Development of Novel PCR Assays To Detect Azole Resistance ...

Development of Novel PCR Assays To Detect Azole ResistanceMediating Mutations of the Aspergillus fumigatus cyp51A Gene in Primary Clinical Samples from Neutropenic Patients Birgit Spiess,a Wolfgang Seifarth,a Natalia Merker,a Susan J. Howard,b Mark Reinwald,a Anne Dietz,c Wolf-Karsten Hofmann,a and Dieter Buchheidta 3. Medizinische Universitätsklinik, Universitätsmedizin Mannheim, Universität Heidelberg, Mannheim, Germanya; School of Translational Medicine, University of Manchester, Manchester Academic Health Sciences Centre, Manchester, United Kingdomb; and Institut für Medizinische Mikrobiologie und Hygiene, Universitätsmedizin Mannheim, Universität Heidelberg, Mannheim, Germanyc

The increasing incidence of azole resistance in Aspergillus fumigatus causing invasive aspergillosis (IA) in immunocompromised/hematological patients emphasizes the need to improve the detection of resistance-mediating cyp51A gene mutations from primary clinical samples, particularly as the diagnosis of invasive aspergillosis is rarely based on a positive culture yield in this group of patients. We generated primers from the unique sequence of the Aspergillus fumigatus cyp51A gene to establish PCR assays with consecutive DNA sequence analysis to detect and identify the A. fumigatus cyp51A tandem repeat (TR) mutation in the promoter region and the L98H and M220 alterations directly in clinical samples. After testing of the sensitivity and specificity of the assays using serially diluted A. fumigatus and human DNA, A. fumigatus cyp51A gene fragments of about 150 bp potentially carrying the mutations were amplified directly from primary clinical samples and subsequently DNA sequenced. The determined sensitivities of the PCR assays were 600 fg, 6 pg, and 4 pg of A. fumigatus DNA for the TR, L98H, and M220 mutations, respectively. There was no cross-reactivity with human genomic DNA detectable. Sequencing of the PCR amplicons for A. fumigatus wild-type DNA confirmed the cyp51A wild-type sequence, and PCR products from one azole-resistant A. fumigatus isolate showed the L98H and TR mutations. The second azole-resistant isolate revealed an M220T alteration. We consider our assay to be of high epidemiological and clinical relevance to detect azole resistance and to optimize antifungal therapy in patients with IA.

I

nvasive aspergillosis (IA) has emerged as a life-threatening infection in immunocompromised patients. An increase in infections due to azole-resistant Aspergillus fumigatus has been observed lately (4, 9, 28), leading to a higher case fatality rate among patients with azole-resistant invasive aspergillosis (27). The main acquired/observed mechanism conferring azole drug resistance implicates point mutations in the 14␣-sterol demethylase gene (cyp51A) and/or increased cyp51A expression due to a tandem repeat (TR) promoter alteration (7, 9, 17, 18, 29). Thus far, the detection of resistance to azoles (itraconazole, voriconazole, posaconazole) is strictly based on positive cultures from clinical isolates, and the hitherto existing PCR assays to detect both the azole resistance-mediating tandem repeat and the single nucleotide polymorphisms were performed with culture samples and depend on positive culture findings from clinical isolates (7, 8, 14, 17, 26). Up to now, only one PCR-based assay that detects cyp51A mutations directly in clinical samples (sputum) from patients with pulmonary diseases like allergic bronchopulmonary aspergillosis (ABPA) and chronic pulmonary aspergillosis (CPA) has been described. In this study, samples from a few patients suffering from invasive pulmonary aspergillosis (IPA) were also tested, but these samples did not yield results due to an insufficient amount of sample remaining (6). From a clinical point of view, at least in patients with hematological malignancies at high risk for IA, evident Aspergillus culture yields are scarce and a culture-based diagnosis of IA is rarely achieved (20, 30). In this context, it may be assumed that azole resistance is underdiagnosed in this group of patients. To over-

