Development of PCR for simultaneously detection of ...

Development of PCR for simultaneously detection of C/ostridium botulinum ty pes A, B, E, and F 1

1

Pa loma Lorcnzo-Lozano , Osear Jiménez-Mateo 2, Jua n Ca rlos Cabria-Ramos , and M a r ía d el Valle Jiménez-Pér cz

*·'

1

Biological Defence Unit. NBC and Materials Area. Technological Institute ofLa Marañosa. Ministry of Defence. San Martín de la Vega, Km 10.5, 28330 Madrid, Spain 2

Underdirectorate-General for Technology & lnnovation. Directorate-General for Armament & Equipment. Ministry of Defence. Arturo Soria, 289. 28033 Madrid, Spain *Corresponding author: e-mail: [email protected], Phone: +34 91 1742368

Keywords: C/ostridium botulinum; botulinum ncurotoxins; typing; PCR

Clostridium botulinum is an oblígate anaerobic, endospore-forming bacterium that produces a lethal neurotoxin called botulinum neurotoxin (BoNT). BoNTs are one of the most powerful biological and chemical substances kuown, and are responsible for a paralytic disease kuowu as botulism, which is characterized by severe flaccid paralysis. BoNTs are divided iuto seven toxin types, A to G, according to their antigenic properties. Toxin types A, B, E, and F cause human botulism. The presumptive identification of the toxigenic strains and typing of BoNT were based on an euriclunent step and subsequent detcction of the toxin by in vivo mouse bioassay. This technique is highly sensitive and specific but laborious, time-consuming, and costly and raises ethical concems with regard to the use of experimental animals. Molecular biological methods based on the detection of BoNT genes in any neurotoxigenic microorganisms would be an ideal altemative. However, there have been few reports of the use of a single PCR primer set for simultaneous detection of BoNT genes of more than one type causing human botulism. In this study we report the development of a method for simultaneously detecting C. botulinum types A, B, E, and F. With the comparison of the sequences of C. botulinum types A, B, E, and F, the Biological Defence Unit has deve loped specific primers for detecting simultaneously the four types.

l. In troduction Botulism is a serious illness that causes flaccid paralysis of muscles. It is caused by a neurotoxin, generically called botulinurn toxin (BoNT), produced by the bacterium Clostridium botulinum and rarely by Closlridium butyricum and Clostridium baratii. There are three main kinds of botulism, which are categorized by the way in which thc disease is acquired: food-bome botulism, caused by eating foods that contain the botulinum neurotoxin; wound botulism, caused by neurotoxin produced from a wound that is infected with the bacteria Clostridium botulinum; aud infant botulism, which occurs when an infant consumes the spores of the botulinum bacteria. BoNT has been used as a biological weapon by many countries, including Japan, Germany, the United States, Russia and lraq. As a biological weapon, BoNT is considered extremely dangerous, banned by the Geneva Conventions, the Biological and Toxin Weapons Convention (BWC/BTWC) and the Chemical Weapons Convention (CWC). In contras!, BoNT has also been used as a therapeutic compound, and at appropriate doses, it has many useful applications: aesthetic and lreatment of neurological diseases, strabismus, muscular atony, stiff neck, severe facial spastic, etc. Tbe c lassification ofBoNTs is based on recognition by polyclonal serum. Seven antigenically toxin types (A, B, C, D, E, F, and G) o f the BoNTs have been identified [1 , 2). Toxin types A, B, E, and F cause human botulism, and belong lo groups 1 or II. Group 1 consists of proteolytic types A, B, and F, and groups II contains non-proteolytic of B, E, and F types [3-5). C. botulinum produces the seven antigenic types of neurotoxins, while C. butyricum, produces type E and C.baratii, produces type F [6, 7). Currently, microbiological methods take into consideration only C. botulinum species, and identification procedures include the confinnation and typing of the BoNTs production of the strain by mouse bioassay

1

[8, 9]. This teclmique is highly sensitive and specific, but costly, time-consuming (5 to 10 days), laborious, raises ethical concem due to the use of experimental animals, and does not take into consideration other BoNTs-producing clostridia. Efforts ha ve been made to develop altematives to animal testing, as recommended by international legislation. Thus, tbe development of molecular biological methods based on the detection of BoNTs genes would be ideal. Different PCR methods have been described for detection ofBoNTs-producing clostridia in food and clinical samples, and results obtained using PCR assays to detect neurotoxü1 gene fragments show a very high level of agreement wiú1 those from the mouse bioassay [10, 11]. However, there have been few reports of the use of a single PCR prüner set for simultaneous detection ofBoNT genes of more than one type causing human botulism.

