 100 copies for an event-specific qPCR assay of GM rice Kefeng-8. For a qPCR assay of GM rice Kefeng-6, Guertler et al.11 reported a LOD of 5 copies. We observed that amplification occurred later for DNA samples extracted by the CTAB method since the Cq of these samples was approximately 24 for 105 DNA copies, while the samples extracted with DNeasy plant mini kit presented a Cq of 22. The DNA extraction method can influence the quantitation because of its effectiveness in removing substances that can interfere in the PCR.23 In order to verify applicability of the FGM assay for seed samples, standard curves for DNA extracted from powder seeds were obtained and efficiency value of 100% was obtained. DNA extraction methods applied to one matrix may not be suitable for other matrices. In this case, DNA extraction method (DNeasy plant minikit) was suitable for both leaf and seed materials. When Embrapa 5.1 DNA was diluted in non-GM common bean DNA solution, the LOD of FGM assay was 102 DNA copies, with a mean Cq of 32.5. Positive reactions were still observed in 22 out of 24 reactions (92%) for 101 DNA copy numbers, with a mean Cq of 35.8, showing that amplification was not highly influenced by the presence of a background DNA. Andersen et al.21 reported that the presence of large amounts of background DNA did not promote a severe effect in the results of DNA amplification. When OLA assay (construct-specific) and FGM assay for DNA samples diluted in non-GM common bean were compared, the methods presented the same LOD and the Cq values were very similar. FGM and OLA assays were compared for serial dilutions of Embrapa 5.1 GM Pérola, Embrapa 5.1 GM Pontal, and Embrapa 2.3 GM event. For OLA probe the efficiency values were 90%, 97%, and 95%, respectively. For FGM probe the efficiency value for GM Pérola was 113% and for GM Pontal was 95%. DNA from Embrapa 2.3 was not detected in any of the points of the standard curves. Therefore, the FGM probe was suitable to differentiate authorized from nonauthorized GM common bean events.

■

ASSOCIATED CONTENT

S Supporting Information *

One table showing specificity test of SYBR Green assay and two figures showing border junction sequence of Embrapa 5.1 and TaqMan FGM assay standard curves. This material is available free of charge via the Internet at http://pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Author

*Phone +554837215382; fax +554837219943; e-mail ana. [email protected]. Funding

The work was financially supported by CNPq Grants 471401/ 2012-9 and 470683/2012-0. D.T. is the recipient of a CNPq Master fellowship; G.L.V., a CAPES Ph.D. fellowship; F.C.A.B., a CAPES PNPD postdoctoral fellowship; and A.C.M.A., a CNPq PQ-2 fellowship. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS We express our gratitude to Francisco J. L. Aragão for providing the border junction DNA sequence of GM common bean Embrapa 5.1.

■

ABBREVIATIONS BGMV, bean golden mosaic virus; Cq, quantitation cycle; CTAB, cetyltrimethylammonium bromide; Embrapa, Brazilian Agricultural Research Corporation; ENGL, European Network of GMO Laboratories; FGM, event-specific quantitative polymerase chain reaction assay for Embrapa 5.1 detection; GMO, genetically modified organism; GM, genetically modified; LOD, limit of detection; MGB, minor-groove binding; OLA, construct-specific quantitative polymerase chain reaction assay for Embrapa 5.1 and Embrapa 2.3 detection; PCR, polymerase chain reaction; qPCR, quantitative polymerase chain reaction; R2, correlation coefficient 11999