July 2012 Volume 56 Number 7

come culture-based diagnostic limitations, we established PCR assays to detect common azole resistance-mediating mutations of the A. fumigatus cyp51A gene in primary clinical samples from patients with hematological malignancies. MATERIALS AND METHODS Strains and growth conditions. An A. fumigatus wild-type strain (DSM 819) was obtained from the Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Braunschweig, Germany, and the Institute for Medical Microbiology and Hygiene, Mannheim University Hospital, Mannheim, Germany. One itraconazole-resistant A. fumigatus clinical isolate (strain F14532) and one both itraconazole- and voriconazole-resistant A. fumigatus clinical isolate (strain F16216) were obtained from the Mycology Reference Centre, Manchester Culture Collection, Manchester, United Kingdom. Strain F14532 showed the following MIC values, obtained by the EUCAST reference microdilution method: voriconazole, 1.0 mg/liter; itraconazole, 8.0 mg/liter; posaconazole, 0.5 mg/liter. Strain F16216 had the following EUCAST MIC values: voriconazole, 8.0 mg/liter; itraconazole, 8.0 mg/liter; posaconazole, 2.0 mg/liter. According to the publication of Verweij et al., we applied the following

Received 11 October 2011 Returned for modification 4 November 2011 Accepted 31 March 2012 Published ahead of print 23 April 2012 Address correspondence to Birgit Spiess, [email protected]. Copyright © 2012, American Society for Microbiology. All Rights Reserved. doi:10.1128/AAC.05902-11

Antimicrobial Agents and Chemotherapy

p. 3905–3910

aac.asm.org

3905

Spiess et al.

TABLE 1 Composition of A. fumigatus cyp51A-specific primer sets and PCR conditions used for amplification of the DNA fragments potentially carrying the L98H, M220, and TR mutations Mutation and primer name

Orientation

Nucleotide sequence (5=–3=)

Fragment length (bp)

Nested Aspergillus PCR result

PCR conditions

L98H mutation CypA-L98H-S_Aa Sense CypA-L98H-AS_Ab Antisense

AAAAAACCACAGTCTACCTGG GGAATTGGGACAATCATACAC

143

⫹

Total vol, 25 ␮l; 2 ␮l template DNA (approx 100 ng human DNA ⫹ unknown amt of A. fumigatus DNA), 3 mM MgCl2, 0.25 mM each deoxynucleoside triphosphate, 1 U of Taq polymerase (Invitrogen GmbH, Karlsruhe, Germany), 20 pmol of each primer; DNA thermal cycler, 2 min of initial denaturation at 94°C, 40 cycles of 94°C for 45 s, 52°C for 1 min, and 72°C for 1 min, and final extension at 72°C for 10 min

M220 mutation CypA-M220-S_A

Sense

GCCAGGAAGTTCGTTCCAA

173

⫹

M220 PCR conditions are on par with the L98H conditions

Antisense

CTGATTGATGATGTCAACGTA

CypA-M220-AS_A Tandem repeat Step 1 CypA-TR-S1 CypA-TR-AS1

Step 2 CypA-TR-S_A CypA-TR-AS_A

a b

⫹ Sense Antisense

GGAGAAGGAAAGAAGCACTCT TCACCTACCTACCAATATAGG

235

First step, total vol, 25 ␮l; components of PCR mixture are on par with those of the L98H PCR mixture; DNA thermal cycler, 2 min initial denaturation at 94°C, 23 cycles of 94°C for 45 s, 52°C for 1 min, and 72°C for 1 min, and final extension at 72°C for 5 min

Sense Antisense

AGCACCACTTCAGAGTTGTCTA TGTATGGTATGCTGGAACTACACCTT

100

Second step, total vol, 25 ␮l; template of 2 ␮l of the first-step PCR mixture; other components are on par with those of the L98H PCR mixture; DNA thermal cycler, 2 min initial denaturation at 94°C, 35 cycles of 94°C for 45 s, 56°C for 1 min, and 72°C for 1 min, and final extension at 72°C for 5 min

S, sense. AS, antisense.

