rt al., 1990; Robin et al., 1990; Robinson et al., 1986). The homologues of ..... Bacillus subtilis ftsAZ Operon. 971. 400 z -. 300. 'S. 5. 0 .o. L. B. :: i. 200. 0. :: c. 4. 8. &. 100 ...... Cell, 52, 697-704. Strauch, M., Webb, V., Spiegelman, G. & Hoch, J. A..
J. Mol. Biol. (1992) 224, 967-979
Developmental
Regulation of Transcription sub tilis ftsAZ Operon
Genevihve Gonzy-Treboul,
C&line Karmazyn-Campelli
Institut de Biologic Physico-Chimique 13 rue Pierre et Marie Curie, 75005 Paris,
of the Bacillus and Patrick Stragiert
France
(Received 11 December 1991; accepted 10 January
1992)
The products of the ftsA and ftsZ genes play a major role in septum formation in Escherichia coEi. Their homologues have been found in various bacterial species, such as Bacillus subtilis where they are involved in septation during vegetative growth as well as during sporulation, a developmental process that is initiated by the formation of an asymmetrically positioned septum. Transcription of the B. subtilis ftsAZ operon was studied during exponential growth and sporulation by monitoring b-galactosidase synthesis in strains harboring fusions of the E. eoli la& gene with various fragments of the ftsAZ regulatory region. Transcription of the ftsAZ operon was found to be controlled by three promoters which were mapped by primer extension and characterized by their temporal pattern of expression. Two of these promoters, Pl and P3, are dependent on g*, the major vegetative sigma factor, and are expressed mainly during growth. The third one, P2, is recognized by &associated RNA polymerase and its activity increases three- to four-fold around the onset of sporulation. The post-exponential enhancement of PB-driven transcription is abolished in a spoOA mutant but partially restored in an abrB spoOA double mutant. After inactivation by oligonucleotide-directed mutagenesis mutated copies of Pl and P2 were introduced into the chromosome upstream from the ftsAZ operon. Transformants could be obtained only when &AZ transcription was controlled by a combination of two intact promoters, neither PI, P2 nor P3 being essential for viability. The sporulation efficiency was found to be dependent on the level of transcription of ftsA2, the absence of P2 still allowing 30% of the normal sporulation rate. Therefore the post-exponential burst of synthesis of the FtsA and FtsZ proteins is not an absolute requirement for the successful completion of the asymmetric septum.
Keywords: transcription;
sporulation;
sigma factor;
1. Introduction
septation;
Bacillus subtilis
personal communication) and then of 8 in the mother cell (Beall & Lutkenhaus, 1991; Driks & Losick, 1991). Therefore, identification of the gene products involved in asymmetric septation is of major importance for a global understanding of sporulation as a primitive developmental process. Most of the studies on septation have been carried out in Escherichia coli and they have provided evidence for the major role played by the FtsA and FtsZ proteins (de Boer et al., 1990). FtsA is a component of the cytoplasmic membrane (Pla et al., 1990) that interacts with the PBP3 protein (Tormo et al., 1980) and is involved in the last steps of cell division (Robinson et al., 1988). FtsZ molecules are able to self-assemble in a ring-like structure at the location of the next septum (Bi & Lutkenhaus, 1991) and appear to be involved in initiation of cell division (Lutkenhaus et al., 1980). Both genes are
Sporulation in Bacillus subtilis involves two cell types that follow different programs of gene expression that are co-ordinated to each other by crisscross activation of successive sigma factors (Losick & Stragier, 1992). Although the regulatory network that controls the cascade of sigma factors during sporulation is now relatively well known the mechanisms inducing the asymmetric septation that creates two unequal compartments remain elusive. Formation of the asymmetric septum is the first recognizable morphological event in sporulation and it is a prerequisite for activation of cF in the forespore (Margolis et al., 1991; P. Margolis & R. Losick, TAuthor to whom all correspondence should be addressed. 967 0022-2836/92/08096-13
$03.00/O
0
1992 Academic
Press Limited
968
(4. Conzy-Trkboul
co-transcribed in I;-:. toll: but multiple promoters allow complex regulation of their expression (Aldea rt al., 1990; Robin et al., 1990; Robinson et al., 1986). The homologues of the ftsA and ftsZ genes have been identified in H. subtilis and were found to be contiguous on the chromosome (Real1 et al., 1988). Interestingly, conditional mutations in ftsA and ,ftsZ have been found that produce a filamentous phenotype during vegetative growth and also prevent asymmetric septum formation at non-permissive temperature: the spo279’” mutation that decreases sporulation efficiency by a factor of 50 (Young, 1976) is a missense mutation in the aminoterminal part of @A (C. Karmazyn-Campelli, L. Fluss, T. Leighton, & P. Stragier, unpublished results), and a strain containing theft&l” mutation sporulates 1000 times less than a wild-type strain (Beall & Lutkenhaus, 1991). Furthermore, it was demonstrated that an artificial reduction of the level of FtsZ molecules blocks asymmetric septation and leads to a 105-fold decrease of the sporulation rate (Real1 & Lutkenhaus, 1991). Therefore, both FtsA and FtsZ seem to be involved in asymmetric septation, which provides us with the first opportunity for studying this process at a molecular level. As a first approach in understanding the role of FtsA and FtsZ in synthesis of the asymmetric septum we undertook a study of the expression of the ftsAZ operon during vegetative growth and sporulation. Transcription of &AZ appears to be controlled by a complex array of &s-acting sequences and regulatory molecules which could allow integration of multiple signals related to the metabolic status of the cell.
et al.
E. coli was grown in LB medium pg/ml) when appropriate.
[a) Bacterial strains and media Most B. subtilis strains were derivatives of strain JH642 trpC2 pheA1. The spoOH81 strain AG145 was provided by A. Grossman. The spoOHAHindII1 strain SC257 and the strain SC1026 containing the abrB::TnSlr mutation were given by 8. Cutting. Strain MO712 in which the spoOA gene is inactivated by insertion of a kanamycin-resistance marker in the BgZII site of the spoOA cistron was constructed by A.-M. G&rout-Fleury. The strain containing the spo279’” allele was a derivative of strain 168 metC2 lysl and was provided by T. Leighton. B. subtilis cells were transformed as described (Anagnostopoulos & Spizizen, 1961) and sporulation was induced by exhaustion in Difco nutrient broth medium (DS medium, Schaeffer et al., 1965). Heat-resistant spores were counted after 32 h of growth at 37°C and heating 10 min at 80°C. Antibiotics were added to selection and growth media when required: chloramphenicol (5 pg/ml), a mixture of erythromycin (05 rig/ml) and lincomycin (12.5 pgglml); kanamycin (5 rig/ml). In the case of kanamycin selection for antibiotic resistance was done on LB plates (Miller, 1972) and this antibiotic was omitted when the cells were grown in nutrient broth medium. Plasmid constructions were done in E. co& strain TGl according to classic procedures (Sambrook et al., 1989). A derivative of strain TGl, carrying the pcnB80 zad::TnlO allele (Lopilato et al., 1986)) was constructed by M. Graffe.
