Dietary resistant maltodextrin ameliorates ... - Wiley Online Library

ORIGINAL ARTICLE

Dietary resistant maltodextrin ameliorates testicular function and spermatogenesis in streptozotocin– nicotinamide-induced diabetic rats C.-Y. Liu1, Y.-J. Hsu2, Y.-W. E. Chien3, T.-L. Cha4 & C.-W. Tsao4 1 2 3 4

Department of Nutritional Science, Fu Jen Catholic University, New Taipei City, Taiwan; Division of Nephrology, Department of Medicine, Tri-Service General Hospital, National Defense Medical Center, Taipei, Taiwan; School of Nutrition and Health Sciences, Taipei Medical University, Taipei, Taiwan; Division of Urology, Department of Surgery, Tri-Service General Hospital, National Defense Medical Center, Taipei, Taiwan

Keywords Diabetes mellitus—hypogonadism—resistant maltodextrin—spermatogenesis—steroidogenesis Correspondence Chih-Wei Tsao, MD, PhD, Division of Urology, Department of Surgery, Tri-Service General Hospital, National Defense Medical Center, No. 325, Section 2, Cheng-Gung Road, Neihu 114, Taipei, Taiwan. Tel.: +886 2 87927170; Fax: +886 2 87927172; E-mail: [email protected] Accepted: May 31, 2015 doi: 10.1111/and.12454

Summary This study investigated the effect of resistant maltodextrin (RMD) on reproduction in streptozotocin (STZ)–nicotinamide-induced type 2 diabetic male rats. Forty male rats were induced with diabetes by a single intraperitoneal injection of STZ (50 mg kg1) and nicotinamide (100 mg kg1). Five groups were analysed in total: normal, diabetic rats without RMD, diabetic rats with RMD 1.2 g per 100 g diet (19), with RMD 2.4 g per 100 g (29), and with RMD 6.0 g per 100 g (59). The groups of diabetic rats with the RMD supplement, compared to those without supplement, showed improved plasma glucose control, attenuated insulin resistance and recovery of testosterone level and spermatogenesis stage. The STZ–nicotinamide-induced diabetes mellitus (DM) caused a significant reduction in serum testosterone, testis androgen receptor (AR), steroidogenic acute regulatory protein (StAR) and 3b-hydroxysteroid dehydrogenase (3b-HSD) protein, but a statistical recovery in each of these was observed in the 59 group. TUNEL-positive cells were observed in the diabetic without RMD group, and RMD treatment reduced apoptotic germ cells. The expression of Bax/Bcl2 was induced in the diabetic group and also significantly reduced in the 59 group. Dietary RMD may improve metabolic control in STZ–nicotinamide-induced diabetic rats and attenuate hyperglycaemia-related impaired male reproduction and testicular function.

Introduction The prevalence of diabetes mellitus (DM) is increasing worldwide. The chronic hyperglycaemia in DM is associated with the long-term damage, dysfunction and failure of multiple organ systems, including the genito-urinary system. Genito-urinary complications are common in patients with diabetes and about 90% of male patients with diabetes have disturbances in sexual function, including decreased libido, impotence, retrograde ejaculation (Dinulovic & Radonjic, 1990; Brownlee, 2005; Agbaje et al., 2007; Fedder et al., 2013), and infertility due to low testosterone concentrations (Kapoor et al., 2007). A meta-analysis of cross-sectional data suggested that DM can be considered to be independently associated with male hypogonadism (Corona et al., 2011). In addition, investigation into human sperm samples from male © 2015 Blackwell Verlag GmbH Andrologia 2016, 48, 363–373

patients with diabetes showed an increase in nuclear and mitochondrial DNA damage by means of hyperglycaemia causing oxidative stress and free radical formation (Agbaje et al., 2007). Furthermore, several studies suggested a significant role for insulin in the reproductive tract and an increased potential for diabetes to affect male fertility (Kanter et al., 2012; Ruan et al., 2012). Numerous therapeutic strategies for the treatment of DM have emerged over the past decade, and providing medical nutrition therapy for the prevention and treatment of DM has shown tremendous potential benefits. Higher glucose concentrations are thought to play a direct pathogenic role in the disease process (Barclay et al., 2008), and some systematic reviews of intervention studies (Livesey et al., 2008a,b) have shown that foods with a low glycaemic index or load can help to normalise fasting blood glucose concentrations, improve glycated 363