breakpoints for A. fumigatus using the EUCAST susceptibility testing methodology: for itraconazole and voriconazole, ⬍2 mg/liter (susceptible), 2 mg/liter (intermediate), and ⬎2 mg/liter (resistant); for posaconazole, ⬍0.25, 0.5, and ⬎0.5 mg/liter, respectively (28). Prior to DNA extraction, fungal cultures were grown in BBL malt agar (Becton, Dickinson, Heidelberg, Germany) for 72 h at 30°C. DNA extraction. Extraction of DNA from fungal cultures as well as from blood and bronchoalveolar (BAL) fluid samples was performed using the phenol-chloroform extraction method as previously described by Sambrook et al. (21) and cited in the paper describing the method of our diagnostic Aspergillus nested PCR assay (22). Tissue samples were additionally processed in liquid nitrogen for disruption. Primers for PCR assays. Three different primer sets for amplification of three cyp51A gene mutations were generated out of the unique sequence of the A. fumigatus cyp51A gene (GenBank accession number AF338659.1). For amplification of the L98H and M220 mutations, one sense and antisense primer pair was used for performing one-step PCRs. Amplification of the tandem repetition out of the cyp51A promoter region was performed by a nested PCR assay using one primer pair to amplify a longer DNA fragment and a second primer pair to amplify an inner shorter fragment in a second PCR step. The A. fumigatus cyp51A gene-specific primer pairs were designed from the A. fumigatus cyp51A DNA sequence (accession number

3906

aac.asm.org

AF338659.1) available in the GenBank database (http://www.ncbi.nlm .nih.gov/). To predict the potential cross-reactivities of the A. fumigatus cyp51A primer sequences with human genomic DNA sequences, additional database alignments were performed by using the NCBI primerBLAST service (http://www.ncbi.nlm.nih.gov/). Sequences of the primers are given in Table 1. The melting temperatures (Tms) of the primers and possible secondary structures were calculated also using the NCBI primer designing tool primer-BLAST (http://www.ncbi.nlm.nih.gov/). The synthetic oligonucleotides were synthesized by Eurofins MWG Operon, Ebersberg, Germany, and diluted to 100 ␮M in double-distilled H2O. PCR assays, specificity, sensitivity, and controls. Three distinct PCR assays for detection of the A. fumigatus cyp51A TR, L98H, and M220 alterations were established. The L98H PCR assay was performed as a one-step PCR using the sense primer CypA-L98H-S_A and the antisense primer CypA-L98H-AS_A. PCR conditions are given in Table 1. The generated PCR product had a length of 143 bp. The M220 PCR assay was also established as a one-step PCR assay using the sense primer CypA-M220-S_A and the antisense primer CypAM220-AS_A. PCR conditions are given in Table 1. The amplified PCR product is 173 bp in length. The TR PCR assay was performed as a two-step (nested) PCR assay. For the first step, the primer pair CypA-TR-S1 and CypA-TR-AS1 is used


Detection of Azole Resistance in A. fumigatus

FIG 1 Partial promoter and coding sequence of the Aspergillus fumigatus cyp51A gene (GenBank accession number AF338659.1). Primer sequences are underlined and marked by bold letters. Orientation of the primers is indicated by arrows. The TR in the promoter region is marked by bold letters and horizontal lines. Cds, coding sequence; TR, tandem repeat.

for amplification of a 235-bp DNA fragment. In the second PCR step, a 100-bp DNA fragment is generated using the primer pair CypA-TR-S_A and CypA-TR-AS_A. PCR conditions are also given in Table 1. PCR products were analyzed by ethidium bromide agarose gel analysis. To exclude cross-reactivity of the designed primer pairs with human genomic DNA, we investigated 100 ng of human DNA as a negative control in the developed PCR assays. An additional negative control for specificity was a sample, adopted in the PCR assays, containing a mixture of 100 ng human genomic DNA and 50 pg of A. fumigatus wild-type DNA. The sensitivities of the different PCR assays were determined using serially diluted A. fumigatus wild-type DNA as the template (see Fig. 2A to C)). PCR amplicons were visualized using ethidium bromide agarose gel analysis. Two azole-resistant A. fumigatus strains (strains F16216 and F14532) were obtained from the culture collection at the Mycology Reference Centre, Manchester, United Kingdom. Genomic DNA of both strains was used as a positive control for amplification and detection of the L98H, M220, and TR mutations with our novel developed PCR assays and consecutive DNA sequence analysis. Sequence analysis. The PCR products were used directly for mandatory sequence analysis, without agarose gel extraction, which is time-consuming, usually associated with the loss of a large amount of DNA, and therefore critical when performing PCR directly out of primary clinical samples containing very small amounts of fungal DNA. The PCR products were purified using a MiniElute PCR purification kit (Qiagen, Hilden, Germany), and a minimum of 50 ng DNA was sequenced (Seq-