ampictillin
(3
(b) Plasmids Two different plasmids were used for construction of la& transcriptional fusions. Both plasmids cont.ain a promoterless E. coli la& gene that uses the translation initiation signals of the B. subtilis spo VG gene (Perkins & Youngman, 1986) and a chloramphenicol resistance marker. In the pDG268 plasmid the cat and la& genes locus are bracketed by sequences from the amyE (Antoniewski et al., 1990). After linearization of the plasmid with a restriction enzyme cutting in the backbone sequences of the vector both the la& fusion and the cat marker were integrated by a double recombination event into the chromosomal amyE locus of the recipient strain M01099. This JH642-derivated strain contains an erythromyein resistance cartridge inserted at the amyE LOCUS, which allows for an easy screening of the transformants that are issued from a double recombination event. since the acquisition of chloramphenicol resistance leads simultaneously to the loss of erythromycin resistance. Plasmid pJM783 does not contain any B. subtilis sequences nor a functional replication origin for B. subtilis (Perego et al.. 1988). Therefore. transformation is done with circular plasmids containing a B. subtilis insert cloned upstream from the la& gene and selection for chloramphenicol resistance leads to integration of the whole plasmid by a single recombination event at the homologous locus. For some experiments that did not involve la& fusions we constructed another integrative plasmid, pDG641, that contains an erythromycin resistance cartridge cloned in the BgZIT site of the versatile vector pJRD184 (Heusterspreute et al., 1985), in the opposite orientat,ion of the tetracycline resistance gene. (c) Transcriptional
2. Materials and Methods
containing
la& fusions
The ftsAZ region has been cloned in our lab (C. Karmazyn-Campelli, L. Fluss, T. Leighton & P. Stragier, unpublished results). Various fragments indicated in the text were subcloned in polylinker-containing plasmids (Yanish-Perron et al., 1985; Short et al., 1988; Chambers et al., 1988) in such a way that they became bracketed with restriction sites compatible with the cloning sites of the pDG268 vector (EcoRI-HindIII-BamHI). One or two steps were required in each case that always involved naturally compatible ends. However, when the Hinf’I site located at position 179 (see Fig. 2) was used as a border the DNA was previously blunted by treatment with the Klenow enzyme. The sequence of the resulting junction in the recombinant plasmid was checked by nucleotide sequence analysis (Sanger et al., 1977; Biggin el al., 1983). A similar strategy was used for constructing la& fusions in the pJM783 vector where the cloning sites are slightly different (EcoRI-SmaI-BamHI). p-Galactosidase assays were performed on sonicated extracts as described (Stragier et al., 1988), protein concentration being determined by the Coomassie blue method (Bradford, 1976). fi-Galactosidase specific activity is expressed as nmol 2-nitrophenyl-fl-n-galactopyranoside hydrolyzed/min mg protein. (d) Oligonucleotide-directed
mutagenesis
Oligonucleotide-directed mutagenesis was performed on single-stranded DNA prepared from a BluescriptKS
Bacillus subtilis ftsAZ Operon
969
1OObp I
ma
(fts 1)
Figure 1. Genetic organization of the &AZ region of the B. subtilis chromosome. The upper part of the Figure shows theftsAZ operon and its flanking genes (Beall et al., 1988). All the genes in this region of the chromosome are transcribed clockwise (straight arrows). The lower part of the Figure is an expanded map of the sbp-f&4 intergenic region that contains the 3 promoters controllingftsA2 transcription (wavy arrows). Asterisks indicate the point mutations that were introduced by oligonucleotide-directed mutagenesis: ftsl creates an HpaI site and fts2 destroys an XmnI site. The restriction sites indicated were used for construction of some transcriptional fusions with la& (see the text).
derivative containing the 425 bpt RsaI fragment shown in Fig. 2. The 30-mer 5’-CATTGTATTGTTGTTUCCGCAAATAATAG, which introduces 2 extra A residues at position 339 to 340 and creates an HpaI site, was used for generating the psi mutation. The fts2 mutation w&9 created with the 19-mer 5’-GGATATAACAAATATTTTC which replaces the G residue at position 240 by an A residue and destroys an XmnI site. Both oligonucleotides were used simultaneously for creating the double mutant ftsl fts2. Polymerization was done according to the method of Kunkel et aE. (1987) with Sequenase (U.S. Biochemical Corp.). The presence of the mutations in the plasmids recovered after transformation of E. coli TGl was first checked by restriction analysis and then by sequencing of the complete RsaI insert. After recombination in B. subtilis as described in Fig. 8 the presence of the mutations upstream from the f&42 operon was checked by hybridization (Southern, 1975) with a 2 kb fragment overlapping the sbp-ftsd intergenic region that had been labeled with digoxygenin (Boehringer). (e) Mapping
the S’termini of ftsAZ transcripts
RNA isolation and primer extension analysis of fk4.Z transcripts were performed according to Moran (1990). As detailed in the legend to Fig. 5 RNA was prepared from strains in which ZacZ transcription was under the control of only 1 of the 3 ftsAZ promoters. The same 2 primers were used in each case which introduced an internal control in these experiments. These primers were complementary to the spoVG moiety of the hybrid ftsA-spoVGZacZ mRNA: VG-4 corresponds to positions -41-22 in the spoVG region (5’-GTATCAATTCAAGCTGGGG) and VG + 17 corresponds to positions + 17/ - 2 (B’-CCCTATATAAAAGCATTAG) (Perkins & Youngman, 1986), + 1 being the normal transcription start of the spoVG gene. Each extension product was run in parallel with the sequencing ladder generated by the chain-termination
method using the same primers and single-stranded DNA templates prepared from Bluescript derivatives containing an identical ftsA-spoVG-lacZ fusion insert. Although 3 to 5-fold larger amounts of RNA were used in each experiment carried out with the VG-4 primer no clear extension product could be obtained for the Pl TAbbreviations
used: bp, base-pair(s): kb, lo3 bp.
transcripts. A possible explanation might be that the spo VG sequence present in our spo VG-ZacZ carrying plasmids has recently been found to contain a 2 bp deletion around position - 13 (Jacob et aZ., 1991) that will weaken the efficiency of hybridization with the VG-4 primer. This 2 bp deletion explains also why the shift seen in Fig. 5 between the two sequencing ladders generated by the VG -4 and VG + 17 primers (and that were loaded on the gel simultaneously) is 2 bp shorter than expected.
3. Results (a) Transcription of the ftsAZ operon is developmentally regulated
In order to monitor the expression of the ftsAZ operon throughout exponential growth and sporulation a 425 bp Rsal fragment overlapping the end of the upstream sbp gene and the beginning of the ftsA coding sequence was cloned upstream from the E. coli la& gene in the pDG268 vector (see Fig. 1 for a physical map of the ftsAZ locus and Fig. 2 for the DNA sequence of the RsaI fragment). The resulting transcriptional la& fusion was introduced into the chromosome at the amyE locus by a double recombination event occurring through the flanking amyE sequences present in the pDG268 vector. The temporal pattern of expression of this fusion is given in Figure 3 and shows that synthesis of j?-galactosidase is roughly constant during exponential growth (about 300 spec. act. units) and increases by a factor of 2 around the onset of sporulation (defined as to). An identical transcriptional fusion was constructed in the pJM783 vector and integrated by a single crossover into the B. subtilis chromosome at the ftsAZ locus. This single homologous recombination event placed the 1acZ gene under the control of all the &s-acting chromosomal sequences located upstream from theftsAZ operon. The pattern of /3galactosidase synthesis driven by this fusion was found to be identical to the previous pattern monitored at the amyE locus (data not shown), which indicates that all the signals governing transcription of the @AZ operon are present in the 425 bp RsaI
G. Gonzy-Trdboul et al.
970
RsaI NdeI GTACATATGATGARATGGTATTTGTTT~~GGTTT~TTTTTTAATATTATATTGGCAAT~GTTTAG~TT~T~TG~AGT~~AT~TT . . 50 p3l--+
G;T~TA~~TTGT~TTTA~~TATATT~G~ATTTGGAGT~AGATTATTT~AG~TATAG~~GTTAT~G~~T~TA~T~~ . 100
150 XmnI
AAAGTGGACTCTTTCT-T. .
