Dextromethorphan inhibits osteoclast differentiation ...

Osteoporos Int DOI 10.1007/s00198-013-2279-8

ORIGINAL ARTICLE

Dextromethorphan inhibits osteoclast differentiation by suppressing RANKL-induced nuclear factor-κB activation Karl Wu & Tzu-Hung Lin & Houng-Chi Liou & Dai-Hua Lu & Yi-Ru Chen & Wen-Mei Fu & Rong-Sen Yang

Received: 7 June 2012 / Accepted: 21 January 2013 # International Osteoporosis Foundation and National Osteoporosis Foundation 2013

Abstract Summary Dextromethorphan (DXM), a commonly used antitussive, is a dextrorotatory morphinan. Here, we report that DXM inhibits the receptor activator of nuclear factor kappa B ligand (RANKL)-induced osteoclastogenesis and bone resorption by abrogating the activation of NF-κB signalling in vitro. Oral administration of DXM ameliorates ovariectomy (OVX)-induced osteoporosis in vivo. Introduction DXM was reported to possess anti-inflammatory properties through inhibition of the release of proinflammatory factors. However, the potential role and action mechanism of DXM on osteoclasts and osteoblasts remain unclear. In this study, in vitro and in vivo studies were performed to investigate the potential effects of DXM on osteoclastogenesis and OVX-induced bone loss. Methods Osteoclastogenesis was examined by the TRAP staining, pit resorption, TNF-α release, and CCR2 and

CALCR gene expression. Osteoblast differentiation was analyzed by calcium deposition. Osteogenic and adipogenic genes were measured by real-time PCR. Signaling pathways were explored using Western blot. ICR mice were used in an OVX-induced osteoporosis model. Tibiae were measured by µCT and serum markers were examined with ELISA kits. Results DXM inhibited RANKL-induced osteoclastogenesis. DXM mainly inhibited osteoclastogenesis via abrogation of IKK-IκBα-NF-κB pathways. However, a higher dosage of DXM antagonized the differentiation of osteoblasts via the inhibition of osteogenic signals and increase of adipogenic signals. Oral administration of DXM (20 mg/kg/day) partially reduced trabecular bone loss in ovariectomized mice. Conclusion DXM inhibits osteoclast differentiation and activity by affecting NF-κB signaling. Therefore, DXM at suitable doses may have new therapeutic applications for the treatment of diseases associated with excessive osteoclastic activity.

Karl Wu and Tzu-Hung Lin have equally contributed to this study

Keywords Dextromethorphan . NF-κB . Osteoblast . Osteocalcin . Osteoclast

Electronic supplementary material The online version of this article (doi:10.1007/s00198-013-2279-8) contains supplementary material, which is available to authorized users. K. Wu Department of Orthopedics, Far Eastern Memorial Hospital, No. 21, Sec. 2, Nanya S. Rd., New Taipei City 220, Taiwan, Republic of China T.-H. Lin : H.-C. Liou : D.-H. Lu : Y.-R. Chen : W.-M. Fu (*) Department of Pharmacology, College of Medicine, National Taiwan University, No. 1 Sec. 1, Jen-Ai Rd., Taipei 100, Taiwan, Republic of China e-mail: [email protected] R.-S. Yang (*) Department of Orthopedics, College of Medicine, College of Medicine, National Taiwan University Hospital, No. 7, Zhong-Shang South Road, Taipei 100, Taiwan, Republic of China e-mail: [email protected]

Introduction Bone is a dynamic tissue and the homeostasis of bone depends on a continuously balanced remodeling process carried out by two distinct cell types: bone-forming osteoblasts and bone-resorbing osteoclasts [1, 2]. Osteoblasts derived from mesenchymal stem cells are responsible for bone matrix formation as well as bone mineralization [2]. On the other hand, osteoclasts derived from hematopoietic stem cells are multinucleated cells and are responsible for bone resorption [2]. Both types of cells are regulated by circulating hormones, mechanical stress, and inflammatory mediators. Any imbalance between bone formation by osteoblasts and bone resorption by osteoclasts causes