2. Subject The goal of this work is the development of a method for simultaneous detection of C. botulinum types A, B, E, and F.

3. Materials and Methods Bacteria! culture conditions a nd genomic DNA extraction from pure c ultures Materials used in this study included Clostridial strains provided for Teclmological lnstitute of La Marañosa (Spain) and Clostridium-DNA preparations from lnstitute of Microbiology Bundeswer (Gennany) and Centre d'Etudes du Bouchet (France) as Table 1 shows. Clostridial strains were cultured anaerobically in Tryptone-yeast extract-glucose (TYG) broth for 48 h at 35°C [ 11 ). Genomic DNA was extracted from C. bot1tlinum and Clostridium spp. with a Geno mie DNA purification kit (QIAamp DNA Minikit (50) QIAGEN). DNA was evaluated by agarose gel electrophoresis and by amplification of the toxin and the 16S rRNA genes. DNA concentrations were determined using the nanoDrop system. Table 1. Bacteria! strains used In specificity test of seml-nested PCR assay

S ccics C. argentinense C. botulimm1 C. botulimml C. botulimm1 C. botulimmr C. perfringens C. pe1jringens C. peljringens C. peljringens C. perfringens C. perfríngens C. sporogenes C. sporogenes C. sporogenes C. sporogenes C. sporogenes C. botulinum C. bo1111ímm1 C. botulim1111 C. bowlimm1

Sero

G A A

E E

B B B F

e

SI rain CECT 4615 CECT551 CECT581 CECT461 1 CECT46 12 CECT376T CECT486 CECT 563 CECT4499 CECT821 CECf4110 CECf485 CECT 553 CECT797 CECT892 CECT4990 CECT4610 1731 1732 1733

S ero Spain Spain Spain Spain Spain Spain Spain Spain Spain Spain Spain Spain Spain Spain Spain Spain Spain France France France

C. botulimm1 C. botulímm1 C. botulimm1 C. botulínum C. botufinum C. botulilutm C. botulinum C. botulinum C. botulimm1 C. botulinum C. botulínum C. bowlínum C. botulimtm C. botulinum C. botufínum C. botulinum C. sporogenes C. sporogenes C. sporogenes C. s oro enes

A A A A A A

F F F F F

e D E G

e

Strain 1734 1736 1740 lBT2268 IBT2292 IBT2295 IBT2267 REB 1072 REB 1955 IBT2297 IBT2272 212F ecuo 7970 2/3 D REB 17 18 IBT 2270 DSM795 885/05 925/05 C2

Ori in France France France Gcnnany Gennany Gennany Gennany Gemmny Gennany Gennany Gcnnany Gennany Gennany Gennany Germany Gcrmany Gennany Gennany Gennany Gennany

Primers design An alignment (DNAST AR software program) of fourteen published sequences of the botulina l neurotoxin genes of four serotypes A, B, E, and F, was performed. The nucleotide sequences were collected from the GenBank Sequence Database (http://www.ncbi.nlm.nih.gov) for C. botulinum types A (accession no. X52066), 8 (accession no. X71343), E (accession no. X62683) and F (accession no. X81714). Four sets of nested primers, specific for types A, B, E, and F neurotoxin genes, were designed at Technological Jnstitute ofLa Marañosa (Table 2). Semi-nested PCR The serni-nested PCR strategy consisted of two-step amplification. In the first step, amplification was performed with primers BT-F and BT-R [11]. The DNA amplification was performed in a total volume of 25 ~d in a 9700 Thennal Cycler (Applied Biosystem, USA). The PCR mixture consisted of 0.1 ¡.tg of