.
pa+
TGTGAT@&AGA$GATATACATAGGATATAACGAATATTTTcAATAAXAT
200
i’jtsz
2;o ?$w
AAAATGTGAAAAGCACATAARAATATTCTGTTGTTATTTTTTGTTACACACTTGT~GCCA~TTCATTGTATTGTTGTTCC~A 300 l&al
AATAATAGAATA~TGATCGAAAn;TGAGGTGCCATA~C~~~~CTTTACGT~GTCTT~~TC~~ . . . . . 350 400
.
Figure 2. Nucleotide sequence of the &AZ regulatory region. The 425 bp RsaI fragment overlaps the end of the sbp gene and the beginning of theftsA gene (translation start and stop codons are boxed). The 3 transcription start sites are shown by arrows and the corresponding promoter signals are underlined. The 2 positions where point mutations were introduced are indicated bv asterisks and the nature of the mutations is shown. Relevant restriction sites are overlined. This sequence is taken fro& Beall et al. (1988).
fragment. However, since no obvious transcription terminator appears to be present in the sbp-&A intergenic region some transcription readthrough originating from the upstream sbp region was expected to contribute to the expression of ftsAZ. Therefore, a transcriptional ZacZ fusion was created by homologous integration of a pJM783 derivative into the sbp coding sequence (at position 44 in Fig. 2) and its expression followed during growth and sporulation. A low level of transcription was found (about 20 b-galactosidase specific units during exponential growth), which slowly decreased after to (data not shown). Such a low level is negligible in regard to &AZ own expression. was The previous analysis of ftsA2 expression carried out by monitoring transcription of a ZacZ gene (carrying the spoVG translation initiation signals) fused to B. subtilis sequences at the 13th codon of &A. Since &s-acting signals present in the ftsA coding sequence could modulate expression of the distal ftsZ gene another 1acZ fusion was introduced at the amyE locus that allowed us to assess the pattern of transcription of f&Z. For this purpose a 2182 bp N&I-P&I fragment, which contains all the ftsA regulatory signals (the NdeI site overlaps the upstream border of the previous 425 bp RsaI fragment), the complete ftsA gene, and 148 codons of ft.&, was cloned upstream from la& in the pDG268 vector. This plasmid was propagated in a pcnB E. coli strain where the copy number of ColEl derivatives is reduced about tenfold (Lopilato et al., 1986). After introduction of this fusion at the amyE locus through a double recombination event we checked that the ftsA coding sequence present in the fusion had not been mutated in E. coli by its ability to complement in trans the spo2Y9’” mutation. fiGalactosidase synthesis was then measured in a wild-type strain (the presence of 2 copies of theftsA gene in that strain has no apparent effect on growth and sporulation) and found to follow a similar temporal pattern as that previously observed when
albeit at a slightly using the 425 bp RsaI fragment, reduced level (Fig. 3). This result indicates that the two genes of thefts operon are similarly regulated during development.
700
-
600 7. ‘2 5005 0 z ii 400:: i! 2 300Lu z 1 200Q IOO-
O-
I ‘-2
I f-l
I ‘0 Time
I ‘I
I ‘2
(h)
3. Expression pattern of ftsA- and ftsA.5lad transcriptional fusions integrated at the amyE locus. flGalactosidase activity was measured through growth and sporulation in DS medium as described in Materials and Methods. As sketched in the lower part of the Figure the ftsA-la& fusion contained the 425 bp RsaI fragment shown in Fig. 2 cloned upstream from lacZ (0) and the ftsAZ-la& fusion contained the 2182 bp NdeI-PstI fragment (see Fig. 1) cloned upstream from la& (a). ti indicates hours before and after the onset of sporulation.
Figure
Bacillus subtilis ftsAZ Operon
400
z‘S 5 0 .o L B ::
300
i 0 c::
200
4 8 & 100
0
I
‘-?.
I
‘- I
I
I
‘0 Time
‘I
I
tz
(h)
Figure 4. Expression of la& transcriptional fusions under the control of various subfragments of the ftsAZ regulatory region. All fusions were integrated at the amyE locus. /?-Galactosidase activity was measured through growth and sporulation in DS medium as described in Materials and Methods. As sketched in the upper part of the Figure the 425 bp RsaI fragment shown in Fig. 2 was split in 3 parts that were each fused to ZacZ: the upstream 242 bp RsaI-XmnI fragment ( l ), the downstream 183 bp XmnI-RsaI fragment (A) and a central fragment (from HinfI at position 180 to the engineered HpaI site at position 339) (0). ti indicates hours before and after the onset of sporulation.
(b) The ftsAZ operon is transcribed from three promoters An apparent &type promoter is present in the 425 bp RsaI fragment at positions 327 to 355 (TTGTAT-I7 bp-TAGAAT), 33 bp upstream from the ftsA initiation codon (Beall et al., 1988). This suggested that the original promoter-bearing fragment could be reduced and another ZacZ fusion was introduced at the amyE locus that contained only the downstream 183 bp Xmnl-RsaI fragment. This new fusion allows a much lower synthesis of Bgalactosidase (around 70 spec. act. units during exponential growth), which slowly decreases after to (Fig. 4). Although confirming the presence of a promoter in the XmnI-RsaI interval these results
971
suggested that either a second promoter or important &-acting signals had been lost while reducing the size of the original DNA fragment. Therefore, the remaining upstream 242 bp RsaI-XmnI fragment was also fused to ZacZ in the pDG268 vector and the resulting putative transcriptional fusion introduced at the amyE locus of the chromosome. As shown in Figure 4 synthesis of fl-galactosidase driven by this fusion was very similar to that previously observed with the downstream fragment, with a level of 60 to 100 specific activity units during vegetative growth and a slow decrease after t,. This result indicates the presence of a second promoter in the RsaI-XmnI interval but also suggests that some transcription signal has been destroyed when splitting the 425 bp RsaI fragment in two parts, since neither promoter shows the postexponential burst of expression found with the intact fragment (Fig. 3). A third subfragment that overlaps the XmnI site and extends from position 180 to position 339 (expected to be in the middle of the downstream promoter) was then cloned upstream from la& and the derivative construct introduced at the amyE locus. The resulting strain was found to be able also to synthesize P-galactosidase (about 120 spec. act. units during growth) with a three- to fourfold increase around to (Fig. 4). This result suggests that a third promoter is present in the 425 bp RsaI fragment, probably overlapping the XmnI site, and subjected to developmental control of its expression. The three promoters defined by the previous 1acZ fusions were then characterized at the nucleotide level by primer extension experiments. mRNA were prepared from strains harboring la& fusions in which only one of the three putative promoters was active and harvested at the time of maximal /?galactosidase synthesis. To avoid multiple signals generated by mRNA synthesized from both the ftsAZ locus and thefts-la& fusion integrated at the amyE locus the primer extension experiments were carried out with a set of two oligonucleotides matching the spoVG sequence located immediately upstream from la&. There is no contribution of the spoVG locus itself in these experiments since both oligonucleotides extend into the non-transcribed region of spoVG. Therefore, only the mRNA synthesized from the fts-1acZ fusion were visualized in these experiments. The results shown in Figure 5 confirm the presence of a promoter in each of the three subfragments derived from the original 425 bp RsaJ fragment and allow an unambiguous determination of the corresponding transcription signals. As predicted from the nucleotide sequence the promoter present in the downstream XmnI-RsaI fragment uses the TTGTAT-17 bp-TAGAAT signals located at positions 327 to 355. Therefore, this promoter (hereinafter called Pl) is not active in the central fragment (extending from position 180 to 339), which itself contains a second promoter allowing transcription initiation at positions 251252. No CA-type promoter is present in the immediate upstream vicinity but signals highly related to