RMD attenuates the harmful effect of DM testis

protein concentrations, and elevate insulin sensitivity in diabetic and nondiabetic subjects (Brand-Miller et al., 2003; Livesey et al., 2008a,b). Resistant maltodextrin (RMD) is a low viscosity, watersoluble, indigestible dextrin produced by the treatment of cornstarch with acid, enzymes and heat (Wakabayashi, 1993; Kishimoto et al., 1995). A diet which includes high levels of resistant starch may increase the insulin sensitivity in humans (Bhalla et al., 2004; Wild et al., 2004), when measured by the hyperinsulinaemic–euglycaemic clamp technique, which is considered to be the gold standard for assessing insulin sensitivity. Bhalla et al. (2004) concluded that resistant starch intake increased the uptake of glucose into skeletal muscle, increased the uptake of short-chain fatty acids into both muscle and adipose tissue, and reduced adipose tissue lipolysis. Moreover, another study (Wild et al., 2004) found that resistant starch increased meal fat oxidation and reduced triglyceride storage within muscle tissue. Previous studies have also shown that RMD can attenuate the glycaemic response to carbohydrate-rich foods (Livesey & Tagami, 2009) and be well-tolerated by the patients, resulting in favourable fermentation characteristics in the large bowel and changes in bacterial populations (Fastinger et al., 2008). The most novel and relevant data (Noshad, 2012) describe a role for resistant starch in ameliorating inflammation, optimal bowel health and prevention of colonrelated cancer, and the systemic effects of treatments for other forms of cancer, such as breast cancer. The purpose of this study was to determine the potential protective effects of RMD on STZ–nicotinamide-induced testicular damage and apoptotic germ cell death by means of glycaemic control and insulin sensitisation. Materials and methods Animals Forty adult male Wistar rats (8 weeks old, weighing 180– 200 g) were purchased from the National Laboratory Animal Centre (Taipei, Taiwan). All rats were housed in a temperature- and humidity-controlled room and given ad libitum access to a standard chow diet for 1 week before the study. The care of the laboratory animals was in full compliance with the Guide of National Research Council for the Care and Use of Laboratory Animals (Gress et al., 2000). This study was approved by the Animal Ethics Committee of Taipei Medical University. Food intake was measured thrice weekly throughout the study period to calculate the average energy intake and food efficiency. Feed efficiency (%) = (mean body weight gain) 9 100/energy intake. 364

C.-Y. Liu et al.

Streptozotocin–nicotinamide-induced diabetes Diabetes was induced in the rats by intraperitoneal injections of 100 mg kg1 nicotinamide dissolved in 0.9% normal saline (Sigma Chemical Co, St. Louis, MO, USA), followed by freshly prepared streptozotocin (STZ) dissolved in 0.1 M citrate-phosphate buffer (50 mg kg1) (Centers for Disease Control and Prevention, 2004). The normal group (n = 8) was injected with vehicle (0.1 M citrate-phosphate buffer, pH 4.5). This procedure was repeated after 1 day. Two weeks after STZ or vehicle injection, blood samples were obtained by tail prick. Blood glucose concentrations were measured using a hand-held glucose meter (Accu-Chekâ Glucose Meter; Roche Diagnostics, Laval, QC, Canada). Only the STZ– nicotinamide-induced diabetic rats with serum glucose levels ≥180 mg dl1 were included in the diabetic groups. Thirty-two male rats with DM were divided into four groups, and fed with an AIN-93M rodent diet with or without the following amounts of RMD (Fibersol-2): without RMD, RMD 1.2 g per 100 g (group 19), RMD 2.4 g per 100 g (group 29) and RMD 6.0 g per 100 g (group 59) (Table 1). In the 11th week, the intraperitoneal glucose tolerance test was performed. After an overnight fast (12–16 h), the rats were injected intraperitoneally with glucose (0.5 g kg1 body weight). Blood samples were collected from the tail vein at 0, 30, 60, 90 and 120 min, and levels of glucose and insulin were measured. All rats were sacrificed after 12 weeks, and blood from the inferior vena cava and testis tissue was harvested. Biochemical analysis Plasma glucose concentrations were determined by colorimetric methods after an enzymatic reaction with peroxidase (Randox, CO. Antrim, UK), and plasma insulin levels were determined using a rat insulin ELISA kit (Mercodia, Uppsala, Sweden). Testosterone was analysed with an electrochemiluminescence immunoassay using an Elecsys autoanalyser (Model 2010; Roche, Mannheim, Germany) according to the manufacturer’s instructions.

Measurement of insulin sensitivity and resistance The homoeostasis model assessment index (HOMA-IR) was used to measure insulin sensitivity. The HOMA-IR values were calculated using the following formula: (fasting insulin 9 fasting glucose)/22.5 (Matthews et al., 1985). To further evaluate the overall glucose exposure, we collected the glucose and insulin concentrations after intraperitoneal glucose tolerance tests and calculated the area under the concentration curve. © 2015 Blackwell Verlag GmbH Andrologia 2016, 48, 363–373


C.-Y. Liu et al.