uiserve, Vaterstetten, Germany). To detect potential mutations in the PCR products analyzed by DNA sequence analysis, the sequence of the products was compared to the sequence of the A. fumigatus cyp51A wildtype sequence using the NCBI alignment service AlignSequenceNucleotideBlast (http://www.ncbi.nlm.nih.gov/). Patients. For the methodical establishment of the three different PCR assays for clinical samples, BAL fluid and tissue samples from 7 immunocompromised neutropenic patients mainly with hematological malignancies were further processed for diagnostic purposes, after the patients gave informed consent. Primary diseases were acute lymphoblastic leukemia (ALL; n ⫽ 2), non-Hodgkin’s lymphoma (NHL; n ⫽ 2), mantle cell lymphoma (n ⫽ 1), Waldenstroem’s macroglobulinemia (n ⫽ 1), and multiple myeloma (n ⫽ 1). An additional immunocompromised patient who suffered from chronic obstructive pulmonary disease (COPD; n ⫽ 1) was not neutropenic. Clinical samples. For BAL fluid samples, bronchoscopy was performed according to standardized operating procedures as described elsewhere (16), and BAL fluid samples were obtained in a sterile vessel without conservation medium. The mean sample volume was 10 ml. Tissue samples were obtained by needle biopsy (liver, kidney) or surgical procedures (other samples) under sterile conditions.

RESULTS

Three distinct PCR assays for the detection of the most common azole resistance-mediating alterations in the A. fumigatus cyp51A

aac.asm.org 3907

Spiess et al.

FIG 2 Determination of the sensitivity of the L98H one-step PCR (A), the TR two-step PCR (B), and the M220 one-step PCR (C) assays by ethidium bromide agarose gel electrophoresis using serially diluted A. fumigatus wild-type DNA. (A) Lane 1, 9 pg; lane 2, 8 pg; lane 3, 7 pg; lane 4, 6 pg; lane 5, 5 pg; lane 6, 100 ng human DNA from a healthy person (negative reagent control); lane 7, 100 ng human DNA plus 50 pg A. fumigatus DNA (positive control); lane 8, sample from patient 1; lane 9, sample from patient 2. (B) Lane 1, 2 pg; lane 2, 1 pg; lane 3, 800 fg; lane 4, 600 fg; lane 5, 400 fg; lane 6, 200 fg; lane 7, 100 fg; lane 8, 50 fg; lane 9, 100 ng human DNA from a healthy person (negative reagent control); lane 10, 100 ng human DNA plus 50 pg A. fumigatus DNA (positive control); lane 11, sample from patient 1; lane 12, sample from patient 2. (C) Lane 1, 9 pg; lane 2, 8 pg; lane 3, 7 pg; lane 4, 6 pg; lane 5, 5 pg; lane 6, 4 pg; lane 7, 3 pg; lane 8, 100 ng human DNA from a healthy person (negative reagent control); lane 9, 100 ng human DNA plus 50 pg A. fumigatus DNA (positive control); lane 10, sample from patient 1; lane 11, sample from patient 2. The PCR amplicons of the patient samples could be used directly for DNA sequencing analysis. (D) Positive-control amplifications for the three different PCR assays (L98H, lanes 1 to 3; TR, lanes 5 to 7; M220, lanes 9 to 11) were performed using A. fumigatus wild-type DNA (50 pg) and DNA of two azoleresistant A. fumigatus isolates (50 pg) (strains F16216 and F14532) diluted in 100 ng human genomic DNA. A negative reagent control amplification without addition of DNA (lanes 4 and 8) resulted in no signals. The 34-bp TR in the promoter region of the cyp51A gene of strain F16216 was predicted by visualizing the longer PCR fragment (lane 6). Lane 1, A. fumigatus wild-type L98H; lane 2, strain F16216 L98H; lane 3, strain F14532 L98H; lane 4, mixed control; lane 5, A. fumigatus wild-type TR; lane 6, strain F16216 TR; lane 7, strain F14532 TR; lane 8, mixed control; lane 9, A. fumigatus wild-type M220; lane 10, strain F16216 M220; lane 11, strain F14532.