G. Gr’onzy-Tre’boul et al.
972
vG+17 x517
vG+17 GATC
P3
P2
Pl CTAt CTAG
+
+ CTAG
VG-4
VG-4 +
3’5’ AT
I TA 3’5’
3’ 5’ GC I TG TA TA AT TA AT AT AT AT GC TA T A* A T* TA TA TA GC TA AT TA TA IT A 5’ 3’
IA * TA CG TA TA AT TA CG TA TA
TA AT C G* TA AT GC CC TA TA TA AT CG ‘A T 5’3’
CG TA GC AT AT CG AT TA AT AT A T” TA CG GC TA CG CG AT TA AT \ TA 5’3’
Figure 5. Mapping of the &AZ transcription start points. The Figure shows the result of primer extension analysis using the VG + 17 and VG -4 oligonucleotides (see Material and Methods) to prime cDKA synthesis from RNA extracted from strains harboring various la& transcriptional fusions int,egrat,ed at alr~yE. In the case of Pl RNA was extracted from a vegetatively growing sp00H strain in which ZacZ transcription was driven by the downstream 248 bp Hinff-RsaJ fragment (no extension product could be obtained with the VG -4 primer, presumably for reasons detailed in Material and Methods). In the case of P2 RNA was extracted at t, from a strain in which la.cZ t’ranscription was driven by the central 160 bp HinfT-HpaI fragment. In the case of P3 RNA was extracted from a vegetatively growing strain in which ZacZ transcription was driven by the upstream 242 bp RsaI-XmnI fragment. The extension products were run in parallel with sequencing ladders (GATE lanes) generated by the chain termination method using the same primers and singlestranded DNA templates containing an identical fts-spoPG-lacZ fusion (in the case of P2 the template used for sequencing contained thefts2 mutation but the wild-type complementary sequence is shown). The asterisks identify the transcription start sites and the heavy bars point to the corresponding - 10 signals.
o”-controlled promoters can be found at position 217 to 247 (AGAGGA-17 bp-GAATATTT) (Daniels et al., 1990; M. Predich, (3;. Nair & I. Smith, personal communication). The XmnI restriction site is located in the - 10 region of this promoter (hereinafter called P2) which is therefore inactive in the upstream &al-XmnI fragment. The latter fragment contains a third promoter associated to CA-type recognition sequences located from position 68 to position 96 (TTTTCT-17 bp-TAGACT). This promoter will hereinafter be called P3. (c) Both CT* and d’ control transcription ftsAZ operon
of the
Not only have the Pl and P3 promoters typical GA-type recognition sequences but they also show the usual temporal pattern of expression of a*-controlled genes (Donnelly & Sonenshein, 1982).
It could then be predicted that the Pl promoter would be severely impaired by increasing the distance between its - 10 and -35 regions. Two extra adenine nucleotides were introduced by oligonucleotide-directed mutagenesis between positions 339 and 340. This mutation (hereinafter calledftsl) completely inactivated Pl as measured from the expression of a la& fusion under the control of a DNA fragment in which all transcripts were initiated at Pl (data not shown). Thefts1 mutation also created a conveniently located HpaT site that was used in various subcloning experiments. sequence and the temporal The nucleotide pattern of expression of the P2 promoter are highly reminiscent of &controlled promoters (Carter et al., 1988; Jaacks et al., 1989; M. Predich, C. Nair & I. Smith, personal communication). Therefore, we examined the effect of a mutation in spoOH, the gene encoding oH, on transcription of the ft.sAZ
Bacillus
subtilis
f&AZ
Operon
973
(b)
t-p
1-l
‘0
PI
f-2
f2 Time
(h
f-l
t0
?I
‘2
h
1
Figure 6. Involvement of C” in transcription of the ftsA2 operon. Strains harboring various la& transcriptional fusions integrated at the amy locus were grown in DS medium, and fl-galactosidase activity was monitored through growth and sporulat’ion as described in Materials and Methods. (a) /?-Galactosidase synthesis was driven by the 425 bp &al fragment containing the 3ftsAZ promoters, either in a wild-type strain (0) or in a spoOHnull mutant (0). (b) ZucZ transcript,ion was under the control of the central 160 bp Hinfl-HpaI fragment containing only P2, and j-galactosidase activit,y was measured in a wild-type (0) and in a spoOH null mutant (0). Th e activity of a similar 1acZ fusion containing the,ftsZ mutation was also monitored in a wild-type strain (0). ti indicates hours before and after the onset of sporulation
operon. This was done with 1acZ fusions under the control of either the 425 bp RsaI fragment carrying Pl, P2 and P3, or the central fragment containing only P2. Global expression of the ftsAZ operon is significantly reduced during vegetative growth in a spoOfi null mutant and there is no post-exponential burst of transcription (Fig. 6(a)), while activity of the P2 promoter is completely abolished in this mutant (Fig. 6(b)). These results confirm that a” is involved in transcription of ftsAZ from the P2 promoter. As final evidence for a direct interaction of U” with
P2 we substituted
by oligonucleotide-
directed mutagenesis an adenine residue to the guanine present at position 240, which corresponds to a highly conserved residue in oH-controlled promoters (Zuber et al., 1989). Introduction of this mutation (hereinafter called fts2) completely inactivated the P2 promoter as measured from expression of a ZacZ fusion
under
the control
of a DNA
frag-
ment in which all transcripts were initiated at P2 (Fig. 6(b)). Therefore, transcription of the ftsAZ operon appears to be controlled both by aA (at the Pl and P3 promoters that are expressed mainly during exponential growth) and by CT”(at the P2 promoter which is active during growth and strongly turned on around to). Multiple 1acZ transcriptional fusions were constructed in which /I?-galactosidase synthesis was under the control of various combinations of PI, P2, P3, with or without the ftsl and/or fts2
mutations, in every instance adding up the only P2 being
a Spa+ or a spoOH background. the results were those expected
In from
respective activities of Pl, P2 and P3, dependent on the presence of a wildtype copy of spoOH (data not shown). In good accordance wibh the results shown in Figure 3 and 4 it appears that each of the two rr*-controlled promoters, Pl and P3, contributes to about 30% of the transcription of ftsAZ during exponential growth, but only to 10 to 15% at t, (1 h after the onset of sporulation). The #-controlled promoter, P2, contributes to about 40% offtsAZ transcription during vegetative growth, and to 75 to 80% at t,. (d) The SpoOA protein is required for the burst of transcription of the ftsAZ operon
post-exponential
Genetic evidence for a direct contact between (T” and one of its cognate promoters was provided by Zuber et al. (1989) who demonstrated allele-specific suppression of a mutation in the spoVG promoter by a mutation in spoOH, the gene encoding a”. The G to A transition in the GAAT motif at position - 10 of the spoVG promoter in strains carrying the spoVG249 allele is a severe down mutation that is partially suppressed by conversion of threonine to isoleucine at residue 100 in #. The latter mutation is present. in strains carrying the spoOH81 allele which itself creates a strong
sporulation
blockage
at
C. Conzy-Trdboul
974
600
500
;:+ .; 400 0 .o c ki 9 :: 4 2 L z0
300
200 SPOOA obrB
I Q 100
0
SPOOA
I ‘-2
I
I
I
I
f
‘-I
‘0
tl
‘2
‘3
Time(hl
Figure 7. Effect of spoOA and abrB mutations on transcription from P2. All strains contained a transcriptional la& fusion under the control of the P2 promoter (the central 160 bp NinfIHpaT fragment) integrated at
the amyE locus. P-Galactosidase activity was measured through growth and sporulation in DS medium as described in Materials and Methods. The relevant genotypes of the various strains are indicated. ti indicates hours before and after the onset of sporulation.