2

genomic DNA templa te, 1.25 U of BioTaq polymerase (Roche), 0.4 J.!M of each primer, 0.2 mM dNTPs (Roche), 2 mM of MgCI 2 (Roche) and 1 x BioTaq buffer (Roche). The amp1ification conditions were: inüial denaturation at 94°C for 5 min, followcd by 35 cycles of denaturation at 94°C for 1 min, annealing at 55°C for 1 min, extension at 72°C for 1.5 min, anda final extension step for 7 min. The second step amplification was conducted with primers designed at Technological lnstitute of La Marañosa, i.e. BoNT-RW and the interna! set of primers (BoNTB-RW, BoNTA-FW, BoNTB-FW, BoNTE-FW, BoNTF-FW) (Table 2) in a single tube using the same conditions as described above except for annealing: 50°C for 1 min and extension at 72°C for 1 min. One microliter of PCR product obtained in the ftrst step was used as template in the second step. The PCR products were visua1ized by electrophoresis on a 2% (wt/vol) agarose gel. The gels were stained in ethidium brornide solution 1 mg 1 mi and documented with t11e GeneGenius (Syngene). Molecular marker Smartladder (Eurogentec) was included on the gel. Tabla 2. Primers used for detection of BoNT genes types A, B, E, and F•. l'rímcr

Loca tíon on BoNT gene•

Nu clcotícd scquence (5'- 3' )

bOlitA BoNTA·FW

ATGATCCCTTATGGTGTTAAACGG

BoNTB·FW

TATATTCTGAAGAGGAAAAGTC

BoNTE-FW

AATGAACTTAATCAAAAGGTITC

BoNTF·FW

GAAGAATTGAACAAAAAAGTTTC

BoNTABEF-R W

AGTGATA YTTTCCA TCCWGAAITA

BoNTB-RW

ATAGATATTTTCCAGCCTGAATTA

(XS2066) 2690·2716

b0111B (X71343)

b0111E

/Jo11tF

(X62683)

(X81714)

679

2546·2568 2605·2624

629 2606·2628

3222-3246

PCil prod uct sizc (bp) 536

3222-3246

3222·3246

626

3222·3246

3222·3246

Y{C,T); W{A,T) • BoNT, C. botulinum neurotoxin.

4. Results In order to optimize the assay reaction conditions, pure genomic DNA from C. botu/inum CECT 58 1, CECT 4611 , CECT 4612 and CECT 461 O was used as templa te. In the Cirst step of semi-nested PCR, amplification of the respective bont genes from C. botu/inum types A, B, E, and F resulted in PCR products of the predicted sizes, ranging from 1033 to 1054 bp (data not shown). The second step yielded the expected amplification product: 536 bp for type A, 679 bp for type B, 629 bp for type E, and 626 bp fo r type F (Figure 1). The PCR products could be clearly visualized in agarose gels.

679 62 9 626 536

pb pb pb pb

Fig. l. PCR product a mplificd from lfll of PCR ncsted from genomic DNA of C. botulimtm type strains. Lane 1\1, 100-bp l:ld dcr (l nvitrogcn); la ne 1, ty pc A (CECT 58 1); la nc 2 typc E (CECT 46 11); la ne 3 ty1>e F (CECT 461 2); la ne 4 typc B C ECT 4610); an d lnnc 5 nega tivc co nlrol (C. sporogeues CECT 797).

In the specificity test of the semi-nested PCR, all the bont genes from twenty four strains of C. botu/inum, gave rise to products of the expected sizes, whereas none of the other Clostridium spp. related strains yielded products (Figure 2, Figure 3 and Figure 4).

3

Figure 2. PC R product amplilicd frorn IJtl ofPCR ncsted from gcnomic ONA of e botuliuu111 typc strains: lane 1 typc A+ B (IBT 2268), lan e 2 typc A {IBT 2292), lanc 3 type A (IBT229S), lane 4 type A (IBT 2267); lane S ty pe F (R EB 1072); lane 6 ty pe F (REB 19SS); lanc 7 type F (IBT 2297); lane 8 typc F (IBT 2272); lan e 9 typc F (2/2 F); lanc 10 typc C2 (1/6 C); lane 11 typc D (2/3 O); lane 12 typc E (REU 1718); lanc13 lype G (IBT 2270) ande sporogeues: lanc 14 (DSJ\179S); lane 15 (885/05); lane 16 (925/05); lanc 17 (CI); lan c 18 (C2). Lane M: 100-bp h1ddc•··

Figu re 3. PC R prod ucl amplilicd from 1Jll of PCR nestcd from genomic DNA of e bot11fimt111 ty pc strains : lane 1 type B (1731); la nc 2 typc B (1732); lanc 3 type F (1733); lan c 4 lype A (1734); lanc S type A ( 1736); lane 6 typc A (1740). Lnne 1\1: 100- bpladdcr.