gene directly from clinical samples were established. Figure 1 shows the major hot spots of mutations in the cyp51A gene and the primers chosen. The assays showed different detection thresholds for genomic A. fumigatus DNA (Fig. 2A to C). The sensitivity of the PCR assays determined for the L98H mutation was 6 pg (Fig. 2A, lane 4), that for the TR mutation was 600 fg (Fig. 2B, lane 4), and that for the M220 mutation was 4 pg (Fig. 2C, lane 6) of A. fumigatus DNA. To exclude cross-reactivity of the primers with nontarget human genomic DNA, 100 ng of human DNA was tested as a negative control for any PCR assay. For the L98H and the M220 PCR assays, this resulted in no signals (Fig. 2A, lane 6, and C, lane 8). Subsequently, 50 pg A. fumigatus DNA diluted in 100 ng of human DNA was also amplified by the respective PCR assays and gave positive signals for A. fumigatus DNA (Fig. 2A and C, lanes 7 and 9). Subsequently, 100 ng of human genomic DNA tested with the TR nested PCR assay resulted in no signal (Fig. 2B, lane 9). Fifty picograms A. fumigatus DNA diluted in 100 ng human genomic DNA resulted in a PCR amplicon of about 100 bp apparently assigned to the A. fumigatus DNA. Cross-reactivity with human DNA was not detectable (Fig. 2B, lane 10).

3908

aac.asm.org

PCR assays using DNA of clinical samples directly as the template resulted in PCR amplicons. This is exemplarily shown for two patients in Fig. 2A, lanes 8 and 9; B, lanes 11 and 12; and C, lanes 10 and 11. Fifty picograms of A. fumigatus wild-type DNA and 50 pg of DNA of the two azole-resistant A. fumigatus isolates (strains F16216 and F14532) diluted in 100 ng human genomic DNA resulted in positive signals using the three PCR assays (Fig. 2D). The PCR amplicon of the TR PCR assay for azole-resistant A. fumigatus strain F16216 carried the 34-bp TR in the cyp51A gene promoter region and was therefore 34 bp longer than the wild-type and strain F14532 PCR fragments (Fig. 2D, lane 6). DNA sequence analysis of the A. fumigatus wild-type PCR amplicons confirmed the wild-type sequence of the cyp51A gene, showing that A. fumigatus cyp51A DNA fragments were amplified by the use of the particular PCR assays. Azole-resistant A. fumigatus isolate F16216 served as the positive control for the detection of the TR and L98H alterations in the cyp51A gene via PCR and consecutive DNA sequence analysis. The M220 alteration was not found in this sample. In strain F14532, the L98H and TR alterations were not detected, whereas DNA sequence analysis revealed a substitution of base T to C on position 730 of the cyp51A gene, leading to an M220T amino acid alteration. DNA sequence analysis is mandatory to detect the mutations in the amplified cyp51A gene fragments. Stored samples of 8 hematological patients positive in our nested diagnostic Aspergillus PCR assay (22) were analyzed with the L98H, M220, and TR PCR assays and consecutive DNA sequence analysis to establish and confirm our method for detection of the most common azole resistance-mediating mutations in the A. fumigatus cyp51A gene (Table 2). The samples of patients 1 and 2 shown in Fig. 2A to C did not reveal any mutations after DNA sequence analysis of the PCR amplicons. The samples of patients 3 and 5 showed the L98H alteration, and patient 3 additionally had the TR in the cyp51A promoter region, but in patient 5, the TR alteration was not found in combination with the L98H alteration. Culture results of both patients were negative; neither patient ever received azole therapy or prophylaxis. Patient 5 died; he had been treated with an azole (voriconazole). Patient 3 was treated with an azole (voriconazole) combined with liposomal amphotericin B and survived. DISCUSSION