et al.
the abrH gene. The AbrK protein is a small DNAbinding protein (Perego et al., 1988) that, binds to the promoter regions of some growth-controlled genes and represses their expression (Furbass et al., 1991). SpoOA relieves this inhibition by preventing neosynthesis of AbrB molecules (Strauch rt al., 1990). In such a case (spoVG for instance) the requirement, for the SpoOA protein can be bypassed by a secondary mutation in abrR (Zuber & Losick, 1987). Therefore, transcription from the P2 promoter was measured in an abrH background and in an abrB spoOA double mutant. Results shown in Figure 7 indicate that, the abrB mutation restores at least 50 ‘y. of the post-exponential burst of fl-galactosidase synthesis that is missing in the spoOA background. The abrB mutation by itself does not alter the temporal pattern of expression of the P2 promoter, although it increases its global act,ivity throughout vegetative growth and sporulation. The involvement of SpoOA in transcription from the P2 promoter appears therefore to be at least partially due to the relief of t’he negative effect of AbrB. Whether AbrB acts only by repressing transcription of spoOH (Weir et al., 1991) or more directly by repressing also transcription from P2 is not clear. However, since the absence of SpoOA has still a significant effect on post-exponential P2 activity in the abrB background (see Fig. 7) it appears that the SpoOA protein might also be controlling transcription from the P2 promoter through an AbrB-independent mechanism. (e) Efficiency transcription
stage 0. Since the fts2 mutation is (and was actually designed to be) identical to the spoVG249 mutation we looked for similar suppression of this mutation by the spoOH81 mutation. A 1acZ fusion in which /Igalactosidase synthesis is under the control of the P2 promoter carrying the fts2 mutation was introduced in a JH642 derivative strain containing the spoOH81 allele. No detectable restoration of transcription from the P2 promoter could be observed (data not shown), indicating that the mutated aH is not able to recognize the mutated P2 sequence. This negative result suggested that some other factor normally required for transcription from P2 was absent in the spoOH81 strain where the whole aHcontrolled regulon is turned off. A likely candidate is the sp00A product, a highly pleiotropic regulatory protein, whose synthesis is partially controlled by aH (Yamashita et al., 1986; M. Predich, G. Nair & I. Smith, personal communication). Therefore, we measured the effect of a spo0A null mutation on expression of a PB-la& transcriptional fusion (without the fts2 mutation). As shown in Figure 7 disruption of the spoOA gene slightly reduces transcription from the P2 promoter during vegetative growth and abolishes the postexponential burst of /3-galactosidase synthesis. Many of the effects of SpoOA in early stationary growth phase are mediated through repression of
of sporulation depends on thr level of the ftsAZ operon
To ascertain the physiological role of the three promoters of the ftsA2 operon we constructed various strains in which transcription of ftsAZ was controlled by only some of these promoters. The technical approach followed in these experiments is described in the legend to Figure 8. For example the 425 bp RsaI fragment containing Pl, P2 and P3, with both ftsl and fts2 mutations, was cloned upstream from la& in pJM783, a plasmid unable to replicate in B. subtilis. Selection for the chloramphenicol resistance marker carried by the plasmid led to the recovery of transformants that arose by a single homologous recombination event taking place within the B. subtilis fragment carried by the plasmid. Depending on the exact location of the crossover several types of transformants were expected, in which the ftsAZ operon would be controlled by one, two or three promoters, while the 1acZ gene would end up under the control of the reciprocal combination of active promoters. Similar experiments were carried out with DNA fragments containing only one of the ftsl/fts2 mutations in order to get the other possible arrangements of active promoters upstream from the ftsAZ operon. In each case various classes of transformants could be recognized on DS agar plates, either from their level of B-galactosidase synthesis (indicated by the intensity of their blue color in the presence of 5.
Bacillus subtilis ftsAZ Operon
P3
p2
PI
CI Figure 8. Introduction of &s-acting mutations upstream from t,he &AZ operon. A derivative of the pJM783 plasmid was constructed in which 2ac.Z was under the control of the 425 bp RsaI fragment containing the 3 promoters of ftsAZ. In this example the RsaI fragment contained both j&l and fts2 mutations. The chromosomal j!sAZ regulatory region is shown with serrated edges. Since pJM783 does not replicate in B. subtilis but contains a cat marker, selection for chloramphenicol resistance led of transformants that arose by single homoto obtention logous recombination of the circular plasmid into the ftsAZ regulatory region. In each case the fragment bordered by the diamonds becomes duplicated and brackets the pJM783 backbone. Depending on the exact location of the crossover (A, R or C) different types of transformants are expected where the @A%: operon is controlled by various combinations of the Pl, P2 and P3 promoters. The complementary combination is found upstream from the ZacZ gene.