Osteoporos Int

disturbances of bone metabolism, including osteopetrosis, osteosclerosis, and osteoporosis. Differentiation of osteoclasts is regulated by interactions between multiple molecules within the bone microenvironment provided by osteoblasts and stromal cells [2]. Inflammatory cytokines and mediators such as interleukin-1 and tumor necrosis factor-α (TNF-α) are involved in bone loss or cartilage degradation by stimulating bone-resorbing osteoclasts [3–5]. Among them, RANKL (receptor for activation of nuclear factor kappa B ligand) plays a critical role in osteoclastogenesis [2, 6]. RANKL is a membrane protein of TNF family. It activates osteoclasts and is proposed to regulate osteoclast differentiation from precursor cells through the nuclear factor kappa B (NF-κB) signalling pathway [2, 7]. Osteoclasts can respond to inflammatory mediators, and excess activation of osteoclasts is involved in many diseases. Osteoclast-mediated bone resorption is a major phenomenon in chronic inflammatory diseases such as arthritis and periodontitis. Moreover, osteoclast-mediated bone resorption plays a pivotal role in bone metastasis of cancer including breast, prostate, colorectal, and lung cancer [8]. Dextromethorphan (DXM) is the d-isomer of the codeine analogue levophanol, a dextrorotatory morphinan. DXM is widely used clinically as a nonopioid cough suppressant in cold and cough medication and has a high safety profile [9]. DXM is also reported to exert anti-inflammatory effects in neuronal and cardiovascular systems [10–12]. These reports indicate that DXM is able to inhibit the release of proinflammatory factors from activated microglia or macrophages in brain and in aortic sinus. In addition, DXM exerts potent liver protection in lipopolysaccharide-induced endotoxemia via its anti-inflammatory effect [13]. DXM may thus be a potential anti-inflammatory agent. However, the effect of DXM on bone metabolism is still unclear. In this study, we examined the effects of DXM on the differentiation of osteoclasts. It was found that DXM inhibited osteoclastogenesis via the inhibition of NF-κB signaling. DXM at high concentrations also down-regulated the differentiation of osteoblasts and markedly decreased the gene expression of osteocalcin. Furthermore, it was found that oral administration of DXM (20 mg/kg/day) decreased ovariectomy-induced trabecular bone loss in mice.

Materials and methods Animals All protocols complied with institutional guidelines and were approved by Animal Care Committees of Medical College, National Taiwan University (IACUC no. 20090120). Threemonth old female CD-1/ICR mice (27–33 g) were purchased

from Laboratory Animal Center of Medical College, National Taiwan University. Materials Recombinant mouse RANKL (462-TEC: amino acids 158– 317 expressed in Escherichia coli) and mouse M-CSF were purchased from R&D system (Minneapolis, MN, USA). Fetal bovine serum was from Biological Industries (Kibbutz Beit Haemek, Israel), TNF-α ELISA kit and BioCoat OsteologicTM slides were from BD Bioscience (San Jose, CA, USA). Rabbit polyclonal antibody for Akt, ERK2, IKKα/β, IκBα, NF-κB p50, or NF-κB p65, mouse monoclonal antibody for phospho-ERK or α-tubulin, and goat anti-mouse or anti-rabbit secondary antibody conjugated with horseradish peroxidase were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Rabbit polyclonal antibody for P38 was from Genetex (Irvine, CA, USA). Mouse monoclonal antibody for phospho-IκBα or phospho-P38 and rabbit monoclonal antibody for phospho-IKKα/β or phospho-Akt were purchased from Cell Signaling Technology (Danvers, MA, USA). Mouse monoclonal antibody for actin was purchased from Merck-Millipore (Bedford, MA, USA). The α-MEM and antibiotics were obtained from Gibco Invitrogen (Carlsbad, CA, USA) and DMEM was from HyClone (Ontario, Canada). A murine monocytic cell line, RAW264.7, was obtained from American Type Culture Collection (Manassas, VA). 3-(4,5-Dimethyl thiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT), β-glycerophosphate, L-ascorbic acid, cetylpyridinium chloride, collagenase, dextromethorphan hydrobromide (DXM), p-nitrophenol phosphate disodium, and tartrate-resistant acid phosphatase (TRAP) staining kit were purchased from Sigma-Aldrich (St. Louis, MO, USA), Trizol and primers were purchased from MDBio (Taipei, Taiwan). Primary culture of osteoclasts derived from bone marrow macrophages Primary osteoclasts were derived from bone marrow macrophages in femurs of 8–12-week-old (300–400 g) male Sprague-Dawley rats [14]. Bone marrow cells were harvested by flushing the bone marrow cavity with α-MEM. Cells were cultured in α-MEM supplemented with 10 % heat-inactivated fetal bovine serum (FBS), 100 U/ml penicillin, and 100 μg/ml streptomycin (pH adjusted to 7.6). After 24-h incubation, the non-adherent cells (primary bone marrow macrophages) were collected. Cells were plated at a density of 106 per well (0.5 ml) with recombinant-soluble RANKL (5 ng/ml) and M-CSF (20 ng/ml) at 37 °C in 5 % CO2 in humidified air. After 6 days’ culture, the cells were washed with PBS twice and then fixed with 4 % paraformaldehyde for 2 min. Cells were stained with a TRAP staining kit at 37 °C for 1 h in the