Table 1 Composition of experimental diets Diabetic with RMD Gram per 100 g diet

a

Corn starch Dextrin Casein – vitamin free Sucrose Powered cellulose Soya bean oil AIN 93M mineral mix AIN 93 vitamin mix Choline bitartrate L-cystine t-butylhydroquinone Fibersol-2 High-fibre noodle

Normal controls

Diabetic (no RMD)

19

29

59

46.57 15.5 14.0 10.0 5.0 4.0 3.5 1.0 0.25 0.18 0.0008 0 0

46.57 15.5 14.0 10.0 5.0 4.0 3.5 1.0 0.25 0.18 0.0008 0 0

34.3 15.5 12.7 10.0 3.2 4.0 3.5 1.0 0.25 0.18 0.0008 1.2 14.8

34.8 15.5 12.8 10.0 3.4 4.0 3.5 1.0 0.25 0.18 0.0008 2.4 13.6

36.3 15.5 13.1 10.0 3.78 4.0 3.5 1.0 0.25 0.18 0.0008 6.0 10.0

19: RMD 1.2 g per 100 g, 29: 2.4 g per 100 g, 59: RMD 6.0 g per 100 g. Diets were based on the AIN-93M rodent diet (American Institute of Nutrition rodent diet for adult maintenance, 1993).

a

Testis tissue preparation for histological analysis The testes were fixed in 4% paraformaldehyde for 24 h and then were embedded in paraffin. Four-lm-thick sections were prepared and stained with haematoxylin and eosin. Measurement of testis histology analysis The testis specimens were embedded in the paraffin blocks after they had been fixed in Bouin’s solution. Sections of 5 lm were obtained, deparaffinised and stained with haematoxylin and eosin (H&E). The testis tissue was examined and evaluated in random order under blindfold conditions with standard light microscopy. Three slides prepared from the upper, lower and mid-portions of the testis were evaluated completely for each testis. Mean seminiferous tubule diameter (MSTD) was measured in micrometres. Testicular injury and spermatogenesis were assessed histopathologically using Johnsen’s mean testicular biopsy score (MTBS) criteria (2000). Preparations were evaluated with a bright field microscope (Nikon Optiphot 2, Tokyo) and photographed.

drated in PBS (pH 7.5). Tissues were then treated with proteinase K solution for permeabilisation and then refixed with 4% paraformaldehyde solution. Endogenous peroxidase was inactivated by 3% H2O2 in methanol. Slides were then treated with recombinant terminal deoxynucleotidyl transferase (TdT) reaction mix and incubated at 37 °C for 1 h. Reaction was terminated by immersing the slides in 29 SSC solutions for 15 min at room temperature. After blocking the endogenous peroxidases activity (by 0.3% hydrogen peroxide), slides were washed with PBS and then incubated with streptavidin horseradish peroxidase solution for 30 min at room temperature. After washing, slides were incubated with 3,30 diaminobenzidine (substrate) solution until a light brown background appears (10 min) and then rinsed several times in deionised water. After mounting, slides were observed by light microscope. TUNEL-labelled sections were examined under 4009 magnification and counted randomly from at least three sections per testis per rat. The apoptotic ratio (%) was measured as the ratio between the total numbers of TUNEL-positive nuclei.

RNA isolation and real-time quantitative RT-PCR TUNEL assay The dUTP nick-end labelling (TUNEL) assay was carried out using DeadEnd Colorimetric TUNEL System (Promega, Madison, WI, USA). According to the manufacturer’s protocol, briefly, paraffin-embedded sections (5 lm thick) were deparaffinised in xylene twice and then treated with a graded series of alcohol [100%, 95%, 85%, 75% ethanol (v/v) in double-distilled water] and rehy-

© 2015 Blackwell Verlag GmbH Andrologia 2016, 48, 363–373

Total RNA was isolated from each testis tissue sample using a Qiagen RNeasy kit (Qiagen, Valencia, CA, USA). Total RNA yield and purity was assessed by NanoDrop (Thermo Scientific, Waltham, MA, USA). An additional DNase I digestion procedure (Qiagen) was included in the isolation of RNA according to the manufacturer’s protocol to remove contaminating DNA. A TaqManâ reverse transcription kit (Applied Biosystems, Foster City,

365


CA, USA) was used to generate cDNA from total RNA. Primers for androgen receptor (AR), steroidogenic acute regulatory protein (StAR), 3b-HSD, 17b-HSD, Bax, Bcl2, cytochrome c, caspase 3, caspase 9 and the housekeeping gene GAPDH were purchased from Mission Biotech (Taipei, Taiwan). The primer sequences used for the quantitative RT-PCR assays are listed in Table 2. Quantitative PCR was performed using an SYBR Green PCR Master Mix Reagent Kit (Applied Biosystems). After PCR mixture heating at 95 °C for 10 min, PCR was performed in a thermal cycler ABI 7500 Real-Time PCR (Applied Biosystems) for 40 cycles, each of which consisted of denaturation at 95 °C for 15 s, annealing at 60 °C for 30 s and extension at 72 °C for 30 s, followed by a final 10-min extension at 72 °C. Relative gene expression was determined based on the threshold cycles (Ct) of the genes of interest and the internal reference gene, Gapdh. The mRNA levels of the genes of interest were expressed as the ratio of each gene of interest to GAPDH mRNA for each sample. The average Ct value of the GAPDH gene was subtracted from the average Ct value of each gene of interest for each testis sample, and the fold change (2DCt ) in expression was calculated for the target gene relative to the internal control gene (GAPDH). Western blot analysis The testes were dissected and stored at 80 °C. Subsequent thawing and homogenisation steps were performed in a RIPA lysis buffer with protease inhibitors. The protein concentrations were determined using a BCA Protein Assay kit (Pierce, Rockford, IL, USA). Total proteins (50 lg per sample) were separated by SDS-PAGE and then transferred onto PVDF membranes. After blocking, the membranes were incubated with specific antibodies to Bax, Bcl2 (Cell Signalling, Boston, USA), caspase 8 (GeneTex, Irvine, CA, USA), AR, StAR, 3b-HSD or Gap-