975
bromo-4-chloro-3-indolyl-b-D-galactopyranoside) or from their growth characteristics (presence of filaments during exponential growth and sporulation efficiency). Due to the small size of the segments in which recombination had to take place to generate some of these classes their relative proportions were only roughly in accordance with what was theoretically predicted. However, there was always an inverse correlation between the apparent amount. of P-galactosidase synthesis and the ability to sporulate (Table 1). In the case of the three classes of transformants issued from the experiment described in Figure 8 fl-galactosidase synthesis was monitored in liquid medium throughout growth and sporulation in a few clones that had been selected from their aspect on plates. The patterns of b-galactosidase synthesis were exactly as expected from the specific combination of promoters supposed to be present upstream from la&, which was subsequently confirmed by Southern blot analysis (taking advantage from the fact that the f.sl mutation creates an HpaI site, while thefts.2 mutation eliminates an XmnI site; data not shown). Results of these experiments are summarized in Table 1. When only two promoters were present. upstream from the &AZ operon the transformants were found to grow almost normally on plates (no filamentation but some apparent growth delay) and to sporulate with a slightly decreased efficiency. Haci’eria still sporulated at about 800/b of the wild type level when Pl was not present upstream from @AZ, and to about 30% when either P2 or P3 was absent. The situation was quite different when two promoters were missing upstream from ,@242. lt was dificult to obtain transformants where &AZ transcription was controlled only by I’1 or P.Z. These clones were extremely filamentous and highly unstable as judged by their sporulation phenotype on US agar plates (especially after growth in liquid medium). Presumably a too low level of transcription off&42 is detrimental to the cells, which leads to the progressive enrichment in bacteria where the plasmid integrated upstream from JsAZ has “popped out” of the chromosome and integrated
Table 1 Growth and sporulation characteristics of strains with various levels of ftsAZ transcription Promoters present in the cloned DNA fragment?
PlfLsl + P2 PI& I + P2 + P3 P l&s1 + P2&2 f P3
tStrains
were constructed
Promoters present upstream from &AZ after integration
Promoters present upstream from lucZ after integration
I’1 + P2 P2 P1+P2 P2+P3 Pl+P2+P3 P3 Pl +P3 Pl+P2+P3 by transformation
described for Fig. 8. fDoubling time was JO”/; increazwd
Pl +P2+P3 Pl i-P3
Filaments, unstable
Pl+P2+P3 P2+P3 Pl +PZ+PS P2+P3 Pl +P2+P3 P2+P3 P3
Filaments,
with pJM783 derivative
and the A,,,
Significant vegetative growth characteristics
Heat-resistant spores/ml 2 x 105-2 x lo7 2.3 x 10s 7 x 104--7 x 10’
unstable
I.8 x 108 lo8
Filaments,
plasmids containing
at the end of exponential
growth
53 x 68 x 7.2 x 1*9x 6.3 x
slow growth$
part
was reduced
of the &4Z from
3 to 2.
regulatory
IO* 106 10s 10’ region
as
G. Gonzy-TrCboul et al.
976
back in another configuration (Fig. 8) allowing &AZ to be transcribed at a higher level. Conversely, transformants were readily obtained where only P3 was present upstream from @AZ. These clones were also highly filamentous, grew at a slower rate and reached a lower maximal density in liquid media than wild-type cells, but appear to be stable. They sporulated to about 1 to 2% of the wild-type level (Table 1). Similar experiments were carried out with another integrative plasmid constructed in our laboratory, which does not carry 1acZ and in which the erm gene of pE194 replaces the cat gene present in pJM783. In that case no transformants could be obtained that would carry only one promoter upstream from ftsAZ, while the phenotypes of the transformants with a combination of only two promoters upstream from ftsAZ were similar to those observed with the pJM783 derivatives. In particular cells sporulated in the absence of P2 with 30”/, efficiency as compared to cells carrying the three promoters upstream from ftsAZ (data not shown). The impossibility to obtain some classes of transformants with this kind of plasmid suggests t’hat in the transformants issued from the pJM783 derivatives some transcription proceeds from the integrated vector sequences and contributes to ftsAZ expression. This basal level could play a critical role in cell survival when only one promoter is present upstream from ftsAZ. 4. Discussion (a) Three promoters and two sigma factors control ftsAZ transcription
Results obtained with 1acZ fusions indicate that the adjacent ftsA and ftsZ genes of B. subtilis follow similar patterns of transcription during growth and sporulation (Fig. 3), which is in good accordance with the previous suggestion that they form an operon (Real1 et al., 1988). Moreover, since the downstream ftsZ gene appears to be expressed at a slightly lower level than ftsA it is unlikely that any additional promoter is present within the ftsA coding sequence that contributes specifically to ftsZ transcription, at least under our growth conditions. This is in sharp contrast with the situation in E. coli where several promoters for ftsZ are present in the upstream ftsA coding sequence (Robinson et al., 1984).
All the regulatory signals that control transcription of the B. subtilis ftsAZ operon are present in a 425 bp RsaI fragment as deduced from monitoring expression of transcriptional ZacZ fusions integrated either at the heterologous amyE locus or at t’he ftsAZ locus itself. Subcloning experiments have shown that this fragment contains three promoters (Fig. 4) that were mapped by primer extension (Fig. 5). Two of these promoters, Pl and P3, are recognized by aA-associated RNA polymerase, as suggested by their nucleotide sequence and by their kinetics of expression during the life cycle of B. subtilis, since oA activity is known to be inhibited
shortly after the onset of sporulation (Tjian & Losick, 1974) and genes exclusively controlled by gA are consequently shut off (Donnelly & Sonenshein, 1982). Interestingly the most upstream promoter. P3, is embedded in the adjacent coding sequence, a feature reminiscent of the situation found in the fts&AZ operon of E. coli (Yi et al., 1985). The third ftsAZ promoter, P2, is recognized by C” as deduced from its nucleotide sequence, its absolute dependence on the spoOH product and its inactivation by the fts2 mutation that modifies a nucleotide highly conserved in &controlled promoters (Fig. 6). Transcription from this promoter increases sharply around the onset of sporulation, similarly to what has been described for the spoVG promoter (Zuber & Losick, 1983), although to a less extent (3 to 4 fold as compared to 10 to 12 fold). This enhancement of transcription from the P2 promoter, which presumably reflects the increased synthesis and activity of C” (Weir et al., 1991; Healy et al., 1991) compensates for the decrease of transcription from the two oA-controlled promoters, Pl and P3, and leads ultimately to a doubling in expression of the @AZ operon. This result has been independently obtained by A. Gholamhoseinian, Z. Shen and P. Piggot (personal communication). proteins modulate the level of transcription of the ftsAZ operon
(b) Auxiliary
At first sight no specific regulation appears to operate at the level of the &controlled promoters, Pl and P3, since their kinetics of expression follow a typical oA-dependent temporal pattern (Donnelly & Sonenshein, 1982). However, preliminary experiments in which Pl activity was monitored from a 145 bp SspI-RsaI fragment containing only 79 bp upstream from the Pl transcription start showed a 60% decrease in p-galactosidase synthesis as compared to the 183 bp XmnI-RsaI fragment containing 117 bp upstream from the Pl transcription start (data not shown). This result suggests that the region located upstream from the &recognized promoter sequences is required for full activity of Pl. This could be due to some intrinsic feature of this DNA region (for instance a local bending created by successive runs of A residues) or to the binding of an activatory protein. In the latter case transcription from Pl could be modulated by the availability and/or the activity of this putative regulatory factor. Conversely, there is clear evidence that transcription from P2 is controlled by at least two regulatory proteins, AbrB and SpoOA (Fig. 7). This is expected from a &controlled promoter, since aH synthesis is repressed by AbrB during exponential growth (Weir et al., 1991) and enhanced at the onset of sporulation by the antagonistic effect of SpoOA on abrB transcription (Strauch et al., 1990). This regulatory network can also act additionally on the a”-controlled promoter itself (Furbass et al., 1991). Such a cascade of negative interactions explains