Osteoporos Int

dark. Cells were then washed with distilled water and air dried for photography and counting. TRAP-positive cells with more than three nuclei were defined as osteoclasts. Primary osteoblast cultures Primary osteoblastic cells were obtained from the calvaria of 1-day-old Sprague-Dawley rats [15]. In brief, the calvaria of fetal rats were dissected with aseptic technique and the soft tissue removed under dissecting microscope. The calvaria were then divided into small pieces and treated with collagenase solution (1 mg/ml) for 20–30 min at 37 °C. The next two 20-min sequential collagenase digestions were then pooled and filtered through 70-μm nylon filters (Falcon, BD Biosciences, San Jose, CA, USA). The cells were grown on plastic cell culture dishes in 95 % air–5 % CO2 with αMEM, which was supplemented with 10 % heat-inactivated FBS, 100 U/ml penicillin, and 100 μg/ml streptomycin (pH adjusted to 7.6). The cell medium was changed every 3 days. The characteristics of osteoblasts were confirmed by morphology and the expression of alkaline phosphatase (ALP). Osteoclastogenesis derived from RAW264.7 RAW264.7 was cultured in α-MEM supplemented with 10 % FBS, 2 mM L-glutamine, 100 U/ml penicillin, and 100 μg/ml streptomycin at 37 °C in 5 % CO2 in humidified air. RAW264.7 cells were plated at a density of 2,000 per well in a 48-well culture dish in the presence of 10 ng/ml RANKL. RANKL was used in the following RAW264.7 cell model. Different concentrations of DXM were added to the cultures to assess its effect on osteoclastogenesis 24 h later. After a 3-day culture, cells were fixed and stained for TRAP using a TRAP staining kit according to the manufacturer’s instructions. Osteoclast-like TRAP-positive cells in each well were scored by counting the number of TRAPpositive multinucleated cells containing three or more nuclei. For mRNA analysis, RAW264.7 cells were seeded onto six-well plates. After reaching 70 % confluence, the cells were incubated in the presence of 10 ng/ml RANKL and different concentrations of DXM. Total mRNA was extracted by using TriZol kit 2 days later. Pit formation assay Pit formation was examined by using RANKL-stimulated RAW264.7 cells cultured on BioCoat OsteologicTM slides in the presence or absence of DXM. After a 3-day culture, the slides were washed with 6 % sodium hypochlorite solution to remove the cells. The resorbed areas on the slides were photographed with an inverted microscope (Olympus 4J18950-DP70, Tokyo, Japan), and were quantified using MetaMorph software (Molecular Device, Toronto, Canada).