C.-Y. Liu et al.

dh (Santa Cruz, Dallas, TX, USA). After washing, the membranes were incubated with horseradish peroxidaseconjugated goat anti-rabbit IgG (1 : 5000). Specific protein bands were developed using the Amersham ECL nonradioactive method (Amersham, Piscataway, NJ, USA). To quantify the protein levels, relative bands obtained from the Western blots were analysed using IMAGEJ software (NIH, USA). Statistical analysis Data are expressed as group mean standard deviation (SD). Analysis of variance was performed to detect differences between groups. When significant differences were detected, analysis of the difference between the means of the treated and control groups was carried out using Dunnett’s t-test. All statistical analyses were performed using SPSS version 16 (SPSS, Chicago, IL, USA). Results Body weight, food intake, testis weight and testosterone levels There were no differences in the initial body weight between the five groups (data not shown); however, the diabetic group without RMD intake had a statistically significant weight loss compared to the normal controls after 12 weeks. The four diabetic groups (diabetic without RMD, diabetic + 19, 29 and 59 RMD) had a significantly increased daily food intake compared with the normal group, but there were no statistical differences between the individual diabetic groups. Feed efficiency was similar to the animals’ statistical daily food intake status. No significant differences in testis weight were found between the five different groups. However, the plasma testosterone level was significantly lower in the

Table 2 Primer sequences used for quantitative RT-PCR Gene

Sense

Antisense

Bax Bcl2 Caspase 3 Caspase 9 Cytochrome c Ar Star 3b-HSD 17b3-HSD Gapdh

GCTGGACACTGGACTTCC TC AGTACCTGAACCGGCATCTG GAAAGCCGAAACTCTTCATCAT ACAAGGCCTTCGACAGTG TTGGCCGAAAGACTGGACAA ACCTGCCTGATCTGTGGAGA CTGCTAGACCAGCCCATGGAC ATATTGGAGGCCTGCGTCG AGT GTG TGA GGT TCT CCC GGT ACC T ATG GGA AGC TGG TCA TCA AC

GCC TCAGCCCATCTTCTTCC CAGCCAGGAGAAATCAAACAG TGCCATATCATCGTCAGTTCC GTACCAGGAACCGCTCTT TGGGATGTATTTCTTCGGGTTCT CATTTCCGGAGACGACACGA TGATTTCCTTGACATTTGGGTTCC GCCTTCTCGGCCATCCTTTT TACAACATTGAGTCCATGTCTGGCCAG CCA CAG TCT TCT GAG TGG CA

Ar, androgen receptor; Star, steroidogenic acute regulatory protein; 3b-HSD, 3-beta-hydroxysteroid dehydrogenase; 17b3-HSD, 17-beta-hydroxysteroid dehydrogenase type 3.

366



C.-Y. Liu et al.

diabetic group without RMD (48.7 18.1 ng/dl) compared with the normal group (180.6 30.7 ng/dl), and the elevated testosterone levels gradually recovered with increasing RMD dosage to values (231.7 65.9 ng/dl for 59 RMD group) equivalent to normal animals (Table 3). Plasma levels of glucose, insulin and HOMA-IR Plasma glucose and insulin levels were significantly higher in the diabetic without RMD group compared to the normal group (P < 0.05; Table 4). Interestingly, the levels of blood glucose and insulin were more stable with increases in the dosage of RMD. Insulin resistance, as assessed by HOMA-IR, was significantly higher in the diabetic rats compared to the normal group, but returned to the similar range of the control with the addition of RMD supplements. The areas under the glucose and insulin curves (AUCglucose and AUCinsulin) were larger in the diabetic without RMD group compared to the normal group but were significantly lower in the animals provided with RMD supplements compared to the diabetic without RMD treatment group (Table 4). Histological analysis of the testis The normal group showed normal histological structure of the seminiferous tubules and normal spermatogenesis, whereas the induction of morphological alternations with diminished seminiferous tubule sizes and degenerated germinal cells was observed in the diabetic without RMD group. The histological structure of the seminiferous tubules in the animals administered with RMD was similar to the normal group. The mean seminiferous tubule diameter (MSTD) and mean Johnsen’s testicular biopsy scores (MTBS) in the diabetic without RMD group (MSTD: 198 6.4 lm, MTBS: 5.2) were significantly lower than those of the 59 RMD group (MSTD: 231 8.2 lm, MTBS: 7.7; both P < 0.05) and normal group (MSTD: 265 9.5 lm, MTBS: 9.1; both P < 0.01)