To overcome culture-based diagnostic limitations, we established PCR assays to detect the most common azole resistance-mediating (key) mutations of the A. fumigatus cyp51A gene in primary clinical samples from patients with hematological malignancies. PCR assays for the detection of A. fumigatus cyp51A alterations have been described, but the assays investigated fungal DNA only from cultures of clinical isolates (7, 8, 11, 14, 17, 26). From a clinical point of view, in patients with hematological malignancies at high risk for IA, evident Aspergillus culture yields of blood or BAL fluid samples are low and a culture-based diagnosis of IA is rarely achieved, because positive culture results from any clinical sample are seldom available, in general, in the early, crucial course of a case of IA. The thereby limited ability of resistance detection led to the development of culture-independent PCR approaches providing a sensitive and rapid methodology of azole resistance identification also in culture-negative clinical samples. Up to now, only one PCR-based assay detecting cyp51A


Detection of Azole Resistance in A. fumigatus

TABLE 2 Results from patient’s samplesa

Patient

Sample

Diagnosis

1 2 3 4 5 6 7 8

BAL fluid BAL fluid Brain abscess BAL fluid Lung biopsy BAL fluid BAL fluid BAL fluid

Mantle cell lymphoma Waldenstroem’s macroglobulinemia T-ALL Multiple myeloma COPDb Non-Hodgkin’s lymphoma ALL Non-Hodgkin’s lymphoma

Diagnostic significance

Nested Aspergillus PCR result

Proven Probable

⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹

Proven

cyp51A alteration TR

L98H

M220

⫺ ⫺ ⫹ ⫺ ⫺ ⫺ ⫺ ⫺

⫺ ⫺ ⫹ ⫺ ⫹ ⫺ ⫺ NT

⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺

a

cyp51A alterations are determined by PCR analysis and consecutive DNA sequence analysis directly from primary clinical samples. BAL, bronchoalveolar lavage; ALL, acute lymphatic leukemia; COPD, chronic obstructive pulmonary disease; NT, not tested (insufficient sample remaining). b Not neutropenic.

mutations in clinical samples (sputum) from patients with underlying pulmonary diseases has been described. Only a few patients in the previous study suffered from invasive pulmonary aspergillosis (IPA), but these samples were not tested due to an insufficient amount of sample remaining (6). Our group has long-standing experience with the development and validation of sensitive and specific PCR-based assays to detect invasive fungal infections in hematological patients, especially infections caused by Aspergillus spp. (1–3, 12, 13, 22, 24, 25). We therefore established a molecular, non-culture-based approach to detect the clinically leading azole resistance-mediating key mutations of the A. fumigatus cyp51A gene directly from primary clinically relevant samples. In this scenario, BAL fluid and tissue samples are more applicable than blood samples because the fungal load is likely to be higher, particularly in hematological patients undergoing intensive antifungal therapy, so that the ratio of target (fungal) and nontarget (human) DNA is more favorable in BAL fluid and tissue samples. The very small amount of included A. fumigatus DNA is the limiting factor when investigating primary clinical samples directly. As single PCR assays amplifying short DNA fragments are more sensitive, we established three distinct PCR assays for the detection of cyp51A mutations. Our nested PCR assay for the detection of the TR alteration in the cyp51A promoter region showed a higher sensitivity than the other two PCR assays. The assays for the detection of the L98H and M220 alterations were established as one-step PCR assays, because nested PCR approaches for detection of these alterations resulted in unspecific PCR amplicons but not in a higher sensitivity. None of the primer combinations showed cross-reactivity with nontarget human genomic DNA when investigating 100 ng of this DNA as a negative control. Because of that, PCR amplicons from patients’ samples containing a mixture of human genomic DNA and Aspergillus DNA could directly be used for DNA sequence analysis without previous gel extraction, saving both time and a loss of DNA. Only when investigating clinical samples containing a very large amount of human genomic DNA did the template DNA taken for the PCR analysis of the samples contain more than 100 ng of human genomic DNA. In these cases, the L98H PCR assays sometimes resulted in additional weak PCR signals, which required the extraction of the A. fumigatus PCR product from the agarose gel before DNA sequence analysis. According to Snelders et al. (23), Rodriguez-Tudela et al. (19), van der Linden et al. (27a), Lockhart et al. (15), and Chowdhary et al. (5), azole resistance in Aspergillus fumigatus isolates is primarily