TNF-α production from RAW264.7 cells RAW 264.7 cells were seeded at a density of 2,000/well into a 48-well culture dish in the presence or absence of 10 ng/ml RANKL. After a 24-h culture, cells were treated with different concentrations of DXM for 2 h before adding RANKL to stimulate TNF-α secretion for further 16 h. The amount of TNF-α was measured by ELISA kit in accordance with manufacturer’s instructions. Western blot RAW264.7 cells were seeded onto six-well plates. After reaching confluence, cells were incubated with DXM (50 μM) for 30 min and treated with RANKL (10 or 100 ng/ml) for different time intervals. Cells were then washed with cold PBS and lysed for 30 min at 4 °C with lysis buffer as described previously [14]. For the separation of cytosolic extracts and nuclear extracts, cells were cultured on a 3.5-cm dish. After reaching confluence, cells were treated with test substances. Cytosolic extracts and nuclear extracts were then separated by NE-PER (Nuclear and Cytoplasmic Extraction Reagents, Thermo Scientific-Pierce, Rockford, IL, USA), and the time point was selected according to our previous study [16]. Equal protein (30 μg) was applied per lane, and electrophoresis was performed under denaturing conditions on a 10 % SDS gel and transferred to an immobilon-P (PVDF) membrane (Merck-Millipore, Bedford, MA, USA). The blots were blocked with 5 % non-fat milk in TBS-T (0.5 % Tween 20 in 20 mM Tris and 137 mM NaCl) for 1 h at room temperature and then probed with antibodies against specific antigens (1:1,000) at 4 °C overnight. After three washes by TBS-T, the blots were subsequently incubated with goat anti-rabbit or anti-mouse peroxidase-conjugated secondary antibody (1:10,000) for 1 h at room temperature. The blots were visualized by enhanced chemiluminescence using Amersham HyperfilmTM ECL (GE Healthcare, Upland, CA, USA) or Biospectrum Imaging System (UVP, Upland, CA, USA). For normalization purposes, the same blot was also probed with anti-α-tubulin, anti-IKK, anti-ERK2, anti-Akt, anti-P38, or anti-C23 (Nucleolin, NCL) antibody (1:1,000). Measurement of cell viability by MTT assay MTT was used as an indicator of cell viability as determined by its mitochondria-dependent reduction to formazone [15]. Osteoblasts were plated onto 24-well culture plates at a density of 2×104 cells/well in 10 % FBS/α-MEM. Cells were grown for 48 h and then treated with various concentrations of dextromethorphan for 1 to 7 days. The medium was changed every 3 days. RAW264.7 cells were plated onto 24-well culture plates at a density of 5×104 cells/well in 10 % FBS/αMEM. Cells were grown for 48 h and then treated with various concentrations of dextromethorphan for 48 h. After washing the cells, 200 μl α-MEM containing 0.5 mg/ml MTT

Osteoporos Int

was added to each well. Cells were incubated for 30 min at 37 °C, the supernatant was then removed, and the formed blue crystals in viable cells were solubilized with dimethylsulfoxide, which was transferred to 96-well plate and the absorbance of each well was measured at 550 nm by using a microplate reader (Bio-Tek, Winooski, VT, USA).

Rat sclerostin Rat PPARgamma2 Rat aP2 Rat LPL

Measurement of osteogenic and adipogenic differentiation in osteoblasts Osteoblasts were plated onto 24-well culture plates at a density of 2×104 cells/well in 10 % FBS/α-MEM supplemented with 50 μg/ml L-ascorbic acid and 10 mM β-glycerophosphate [15]. The culture medium was changed every 3 days and test substances were newly replaced. After 2 weeks, the cells were washed twice with TBS, fixed in ice-cold 75 % (v/v) ethanol for 30 min and then air-dried. Calcium deposition was determined using quantitative alizarin red S staining. In brief, the ethanol-fixed cells and matrix were stained for 1 h with 40 mM alizarin red-S (pH4.2) and extensively rinsed with distilled water. After photography, the bound staining was eluted with 10 % (w/v) cetylpyridinium chloride. The alizarin red S in samples was quantified by measuring absorbance at 550 nm and calculated according to a standard curve. The total RNA was extracted on days3, 7, and 14 for osteogenic signaling and adipiogenetic (PPARgamma2) signaling analysis. For further adipogenic signaling analysis, the cells were cultured in 10 % FBS/α-MEM and was initiated 24–48 h after confluence by changing the medium to 10 % FBS/α-MEM containing insulin (5 μg/ml), IBMX (0.5 mM), dexamethasone (0.1 μM), and different concentrations of DXM. After 3 days, the total RNA was extracted for qPCR analysis. Quantitative real-time PCR for mRNA analysis Total RNA was extracted by TriZol Kit. The absorbance was measured in a spectrophotometer, Picodrop (Picodrop Ltd., Essex, UK) at 260 and 280 nm. RNA was used for RT-PCR by using MMLV RT kit. Gene expression was detected by realtime PCR using a SYBR Green qPCR kits (Applied Biosystems, Foster City, CA, USA) and an ABI StepOnePlus realtime PCR system. The following primers were used: Rat β-actin Rat ALP Rat OCN Rat RUNX2 Rat BMP-2

gctcctcctgagcgcaagta and ggccaggatagagccacca tgaatcggaacaacctgactga and ttccactagcaagaagaagccttt aagcccagcgactctgagtct and ccggagtctattcaccaccttact ctccaacccacgaatgcacta and gtgagtggtggcggacatg ggactgcggtctcctaaa and cagcctcaactcaaactcg