(Fig. 1). No significant change was determined in germ cell apoptosis in the 59 RMD group compared to the control group (1.74 2.90%, Fig. 1a). TUNEL-positive cells were observed in the diabetic without RMD group (67.70 15.90%, Fig. 1b) and RMD treatment reduced the number of apoptotic germ cells (10.90 11.66%, Fig. 1c). RMD significantly attenuated the diabetesinduced morphological changes and germ cell apoptosis in the diabetic rat testis (P < 0.05). Expression of apoptosis-related genes, androgen receptor and steroidogenic-related genes The levels of Bcl2, Bax, cytochrome c, and caspases 3 and 9 mRNA in the testes are shown in Fig. 2. The ration of Bax to Bcl2 mRNA expression was a significantly higher (P < 0.05) in diabetic without RMD group compared to the normal and 59 RMD groups. No significant differences were observed in the levels of cytochrome c, and caspases 3 and 9 mRNA between any of the groups. The levels of Ar and steroidogenic-related gene mRNA, Star and 3b-Hsd, were significantly lower in the diabetic without RMD group compared with the normal and 59 RMD groups (Fig. 3, P < 0.05). Figure 4a demonstrates the significantly higher ratio of Bax to Bcl2 protein expression in diabetic without RMD group compared to the normal group. This ratio is lower in 59 RMD group than in diabetic without RMD group, but the difference is not statistically significant. Then, we checked the protein expression of pro-caspase 8 and cleaved caspase 8, the Figure 4b shows that the significantly higher cleaved caspase 8 protein expression in diabetic without RMD group compared to the normal group. It is lower in 59 RMD group than in diabetic without RMD group, but the difference is still not statistically significant. Figure 4c shows that the expression of AR, StAR and 3b-HSD proteins in the STZ-induced diabetic rats was significantly lower than in the diabetic without RMD group. In particular, the expression of AR

Table 3 Weight, food intake, feed efficiency, testis weight and testosterone level of the type 2 diabetic rats Diabetic with RMD Normal controls Weight (g) Daily food intake (g day1) Feed efficiency (%) Testis weight (g) Testosterone (ng/dl)

500.1 22.8 8.86 1.70 180.6

42.9a 1.7a 3.39a 0.34 30.7a

Diabetic (no RMD) 355.6 39.4 0.96 1.68 48.7

87.1bc 6.8b 3.32b 0.28 18.1b

19 407.6 34.7 1.98 1.63 55.3

29

139.6abc 7.4b 6.14b 0.12 7.6b

425.2 40.5 2.05 1.68 94.0

59

31.9c 3.0b 2.72b 0.07 36.5b

431.4 34.2 2.33 1.79 231.7

87.5ab 7.7b 5.19b 0.24 65.9a

Data are presented as means SD (n = 8 in each group). Values are expressed as mean SD from three independent experiments, and those that do not share the same letter (a, b or c) differ significantly (P < 0.05). 19: RMD 1.2 g per 100 g, 29: RMD 2.4 g per 100 g, 59: RMD 6.0 g per 100 g.


367


C.-Y. Liu et al.

Table 4 Plasma glucose, insulin, HOMA-IR, area under the glucose and insulin curve from the glucose tolerance test of type 2 diabetic rats Diabetic with RMD Normal controls Plasma Plasma HOMA-IR AUCglucose AUCinsulin

glucose (mg dl1) insulin (ng dl1) (mg 9 min dl1) (ng 9 min dl1)

227.6 27.13 5.13 30 186 3365

Diabetic (no RMD)

10.9a 1.24a 1.15a 1543a 473a

339.1 39.43 7.99 45 795 4789

90.7b 1.45b 3.07b 3205c 252c

19 302.1 36.83 6.86 45 154 4715

29

113.1ab 1.28b 3.11ab 5451c 541c

293.1 34.21 5.24 40 896 4164

59

41.5ab 1.07ab 1.60a 8182bc 182bc

236.5 28.21 5.20 37 112 3693

56.7a 2.73a 1.60a 6662b 671b

HOMA-IR, homoeostasis model assessment for insulin resistant; AUC, area under the curve. Data are presented as means SD (n = 8 in each group). Values are expressed as mean SD from three independent experiments, and those that do not share the same letter (a, b or c) differ significantly (P < 0.05). 19: RMD 1.2 g per 100 g, 29: RMD 2.4 g per 100 g, 59: RMD 6.0 g per 100 g.