due to the TR/L98H mutation and would thus be detected by our assay. Howard et al. described more mutation variety in the Manchester, United Kingdom, patient population, so our assay would probably work less well at detecting azole resistance in this group of patients (mostly patients with underlying pulmonary diseases) (10). Investigating primary clinical samples with our PCR assays, we detected the L98H alteration in patient 5 but not in combination with the TR alteration. The L98H mutation alone does not mediate azole resistance (8). In a second patient suffering from ALL, the L98H mutation was detected in combination with the TR alteration in a brain biopsy specimen. To our knowledge, this is the first patient in Germany showing this molecular finding. The clinical impact of the detected mutation pattern was not assessable, because the patient was treated at the time of brain biopsy with an azole antifungal combined with amphotericin B. The current study is the first to detect azole resistance directly from primary clinical specimens in a defined group of hematological patients. Both a retrospective epidemiological study and a prospective diagnostic study testing primary clinical samples from hematological patients with a limited or insufficient response to azole treatment or prophylaxis are under way. In addition, we have established novel PCR assays for the detection of other hotspot mutations, e.g., G54. We consider our rapid molecular assay to be of high epidemiological and clinical relevance to detect azole resistance and to allow significantly faster targeted antifungal therapy in patients with IA. Furthermore, the direct and rapid detection of azole resistance due to cyp51A gene alterations allows the differentiation between the diverse azole resistance mechanisms, as not every case of clinically relevant azole resistance is caused by cyp51A alterations. ACKNOWLEDGMENT This study was supported by a grant of the German Cancer Aid/Dr. Mildred Scheel Foundation for Cancer Research (project 109 411).

REFERENCES 1. Buchheidt D, et al. 2002. Clinical evaluation of a polymerase chain reaction assay to detect Aspergillus species in bronchoalveolar lavage samples of neutropenic patients. Br. J. Haematol. 116:803– 811. 2. Buchheidt D, et al. 2001. Detection of Aspergillus species in blood and bronchoalveolar lavage samples from immunocompromised patients by means of 2-step polymerase chain reaction: clinical results. Clin. Infect. Dis. 33:428 – 435.

aac.asm.org 3909

Spiess et al.

3. Buchheidt D, Hummel M, Schleiermacher D, Spiess B, Hehlmann R. 2004. Current molecular diagnostic approaches to systemic infections with aspergillus species in patients with hematological malignancies. Leuk. Lymphoma 45:463– 468. 4. Bueid A, et al. 2010. Azole antifungal resistance in Aspergillus fumigatus: 2008 and 2009. J. Antimicrob. Chemother. 65:2116 –2118. 5. Chowdhary A, et al. 2012. Isolation of multiple-triazole-resistant Aspergillus fumigatus strains carrying the TR/L98H mutations in the cyp51A gene in India. J. Antimicrob. Chemother. 67:362–366. 6. Denning DW, et al. 2011. High-frequency triazole resistance found in nonculturable Aspergillus fumigatus from lungs of patients with chronic fungal disease. Clin. Infect. Dis. 52:1123–1129. 7. Diaz-Guerra TM, Mellado E, Cuenca-Estrella M, Rodriguez-Tudela JL. 2003. A point mutation in the 14alpha-sterol demethylase gene cyp51A contributes to itraconazole resistance in Aspergillus fumigatus. Antimicrob. Agents Chemother. 47:1120 –1124. 8. Garcia-Effron G, et al. 2008. Rapid detection of triazole antifungal resistance in Aspergillus fumigatus. J. Clin. Microbiol. 46:1200 –1206. 9. Howard SJ, Arendrup MC. 2011. Acquired antifungal drug resistance in Aspergillus fumigatus: epidemiology and detection. Med. Mycol. 49:90 –95. 10. Howard SJ, et al. 2009. Frequency and evolution of azole resistance in Aspergillus fumigatus associated with treatment failure. Emerg. Infect. Dis. 15:1068 –1076. 11. Howard SJ, et al. 2006. Multi-azole resistance in Aspergillus fumigatus. Int. J. Antimicrob. Agents 28:450 – 453. 12. Hummel M, et al. 2010. Aspergillus PCR testing: results from a prospective PCR study within the AmBiLoad trial. Eur. J. Haematol. 85:164 –169. 13. Hummel M, et al. 2006. Detection of Aspergillus DNA in cerebrospinal fluid from patients with cerebral aspergillosis by a nested PCR assay. J. Clin. Microbiol. 44:3989 –3993. 14. Klaassen CH, de Valk HA, Curfs-Breuker IM, Meis JF. 2010. Novel mixed-format real-time PCR assay to detect mutations conferring resistance to triazoles in Aspergillus fumigatus and prevalence of multi-triazole resistance among clinical isolates in the Netherlands. J. Antimicrob. Chemother. 65:901–905. 15. Lockhart SR, et al. 2011. Azole resistance in Aspergillus fumigatus isolates from the ARTEMIS Global Surveillance Study is primarily due to the TR/L98H mutation in the cyp51A gene. Antimicrob. Agents Chemother. 55:4465– 4468. 16. Maschmeyer G, et al. 2009. Diagnosis and antimicrobial therapy of lung infiltrates in febrile neutropenic patients: guidelines of the Infectious Diseases Working Party of the German Society of Haematology and Oncology. Eur. J. Cancer 45:2462–2472. 17. Mellado E, et al. 2007. A new Aspergillus fumigatus resistance mechanism