Bacillus subtilis ftsAZ Operon why the requirement for SpoOA in post-t,, transcription of spoVG is fully suppressed by a secondary mutation in ah-B (Zuber & Losick, 1967). However, this is not the case for the P2 promoter of theftsA operon, since an abrB mutation restores only partially the post-t, enhancement of P2 activity that is lost in a sp00A background (Fig. 7). Therefore, it is possible that the spoOA product acts also more directly on P2 activity after t,. An unexpected complication came from our attempts to suppress (at least partially) the j&2 mutation by the spoOH81 allele. It has been shown that an identical mutation in the spoVG promoter, which completely inactivates this promoter in a spoOH+ background, allows about 30% of the wildtype level of spoVG transcription in the presence of the spoOH81 allele (Zuber et al., 1989), and we confirmed this result with the spoOH81 strain that was used throughout our own experiments (data not shown). No transcription could be detected from the P2 promoter containing the fts2 mutation in a spoOH81 strain, even in an abrB background where P2 activity is enhanced about twofold (data not shown). This result suggests that some auxiliary factor, absolutely required for P2 transcription, is missing in the spoOH81 strain. This factor cannot be the SpoOA protein, which depends on cH both for its synthesis (Yamashita et al., 1986; M. Predich, G. Nair & I. Smith, personal communication) and its activation by phosphorylation (Burbulys et al., 1991), since even the vegetative level of P2 transcription that does not depend on SpoOA is completely abolished in a fts2 spoOH81 abrB strain (data not shown). This apparent dependency of the P2 promoter on an auxiliary protein might explain a preliminary result in which no P2 activity was found in a DNA fragment extending from position 218 to 389 (data not shown). Either the A nucleotide at position 217 (replaced by a C in our experiment) plays a critical role in P2 activity, although this is not a highly conserved position in other a”-recognized promoters (M. Predich, G. Nair & I. Smith, personal communication), or the adjacent upstream region (from position 180 to 217) is absolutely required for transcription initiation by OH-associated RNA polymerase. This region could be the binding site for the auxiliary factor postulated above (whose synthesis and/or activity would depend on aH) but it could also play a role in the local conformation of DNA. In this regard it is striking that this region is extremely A +T-rich (87%), with long runs of A residues, a feature also found in the upstream “enhancer” region of the spoVG promoter (Zuber & Losick, 1987). (c) Why three promoters?
Experiments in which the promoter region of the ftsAZ operon was modified by integration of plasmids containing various mutations (schematized in Fig. 8 and summarized in Table 1) have shown that none of the three promoters of @AZ can provide enough transcription for viability. The residual
977
growth observed with pJM783 derivatives (but not with other plasmids) could be due to an additional basal level of transcription originating from the plasmid sequences. Since P2 is stronger than P3 (Fig. 4) it is surprising that no stable transformant could be obtained where transcription of &AZ would be driven by P2 alone (after integration of a pJM783 derivative plasmid) while slow growing clones were obtained in which ftsAZ transcription depended only on P3 (Table 1). Presumably, the activity of a” and/or auxiliary factors is too weak at very low cell density to ensure enough induction of P2 in the transformed clones. Conversely, the presence of any combination of two promoters upstream from &-AZ leads to viable clones, indicating that transcription originating from two promoters allows sufficient synthesis of FtsA and FtsZ for normal growth. However, the efficiency of sporulation is decreased, roughly in proportion with the level of ftsAZ transcription. Such a correlation between the amount of FtsA and FtsZ molecules and the sporulation rate is expected since the first step of sporulation is an asymmetric septation that depends both on ftsA (as shown by the phenotype created by the spo279’” mutation which affects ftsA (Young, 1976; C. KarmazynCampelli, L. Fluss, T. Leighton & P. Stragier, unpublished results) and on ft.& (Beall & Lutkenhaus, 1991). It is striking that inactivation of P2 still allows about 30% of sporulation. It could have been imagined that the burst of transcription of ftsAZ at the onset of sporulation, which depends on the two major developmental products a” and SpoOA, was an absolute prerequisite for asymmetric septation to occur and sporulation to proceed. This is not the case, at least under our laboratory conditions. It was speculated that asymmetric septation was a direct consequence of enhanced transcription of the ftsA2 operon because of the apparent similarity between a stage II sporulating cell and the minicell phenotype created by overproducing FtsZ in E. coli (Stragier, 1989). Our results rule out this hypothesis since at least 30% of the B. subtilis cells are still able to build their asymmetric septum without a previous increase in ftsAZ transcription (the exact morphological stage of blockage in the remaining 70% cells was not determined). What then could be the physiological role of the P2 promoter? In B. subtilis septation is not as tightly linked to DNA replication as it is in E. coli and long filaments are always present during vegetative growth. At the end of exponential growth these filaments are fragmented into individual cells that will eventually sporulate. Therefore, a sudden increase in septation capacity is required to make up for delayed septa and it is provided by the P2 promoter and the #/SpoOA(AbrB) machinery. Besides their specific requirement for sporulation these regulatory molecules play a major role in the transition from exponential growth to stationary phase, an event which might be quite frequent in the natural soil habitat of B. subtilis, even when sporulation will not occur.
(i. Gonxy-Trdhoul
97x
It is possible that individual cells are more easily and efficiently disseminated than long filaments, which will give them a selective advantage under starvation conditions. According to this point of view the o”-controlled P2 promoter should not be considered as specifically used for asymmetric as a device for septation but, more generally, creating unicellular organisms in stationary phase conditions. The two &controlled promoters would ensure a basal level of synthesis of FtsA and FtsZ in active growth conditions, the presence of two separate promoters allowing a finer tuning of @AZ transcription through the eventual action of auxiliary regulatory proteins on Pl and/or P3. The FtsZ protein appears to self-assemble into a ring structure that dictates the septation site in E’. coli (Bi & Lutkenhaus, 1991). Because of this structural role it is likely that the amount of FtsZ molecules must reach a critical point for R. subtilis cells to be able to start asymmetric septation once all the delayed vegetative septa have been completed. However, the choice of the location of the septum must involve more specialized gene products whose synthesis is tightly regulated. Aberrant activity of these products could lead to a pseudo-minicell phenotype. Such mutations have been described (Van Alstyne & Simon, 1971; Reeve et aZ., 1973) and they might define the real master loci for asymmetric septum formation. We thank Patrick Piggot for sharing his results with us before publication, Anne-Marie G&rout-Fleury for constructing the spoOA::kan strain, and David Popham, Alan Grossman and Dave Daniels for stimulating discussions. This work was supported by a grant from CNRS (URA 1139) and INSERM (Contrat de Recherche Externe 881016.
et al.
Bradford, M. M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of prot,ein-dye binding. Anal. Biochem.
Acad. Ski.,
References
U.S.A.
80, 3963-3965.
U.S.A.
88, 9934-9938.