Mouse β-actin Mouse CCR2 Mouse CALCR

gagaacaaccagaccatgaac and gctcgcggcagctgtact cctccctgattgaataaagatgg and ctgggcggtctccactga gatttccttcaaactgggcg and tgacacattccaccaccagc aggtcagagccaagagaagca and ggagtaggttttatttgtggcg tcctcctgagcgcaagtactct and cggactcatcgtactcctgctt attctccacaccctgtttcg and gattcctggaaggtggtcaa tggtgcggcgggatcctataagt and agcgtaggcgttgctcgtcg

Amplification was performed in the following cycling conditions: 50 °C for 2 min and 95 °C for 10 min and then 40 cycles of 95 °C for 15 s followed by 60 °C for 1 min [14, 15]. The optimal concentrations of primers and templates that were used in each reaction were established based on the standard curve created before reaction and corresponding to nearly 100 % efficiency of the reaction. The reference household gene used to normalize the amount of mRNA was βactin. The fold change in gene expression relative to control was calculated by 2 ΔΔCT . Osteoporosis induced by ovariectomy ICR mice were used in this study. Mice were ovariectomized bilaterally under trichloroacetaldehyde anesthesia and control mice were sham operated for comparison. All animals were kept under controlled conditions at room temperature (22±1 °C) and a 12-h light–dark cycle. Distilled water or dextromethorphan (20 or 40 mg/kg/day) was administered to mice (once/day) by gastric intubation for 4 weeks. In addition, some mice were fed daily with DXM dissolved in drinking water (about 10 or 20 mg/kg/day) for 5 weeks. Analysis of bone resorption markers and osteoblastic markers in serum At the end of experiment, mice were anesthetized and sacrificed. The blood sample was quickly obtained from left ventricle. Serum samples were prepared by centrifugation. In addition, the tibiae were removed and cleaned of soft tissue for further analysis. CTX (C-terminal telopeptides of type-I collagen) levels were measured by Serum Rat-Laps ELISA assay for the evaluation of bone resorption (Immunodiagnostic Systems, Boldon Colliery, Tyne & Wear, UK). The levels of mouse osteocalcin (OCN) was measured by using MILLIPLEX® MAP kit (Merck-Millipore), and the levels of bone-specific ALP (BALP) was measured by using BALP ELISA kits (USCN Life, Wuhan, China).

Osteoporos Int

Microcomputed tomography Tibiae were removed from mice, fixed with 4 % paraformaldehyde, and then analyzed by microcomputed tomography (μCT). Fixed bones were subjected to the X-ray microtomography apparatus by using Skyscan 1176 (SKYSCAN, Kontich, Belgium). Scanning was done at 50 kV and 497 μA with a 0.5-mm aluminum filter. The images were collected at a resolution of 9 μm/pixel. Reconstruction of sections was carried out with scanner software (NRecon). Quantification of bone mineral density and trabecular morphometric indices was performed in a defined cancellous bone area located 0.5– 1.5 mm (113 sections) below the growth plate of the proximal end of the tibia [17]. The analysis was performed by scanner software (CTAn). Trabecular morphology was described by measuring bone volume fraction (bone volume/tissue volume, BV/TV), ratio of bone surface to tissue volume (BS/TV), trabecular number (Tb N), trabecular thickness (Tb Th), and trabecular bone mineral density (BMD). The 3D images were obtained with scanner software (CTvox).

RANKL-induced osteoclast differentiation. As shown in Fig. 1, DXM concentration dependently inhibited TRAPpositive multinucleated osteoclast formation on day6 in primary cell cultures. The inhibition was 27.0±4.7, 33.6± 4.1, 42.6±3.2, and 87.4±6.9 % for 0.1, 1, 10, and 50 μM DXM, respectively. We also analyzed the inhibitory effects

TRAP staining of tibiae sections Mouse tibiae were fixed using PBS containing 4 % paraformaldehyde at 4 °C for 48 h, decalcified using 10 % Na2EDTA at 4 °C for 14 days, dehydrated in increasing concentration of ethanol and embedded in paraffin. The serial histological sections were cut longitudinally (4 μm) and then stained by TRAP kit. Images of the growth plate and proximal tibia were photographed by using a CX31 microscope (Olympus, Tokyo, Japan). Measurement of the ratio between osteoclasts and the perimeter of trabecular bone was performed on the primary and secondary spongiosa. Bone perimeter was calculated using Image Pro Plus 3.5 (Media Cybernetics, MD, USA). Statistical analysis Each experiment was repeated at least three times. All quantitative data were presented as mean ± SEM. Significant differences were determined by analysis of variance (ANOVA) and two-tailed Student’s t test. A difference was considered significant if p