(a)

(b)

(c)

Fig. 1 Haematoxylin-/eosin-stained paraffin sections and TUNEL staining of the testes from (a) normal rats, (b) diabetic rats and (c) diabetic rats with 6.0 g per 100 g RMD supplement (59) (scale bar = 50 lm).

and StAR proteins was significantly greater in the animals provided with RMD supplements than in the diabetic group without RMD treatment (P < 0.05), and StAR protein expression in 59 RMD group was even significantly greater than that of the normal group (P < 0.05). The 3b-HSD expression was similar in the animals treated with RMD supplements and the normal group. There were no significant changes in 17b-HSD level between the normal, diabetic without RMD, 19 RMD, 29 RMD and 59 RMD groups (data not shown). 368

Discussion The addition of RMD supplements to this STZ–nicotinamide-induced diabetic rat model led to improvements in body weight and hyperglycaemia. In addition, an improvement in impaired fertility was also noted in the RMD-supplemented groups. In addition, there was not only an increase in endocrine levels, but also significant recovery in spermatogenesis in animals treated with RMD compared to those without RMD treatment. © 2015 Blackwell Verlag GmbH Andrologia 2016, 48, 363–373


C.-Y. Liu et al.

(a)

(b)

(c)

(d)

Fig. 2 Effects of RMD supplements on apoptosis-related mRNA expression in the testes of the diabetic rats. (a) Bax/Bcl2, (b) caspase 3, (c) caspase 9 and (d) cytochrome c. Data show the fold changes of mRNA expression relative to the normal rats. Values are expressed as mean SD (n = 8), and those that do not share the same letter (a or b) differ significantly (P < 0.05).

(a)

(b)

(c)

Fig. 3 Effects of RMD supplements on androgen receptor and steroidogenic-related mRNA expressions in the testes of the diabetic rats. (a) AR, (b) StAR and (c) HSD3b. Data show the fold changes of mRNA expression relative to the normal rats. Values are expressed as mean SD (n = 8), and those that do not share the same letter (a or b) differ significantly (P < 0.05).

In males, testosterone is secreted primarily by the Leydig cells of the testes and is required for the maturation of germ cells and sperm, and thus fertility (Wang et al., 2009). Several molecules and enzymes are involved in key steps of steroid transport and androgen synthesis, including StAR, 3b-HSD and 17b-HSD. The rate-limiting step in all steroid production is the delivery of substrate cholesterol from the outer to the inner mitochondrial membrane, and this is primarily mediated by StAR (Clark et al., 1994; Stocco & Clark, 1996). Cholesterol is then converted to pregnenolone which is further metabolised to progesterone by mitochondrial or microsomal 3bHSD. The maturation of progesterone to androstenedione and its further conversion to testosterone is dependent on the activity of 17b-HSD. These steroid dehydrogenases specific to androgen production are two key steroidogenic enzymes that regulate testosterone synthesis. Finally,


testosterone can act directly on target cells through androgen receptors (ARs) (Payne & Hales, 2004; Stocco et al., 2005), and testicular steroidogenesis can be impaired by stress at the testicular level, resulting in a reduction in testosterone concentration (Srivastava et al., 1993). Dose-dependent increases in the activities of 3b-HSD, StAR and testosterone were observed in the RMD-supplemented groups. Trends towards a decrease in the ratio of Bax/Bcl-2 and in the levels of cytochrome c, caspase 8 were noticed; however, no significant changes were observed in the other apoptosis markers. Some studies showed that the apoptotic cell death play an important role in STZ-induced diabetic rat testicular damage, and the possible mechanisms could be due to STZ cytotoxicity and/or diabetes-related spermatogenic dysfunction through the regulation of Wnt 4, NF-jB, VEGF, NGF-b,

369


C.-Y. Liu et al.

(a)

(b)

(c)

Fig. 4 Effects of RMD supplements on (a, b) apoptotic-related protein, and (c) androgen receptor and steroidogenic-related protein expression in the testes of the diabetic rats. Data show fold changes of protein expression relative to the normal rats. Values are expressed as mean SD from three independent experiments, and those that do not share the same letter (a, b or c) differ significantly (P < 0.05).

TGF-b1, IL-1b, caspase 3, etc. (Roy et al., 2014; Sisman et al., 2014; Xu et al., 2014; Orman et al., 2015). In this STZ–nicotinamide-induced diabetic rat, our result showed that upregulation of Bax/Bcl-2 and caspase 8 in the diabetic group indicating the possible involvement of intrinsic pathway and extrinsic pathway respectively. However, the caspase 3 expression was not concordant to TUNEL results; more evidence is now accumulating that apoptosis can occur in complete absence of caspases, and other, noncaspase proteases have been described to be able to execute apoptosis (Borner & Monney, 1999; Broker et al., 2005). It also could be other effector caspases get involved in the process (Chowdhury et al., 2008; Almeida et al., 2013) which is need to explore in the future study. To our knowledge, this is the first study that investigated the correlation of diabetic process and testicular damage in STZ–nicotinamide-induced diabetic rat. Therefore, the mechanism of the improvements in hypogonadism in the STZ–nicotinamide-induced diabetic rats treated with RMD supplement cannot be explained only by the resistant starch directly attenuating testicular damage and apoptotic germ cell death. The mechanism 370