dx.doi.org/10.1021/jf503928m | J. Agric. Food Chem. 2014, 62, 11994−12000

Journal of Agricultural and Food Chemistry

■

Article

(17) Holst-Jensen, A.; Ronning, S. B.; Lovseth, A.; Berdal, K. G. PCR technology for screening and quantification of genetically modified organisms (GMOs). Anal. Bioanal. Chem. 2003, 375, 985−993. (18) Aragao, F.; Faria, J. First transgenic geminivirus-resistant plant in the field: The development of a RNAi-based agriculture technology. In Vitro Cell. Dev. Biol. Anim. 2010, 46, S5. (19) Meng, Y. A.; Liu, X.; Wang, S.; Zhang, D. B.; Yang, L. T. Applicability of plasmid calibrant pTC1507 in quantification of TC1507 maize: An interlaboratory study. J. Agric. Food Chem. 2012, 60, 23−28. (20) ENGL, European Network of Genetically Modified Organism Laboratories. Definition of minimum performance requirements for analytical methods of GMO testing, 13 October 2008; http://gmo-crl. jrc.ec.europa.eu/doc/Min_Perf_Requirements_Analytical_methods. pdf. (21) Andersen, C. B.; Holst-Jensen, A.; Berdal, K. G.; Thorstensen, T.; Tengs, T. Equal performance of TaqMan, MGB, molecular beacon, and SYBR green-based detection assays in detection and quantification of Roundup-ready soybean. J. Agric. Food Chem. 2006, 54, 9658−9663. (22) Kutyavin, I. V.; Afonina, I. A.; Mills, A.; Gorn, V. V.; Lukhtanov, E. A.; Belousov, E. S.; Singer, M. J.; Walburger, D. K.; Lokhov, S. G.; Gall, A. A.; Dempcy, R.; Reed, M. W.; Meyer, R. B.; Hedgpeth, J. 3′minor groove binder-DNA probes increase sequence specificity at PCR extension temperatures. Nucleic Acids Res. 2000, 28, 655−661. (23) Cankar, K.; Stebih, D.; Dreo, T.; Zel, J.; Gruden, K. Critical points of DNA quantification by real-time PCR: Effects of DNA extraction method and sample matrix on quantification of genetically modified organisms. BMC Biotechnol. 2006, 6, 37. (24) Ma, H.; Li, H.; Li, J.; Wang, X. F.; Wei, P. C.; Li, L.; Yang, J. B. High-throughput, low-cost, and event-specific polymerase chain reaction detection of herbicide tolerance in genetically modified soybean A2704-12. GMR, Genet. Mol. Res. 2014, 13, 696−703. (25) Shin, K.-S.; Lim, M.-H.; Woo, H.-J.; Lim, S.-H.; Ahn, H.-I.; Lee, J.-H.; Cho, H.-S.; Kweon, S.-J.; Suh, S.-C. Event-specific qualitative and quantitative polymerase chain reaction methods for detection of insect-resistant genetically modified Chinese cabbage based on the 3′junction of the insertion site. J. Kor. Soc. Appl. Biol. Chem. 2012, 55, 367−375. (26) Xu, W. T.; Zhang, N.; Luo, Y. B.; Zhai, Z. F.; Shang, Y.; Yan, X. H.; Zheng, J. J.; Huang, K. L. Establishment and evaluation of eventspecific qualitative and quantitative PCR method for genetically modified soybean DP-356043-5. Eur. Food Res. Technol. 2011, 233, 685−695. (27) Zhang, N.; Xu, W.; Bai, W.; Zhai, Z.; Luo, Y.; Yan, X.; He, J.; Huang, K. Event-specific qualitative and quantitative PCR detection of LY038 maize in mixed samples. Food Control 2011, 22, 1287−1295. (28) Zhang, M.; Huo, N.; Liu, Y.; Qiu, Y.; Ao, J.; Luan, F.; Li, Q.; Gao, X. Event-specific detection of genetically modified wheat B73−61 based on the 3′-flanking sequence. Eur. Food Res. Technol. 2012, 235, 1149−1159. (29) Venturelli, G. L.; Brod, F. C.; Rossi, G. B.; Zimmermann, N. F.; Oliveira, J. P.; Faria, J. C.; Arisi, A. C. A Specific endogenous reference for genetically modified common bean (Phaseolus vulgaris L.) DNA quantification by real-time PCR targeting lectin gene. Mol. Biotechnol. 2014, 56, 1060−1068. (30) Branquinho, M. R.; Ferreira, R. T. B.; Cardarelli-Leite, P. Survey of compliance with labeling legislation in food containing GMOs in Brazil. J. Food Compos. Anal. 2010, 23, 220−225.