Figure 4. I'CR product amplificd fro m 1Jll of r•CR nestcd from gcnomic ONA of: e bollllin11111 lanc 1 (type A CECT 461 1), lane 2 (typc E CECT 4611), lanc 3 (ty pe F CECT 4612); e sporogeues lanc 4 (CECT 797); e perfriugeus lanes S, 6, 7, 8 (CECT 486, 4499, 376T, 563); e bot11limt1111anc 9 (typc 1\ CECT 551); e argeutiueuse lane 10 (CECT 4615); C. perfriugeus lanc 11 (CECT 821); e sporogeues lan es 12, 13, 14, 15 (CECT 485,892,553, 4990). La nc C positi vc con trol (DNA type A, B, E an d F), lane C negativc contro l, lnne l\1: 100-bp la dd er.

5. Conclusions In this study we have used a semi-nested PCR for simultaneous detection and identification of C. botulinum types A, B, E, and F. The primer set for the first amplification allowed the simultaneous detection of C. botulinum types A, B, E, and F. The second amplification used a primer cocktail, designed at Technological lnstitute of La Marañosa, a common reverse primer and six new primers, each specific for one or other of the each type A, B, E or F neurotoxins genes. The applicability of this technique was demonstrated by the analysis of forty samples. Twenty four C. botulinum (eight type A, three type B, one type C, one type D , three type E, six type F and one type G), six C. perfringens strain, one C. argentinense and nine C. sporogenes strain. The use of a semi-nestcd PCR is a valuable alterna ti ve to time-consuming traditional methods, especially when PCR could be applied altematively to animal-based assays. The experimental procedure developed in this study can be implementcd as a routine detection method.

4

Acknowledgments We would like to thank the lnstitute ofMicrobiology Bundeswer (Germany) and the Centre d'Etudes du Bouchet (France) for their support by providing Clostridium DNA.

6. References [ 1] Hatheway, C. L. Botulism: !he present status of the disease. Curr. Top. Microbio/. In m uno/. 1995; 195:55-75. [2] Cherington, M. Bolulism: update ancl revicw. Semin. Neurol. 2004;24: 155- 163. [3] Macdonald, T. E. et al Differentiation of C/ostridium botulinum serotypc A strain by Multiple-Locus Variable-Number Tandem-Repeat Analysis. Appl. Enviran. Microbio/. 2008;3:875-882. [41 Hatheway, C. L. Toxigenic Clostridia. C/in. ldicrobiol. 1990;3:66-98. [51 Smith, L. D. S. Botulinum, the organism, its toxins, the disease. Charles Thomas, Springlield, IL. 1977. [6] Fenicia, L. et al. SYBR green Real-Time PCR rnethod to detect C/ostridium botulinum type A. Appl. Enviran. Microbio/. 2007;9:289 1-2896. (7] Hill, K. K. et al Genetic diversity among bowlinum neurotoxin-producing clostridial strains. J. Bacteria/. 2007;3:8 18-832. [8] Wictome, M. et al Development of an in vitro assay for Clostridium botulimtm type B neurotoxin in foods that is more sensitive than the mouse bioassay. Appl. Enviran. Microbio/. 1999;65:3787-3792. [9] Lindstrom, M. et al Laboratory diagnostic of botulism. Clin. Microbio!. Reviews. 2006;2:298-314. [10] Collins, M. D. el al Phylogeny and taxonomy of the food-borne pathogen Clostridium botulinum and its neurotoxins. J. Appl. Microbio!. 1998;84:5- 17. [11] Na-Ri S. et al Development of enrichment semi-nested PCR for Clostriditm1 botulinum types A, B, E, and F and its application to Korean environmental sarnples. ¡\1/o/. Cells. 2007;3:329-337.

5