is more likely to be in accordance with the proposal by Reis et al. (2000) that insulin resistance is associated with a decrease in Leydig cell testosterone secretion. Our findings showed that improvements in Leydig cell testosterone secretion and related steroidogenic enzymes were correlated with a decrease in insulin resistance. Fernandes et al. (2004) reported that STZ-induced diabetic rats showed a decrease in the total number of Leydig cells and an impairment in cell function due to the loss of tyrosine phosphorylation accompanied with a strong decrease in the expression of androgen, GLUT-3 and IGF-I receptors. Our findings showed a statistical increase in the levels of ARs in the RMD-supplemented group compared to the diabetic without RMD group, which may have contributed to the recovery of spermatogenesis. The results reported by Tanaka et al. (2000) indicate a strong correlation between the inhibitory effect of insulin/glucose on the pituitary biosynthesis and secretion of follicle stimulating hormone (FSH), and the reduction in sperm output and fertility. Therefore, the recovery of spermatogenesis in the testis of the diabetic rats treated with RMD supplements appears to © 2015 Blackwell Verlag GmbH Andrologia 2016, 48, 363–373


C.-Y. Liu et al.

be associated with decreased insulin resistance and better glucose control. In addition to indirectly affecting spermatogenesis through interactions with the hypothalamic–pituitary axis, the low levels of plasma insulin in the diabetic rat model may also affect the testes directly by interacting with insulin receptors on the Sertoli cells (Viswanathan et al., 2000). The presence of insulin receptors on Sertoli cells suggests that these cells may be able to directly respond to circulating levels of insulin, particularly as the basal compartment of the seminiferous tubule is in contact with the blood and lymph. There is evidence to suggest that insulin has a stimulatory effect on spermatogenesis: Treatment of seminiferous tubule segments in culture with insulin stimulates spermatogonial DNA synthesis in rats (O’Byrne et al., 2000), and insulin treatment also promotes spermatogonial differentiation of primary spermatocytes in the newt (Tanaka et al., 2000). These experiments indicate that in addition to insulin’s effect on the hypothalamic–pituitary–gonadal (HPG) axis, insulin may have a direct role in the process of spermatogenesis. Moreover, some studies concerning insulinlike factor 3 (INSL3) supported a survival factor/anti-apoptotic role for INSL3 in germ cells, effectively abetting the role of FSH acting via Sertoli cells (Cilio et al., 2000; Honeyman et al., 2000; Rendell, 2000). INSL 3 is an important new downstream effector of the HPG axis, through positive feed-forward mechanisms, and acts to buffer the stimulus of LH (directly via Leydig cells) and of FSH (indirectly via Sertoli cells) on both steroidogenesis, as well as germ cell production (Chandalia et al., 2000). In conclusion, the extrapolation of our present findings suggests that impaired spermatogenesis and testosterone synthesis in STZ–nicotinamide-induced diabetic rats were ameliorated via improved glucose control and insulin resistance after RMD feeding. RMD may be a safe effective way to improve health for patients with diabetes. Some limitation of the study included no available data of intratesticular testosterone and definite FSH levels. Further studies on the detailed markers of apoptosis, oxidative stress and insulin resistance should be conducted to clarify the mechanism by which RMD attenuates decreased reproductive function and endocrines in STZinduced diabetic rats. Author contributions Chih-Wei Tsao and Chin-Yu Liu contributed to conception and design of study; Chin-Yu Liu and Yu-Juei Hsu conducted data analysis and interpretation; Chih-Wei Tsao, Chin-Yu Liu, Yi-Wen Eve Chien and Tai-Lung Cha contributed to drafting or revision of the manuscript.