Furbass, R.. Gocht, M., Zuber, P. & Marahiel, M. (1991). Interaction of abrB, a transcriptional regulator from Bacillus subtilis with the promoters of the transition state-activated genes tycA and spoVG. Mol. Gen. Genet. 225, 347-354.
Healy, J.. Weir, J., Smith, I. & Losick, R. (1991). Posttranscriptional control of a sporulation regulatory gene encoding transcription factor on in Bacillus subtilis.
Aldea, M., Garrido, T., Pla, J. & Vicente, M. (1990). Division genes in Escherichia coli are expressed coordinately to cell septum requirements by gearbox promoters. EMBO J. 9, 3787-3794. Anagnostopoulos, C. & Spizizen, J. (1961). Requirements for transformation in Bacillus subtilis. J. Bacterial. 81, 74-76. Antoniewski, C., Savelli, B. & Stragier, P. (1990). The spoZZJ gene, which regulates early developmental steps in Bacillus subtilis, belongs to a class of environmentally responsive genes. J. Bacterial. 172, 86-93. Beall, B. & Lutkenhaus, J. (1991). FtsZ in Bacillus subtilis is required for vegetative septation and for asymmetric septation during sporulation. Genes Develop. 5, 447455. Beall, B., Lowe, M. & Lutkenhaus, J. (1988). Cloning and characterization of Bacillus subtilis homologs of Escherichia coli cell division genes ftsZ and ftsA. J. Bacterial. 170, 485S4864. Bi, E. & Lutkenhaus, J. (1991). FtsZ ring structure associated with division in Escherichia eoli. Nature (London), 354, 161-164. Biggin, M. D., Gibson, T. J. & Hong, G. F. (1983). Buffer gradient gels and 35S label as an aid to rapid DNA sequence determination. Proc. Nat. Acad. Sci.,
72, 248-254.
Burbulys, I).. Trach, K. A. & Hoch, J. A. (1991). lnitiat,ion of sporulation in Bacillus subtilis is controlled by a multicomponent phosphorelay. Cell, 64, 545.-5.52. Carter, H. L., ITT, Wang, L. F., Doi, R. H. &. Moran, C. P., Jr (1988). rpoD operon promoter used by &RNA polymerase in Bacillus subtilis. .I. Bactwiol. 170, 1617-1621. Chambers, 8. P., Prior, S. E., Karstow, D. A. CL:Minton. N. P. (1988). The pMTL nit- cloning vectors. I. Improved pUC polylinker regions to facilitate the use of sonicated DNA for nucleotide sequencing. Gene, 68, 139-149. Daniels, D., Zuber, P. & Losick, R. (1990). Two amino acids in an RNA polymerase c factor involved in the recognition of adjacent base pairs in the - 10 region of a cognate promoter. Proc. Nat. Acad. Sci.. 1T.S.A. 87, 8075-8079. de Boer, P. A. ,J., Cook, W. R. & Rothfield, L. 1. (1990). Bacterial cell division. Annu. Rev. Genet. 24, 249--274. Donnelly, C. E. & Sonenshein, A. L. (1982). Genetic fusion of E. coli lac genes to a B. subtilis promoter. In Molecular Clonilzg and Gene Regulation in Bacilli (Ganesan. A. T., Hoch, J. A. & Chang. S., eds), pp. 63-72, Academic Press, New York. Driks, A. K: Losick, R. (1991). Compartmentalized expression of a gene under the control of sporulation transcription factor oE in Bacillus subtilis. Proc. Nat.
Mol.
Microbial.
5, 477488.
Heusterspreute, M., Ha Thi, V., Emery, S.. Tournis-Gamble, S., Kennedy, N. & Davison, J. (1985). Vectors with restriction site banks. IV. pJRD184, a 3793 bp plasmid vector having 43 unique cloning sites. Gene, 39, 299-304. Jaacks, K. ,J., Healy, ,J., Losick, R. & Grossman, A. 1). (1989). Identification and characterization of genes controlled by the sporulation regulatory gene spoOH in Bacillus subtilis. J. Bacterial. 171, 4121-4129. Jacob, S., Allmansberger, R., Ggrtner, D. & Hillen, W. (1991). Catabolite repression of the operon for xylose utilisation from Bacillus subtilis W23 is mediated at the level of transcription and depends on a cis site in the xylA reading frame. Mol. Ben. Genet. 229. 189-196. Kunkel, T. A., Roberts, J. D. & Zakour, R. A. (1987). Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods Enzymol. 154, 367-382. Lopilato. J.. Bortner, S. & Beckwith, J. (1986). Mutations in a new chromosomal gene of Escherichia coli K-12, pcnB. reduce plasmid copy number of pBR322 and its derivatives. Mol. Gen. Genet. 205, 285-290. Losick, R. C Stragier, P. (1992). Crisscross regulation of cell-type specific gene expression during development in Bacillus subtilis. Nature (London), 355, 601-604. Lutkenhaus, J. F., Wolf-Watz, H. & Donachie, W. D. (1980). Organization of genes in theftsA-envA region
Bacillus subtilis ftsAZ of the Escbrichia coli genetic map and identification of a new fts locus (f&Z). J. Bacterial. 142, 615-620. Margolis, P., Driks, A. & Losick, R. (1991). Establishment of cell type by compartmentalized activation of a transcription factor. Science, 254, 562565. Miller, J. (1972). Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Moran, C. P., Jr (1990). Measuring gene expression in Bacillus. In Molecular Biological Methods for Bacillus (Harwood, C. R. 6 Cutting, S., eds), pp. 268271, John Wiley & Sons, Chichester, England. Perego, M., Spiegelman, G. B. & Hoch, J. A. (1988). St,ructure of the gene for the transition state regulator abrB : regulator synthesis is controlled by the spoOA sporulation gene in Bacillus subtilis. Mo2. Microbial. 2, 689699. Perkins, J. B. $ Youngman, P. J. (1986). Construction of Tn9171ac, a transposon derivative that mediates transcriptional gene fusions in Bacillus subtilis. Proc. Nat. Acad. Sci., U.S.A. 83, 14&144. Pla, J., Dopazo, A. & Vicente, M. (1990). The native form of FtsA, a septal protein of Escherichia coli, is located in the cytoplasmic membrane. J. Bacterial. 172, 5097-5102. Reeve, J. N., Mendelson, N. H., Coyne, S., Hallock, L. L. & Cole, R. M. (1973). Minicells of Bacillus subtilis. J. Bacterial. 114, 860-873. Robin, A., Joseleau-Petit. D. & D’Ari, R. (1990). Transcription of the ftsZ gene and cell division in Escherichia coli. J. Bacterial. 172, 1392-1399. Robinson, A. C., Kenan, D. J., Hatfull, G. F., Sullivan, N. F., Spielgelberg, R. & Donachie, W. D. (1984). DNA sequence and transcriptional organization of essential cell division genes ftsQ and ftsA of Escherichia co&: evidence for overlapping transcriptional units. J. Bacterial. 160, 546555. Robinson, A. C., Kenan, D. J., Sweeney, J. & Donachie, W. D. (1986). Further evidence for overlapping transcriptional units in an Escherichia coli cell envelopecell division gene cluster: DNA sequence and transcriptional organization of the ddl-ftsQ region. J. Bacterial. 167, 80!%817. Robinson, A. C., Begg, K.