3910

aac.asm.org

conferring in vitro cross-resistance to azole antifungals involves a combination of cyp51A alterations. Antimicrob. Agents Chemother. 51:1897– 1904. 18. Perlin DS. 2009. Antifungal drug resistance: do molecular methods provide a way forward? Curr. Opin. Infect. Dis. 22:568 –573. 19. Rodriguez-Tudela JL, et al. 2008. Epidemiological cutoffs and crossresistance to azole drugs in Aspergillus fumigatus. Antimicrob. Agents Chemother. 52:2468 –2472. 20. Ruhnke M, et al. 2012. Diagnosis of invasive fungal infections in hematology and oncology— guidelines from the Infectious Diseases Working Party in Haematology and Oncology of the German Society for Haematology and Oncology (AGIHO). Ann. Oncol. 23:823– 833. 21. Sambrook J, Fritsch E, Maniatis T. 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 22. Skladny H, et al. 1999. Specific detection of Aspergillus species in blood and bronchoalveolar lavage samples of immunocompromised patients by two-step PCR. J. Clin. Microbiol. 37:3865–3871. 23. Snelders E, et al. 2008. Emergence of azole resistance in Aspergillus fumigatus and spread of a single resistance mechanism. PLoS Med. 5:219. 24. Spiess B, et al. 2003. Development of a LightCycler PCR assay for detection and quantification of Aspergillus fumigatus DNA in clinical samples from neutropenic patients. J. Clin. Microbiol. 41:1811–1818. 25. Spiess B, et al. 2007. DNA microarray-based detection and identification of fungal pathogens in clinical samples from neutropenic patients. J. Clin. Microbiol. 45:3743–3753. 26. van der Linden JW, et al. 2009. Azole-resistant central nervous system aspergillosis. Clin. Infect. Dis. 48:1111–1113. 27. van der Linden JW, et al. 2011. Clinical implications of azole resistance in Aspergillus fumigatus, The Netherlands, 2007-2009. Emerg. Infect. Dis. 17:1846 –1854. 27a.Van Der Linden JWM, Arendrup MC, Verweij PE, SCARE-Network. 2011. Prospective international surveillance of azole resistance (AR) in Aspergillus fumigatus (Af) (SCARE-Network), abstr. M-490. Abstr. 51st Intersci. Conf. Antimicrob. Agents Chemother. American Society for Microbiology, Washington, DC. 28. Verweij PE, Howard SJ, Melchers WJ, Denning DW. 2009. Azoleresistance in Aspergillus: proposed nomenclature and breakpoints. Drug Resist. Updat. 12:141–147. 29. Verweij PE, Snelders E, Kema GH, Mellado E, Melchers WJ. 2009. Azole resistance in Aspergillus fumigatus: a side-effect of environmental fungicide use? Lancet Infect. Dis. 9:789 –795. 30. Walsh TJ, et al. 2008. Treatment of aspergillosis: clinical practice guidelines of the Infectious Diseases Society of America. Clin. Infect. Dis. 46: 327–360.