REFERENCES

(1) Bonfim, K.; Faria, J. C.; Nogueira, E. O. P. L.; Mendes, E. A.; Aragao, F. J. L. RNAi-mediated resistance to Bean golden mosaic virus in genetically engineered common bean (Phaseolus vulgaris). Mol. Plant-Microbe Interact. 2007, 20, 717−726. (2) Aragao, F. J. L.; Faria, J. C. First transgenic geminivirus-resistant plant in the field. Nat. Biotechnol. 2009, 27, 1086−1088. (3) Faria, J. C.; Valdisser, P. A. M. R.; Nogueira, E. O. P. L.; Aragão, F. J. L. RNAi-based bean golden mosaic virus-resistant common bean (Embrapa 5.1) shows simple inheritance for both transgene and disease resistance. Plant Breed. 2014, 133, 649−653. (4) Aragao, F. J. L.; Nogueira, E. O. P. L.; Tinoco, M. L. P.; Faria, J. C. Molecular characterization of the first commercial transgenic common bean immune to the bean golden mosaic virus. J. Biotechnol. 2013, 166, 42−50. (5) Brazil, Decree 4.680 of 24 April 2003, regulates the information access concerning foods and ingredients containing or produced from genetically modified organisms. DOU, Official Journal of Brazil, ́ Brazil, 2003; http://www.anvisa.gov.br/e-legis/. Brasilia, (6) European Commission.. EC Regulation 1830/2003 of 22 September 2003, concerning the traceability and labelling of genetically modified organisms and the traceability of food and feed products produced from genetically modified organisms. Off. J. Eur. Commun. 2003, L268, 24−28. (7) European Commission.. EC Regulation 619/2011 of 24 June 2011, laying down the methods of sampling and analysis for the official control of feed as regards presence of genetically modified material for which an authorization procedure is pending or the authorization of which has expired. Off. J. Eur. Commun. 2011, L166, 9−15. (8) Scholtens, I.; Laurensse, E.; Molenaar, B.; Zaaijer, S.; Gaballo, H.; Boleij, P.; Bak, A.; Kok, E. Practical experiences with an extended screening strategy for genetically modified organisms (GMOs) in reallife samples. J. Agric. Food Chem. 2013, 61, 9097−9109. (9) Caprioara-Buda, M.; Meyer, W.; Jeynov, B.; Corbisier, P.; Trapmann, S.; Emons, H. Evaluation of plasmid and genomic DNA calibrants used for the quantification of genetically modified organisms. Anal. Bioanal. Chem. 2012, 404, 29−42. (10) Wang, W.-x.; Zhu, T.-h.; Lai, F.-x.; Fu, Q. Event-specific qualitative and quantitative detection of transgenic rice Kefeng-8 by characterization of the transgene flanking sequence. Eur. Food Res. Technol. 2012, 234, 477−484. (11) Guertler, P.; Huber, I.; Pecoraro, S.; Busch, U. Development of an event-specific detection method for genetically modified rice Kefeng 6 by quantitative real-time PCR. J. Verbraucherschutz Lebensmittelsicherh. 2012, 7, 63−70. (12) Vanella, R.; Weston, A.; Brodmann, P.; Kuebler, E. Development of an event-specific assay for the qualitative and quantitative detection of the genetically modified flax CDC Triffid (FP967). Food Control 2014, 41, 128−133. (13) Wu, Y.; Yang, L.; Cao, Y.; Song, G.; Shen, P.; Zhang, D.; Wu, G. Collaborative validation of an event-specific quantitative real-time PCR method for genetically modified rice event TT51-1 detection. J. Agr. Food Chem. 2013, 61, 5953−5960. (14) Dinon, A. Z.; Brod, F. C. A.; Mello, C. S.; Oliveira, E. M. M.; Faria, J. C.; Arisi, A. C. M. Primers and probes development for specific PCR detection of genetically modified common bean (Phaseolus vulgaris) Embrapa 5.1. J. Agric. Food Chem. 2012, 60, 4672−4677. (15) Brod, F. C. A.; Dinon, A. Z.; Kolling, D. J.; Faria, J. C.; Arisi, A. C. M. Development of plasmid DNA reference material for the quantification of genetically modified common bean Embrapa 5.1. J. Agric. Food Chem. 2013, 61, 4921−4926. (16) Dinon, A. Z.; Prins, T. W.; van Dijk, J. P.; Arisi, A. C. M.; Scholtens, I. M. J.; Kok, E. J. Development and validation of real-time PCR screening methods for detection of cry1A.105 and cry2Ab2 genes in genetically modified organisms. Anal. Bioanal. Chem. 2011, 400, 1433−1442. 12000

dx.doi.org/10.1021/jf503928m | J. Agric. Food Chem. 2014, 62, 11994−12000