Acknowledgements The study has been partially funded through a research grant of TSGH-C103-060 from the Tri-Service General Hospital, Taiwan. References Agbaje IM, Rogers DA, McVicar CM, McClure N, Atkinson AB, Mallidis C, Lewis SE (2007) Insulin dependant diabetes mellitus: implications for male reproductive function. Hum Reprod 22:1871–1877. Almeida C, Correia S, Rocha E, Alves A, Ferraz L, Silva J, Sousa M, Barros A (2013) Caspase signalling pathways in human spermatogenesis. J Assist Reprod Genet 30:487–495. Barclay AW, Petocz P, McMillan-Price J, Flood VM, Prvan T, Mitchell P, Brand-Miller JC (2008) Glycemic index, glycemic load, and chronic disease risk–a meta-analysis of observational studies. Am J Clin Nutr 87:627–637. Bhalla MA, Chiang A, Epshteyn VA, Kazanegra R, Bhalla V, Clopton P, Krishnaswamy P, Morrison LK, Chiu A, Gardetto N, Mudaliar S, Edelman SV, Henry RR, Maisel AS (2004) Prognostic role of B-type natriuretic peptide levels in patients with type 2 diabetes mellitus. J Am Coll Cardiol 44:1047–1052. Borner C, Monney L (1999) Apoptosis without caspases: an inefficient molecular guillotine? Cell Death Differ 6:497–507. Brand-Miller J, Hayne S, Petocz P, Colagiuri S (2003) Lowglycemic index diets in the management of diabetes: a metaanalysis of randomized controlled trials. Diabetes Care 26:2261–2267. Broker LE, Kruyt FA, Giaccone G (2005) Cell death independent of caspases: a review. Clin Cancer Res 11:3155– 3162. Brownlee M (2005) The pathobiology of diabetic complications: a unifying mechanism. Diabetes 54:1615– 1625. Centers for Disease Control and Prevention (2004) Preventivecare practices among adults with diabetes–Puerto Rico, 2000-2002. MMWR Morb Mortal Wkly Rep 53:1047–1050. Chandalia M, Garg A, Lutjohann D, von Bergmann K, Grundy SM, Brinkley LJ (2000) Beneficial effects of high dietary fiber intake in patients with type 2 diabetes mellitus. N Engl J Med 342:1392–1398. Chowdhury I, Tharakan B, Bhat GK (2008) Caspases – an update. Comp Biochem Physiol B Biochem Mol Biol 151:10– 27. Cilio CM, Bosco S, Moretti C, Farilla L, Savignoni F, Colarizi P, Multari G, Di Mario U, Bucci G, Dotta F (2000) Congenital autoimmune diabetes mellitus. N Engl J Med 342:1529–1531. Clark BJ, Wells J, King SR, Stocco DM (1994) The purification, cloning, and expression of a novel luteinizing hormone-induced mitochondrial protein in MA-10 mouse

371


Leydig tumor cells. Characterization of the steroidogenic acute regulatory protein (StAR). J Biol Chem 269:28314– 28322. Corona G, Monami M, Rastrelli G, Aversa A, Sforza A, Lenzi A, Forti G, Mannucci E, Maggi M (2011) Type 2 diabetes mellitus and testosterone: a meta-analysis study. Int J Androl 34:528–540. Dinulovic D, Radonjic G (1990) Diabetes mellitus/male infertility. Arch Androl 25:277–293. Fastinger ND, Karr-Lilienthal LK, Spears JK, Swanson KS, Zinn KE, Nava GM, Ohkuma K, Kanahori S, Gordon DT, Fahey GC Jr (2008) A novel resistant maltodextrin alters gastrointestinal tolerance factors, fecal characteristics, and fecal microbiota in healthy adult humans. J Am Coll Nutr 27:356–366. Fedder J, Kaspersen MD, Brandslund I, Hojgaard A (2013) Retrograde ejaculation and sexual dysfunction in men with diabetes mellitus: a prospective, controlled study. Andrology 1:602–606. Fernandes AP, Foss MC, Ramos SB, Donadi EA (2004) Overexpression of HLA class I molecules on T cells among type 1 diabetes Brazilian patients. Mol Immunol 41:1047– 1050. Gress TW, Nieto FJ, Shahar E, Wofford MR, Brancati FL (2000) Hypertension and antihypertensive therapy as risk factors for type 2 diabetes mellitus. Atherosclerosis risk in communities study. N Engl J Med 342:905–912. Honeyman MC, Coulson BS, Harrison LC (2000) A novel subtype of type 1 diabetes mellitus. N Engl J Med 342:1835; author reply 1837. Kanter M, Aktas C, Erboga M (2012) Protective effects of quercetin against apoptosis and oxidative stress in streptozotocin-induced diabetic rat testis. Food Chem Toxicol 50:719–725. Kapoor D, Aldred H, Clark S, Channer KS, Jones TH (2007) Clinical and biochemical assessment of hypogonadism in men with type 2 diabetes: correlations with bioavailable testosterone and visceral adiposity. Diabetes Care 30:911– 917. Kishimoto Y, Wakabayashi S, Takeda H (1995) Hypocholesterolemic effect of dietary fiber: relation to intestinal fermentation and bile acid excretion. J Nutr Sci Vitaminol (Tokyo) 41:151–161. Livesey G, Tagami H (2009) Interventions to lower the glycemic response to carbohydrate foods with a lowviscosity fiber (resistant maltodextrin): meta-analysis of randomized controlled trials. Am J Clin Nutr 89:114–125. Livesey G, Taylor R, Hulshof T, Howlett J (2008a) Glycemic response and health – a systematic review and metaanalysis: relations between dietary glycemic properties and health outcomes. Am J Clin Nutr 87:258S–268S. Livesey G, Taylor R, Hulshof T, Howlett J (2008b) Glycemic response and health – a systematic review and metaanalysis: the database, study characteristics, and macronutrient intakes. Am J Clin Nutr 87:223S–236S.

372

C.-Y. Liu et al.

Matthews DR, Hosker JP, Rudenski AS, Naylor BA, Treacher DF, Turner RC (1985) Homeostasis model assessment: insulin resistance and beta-cell function from fasting plasma glucose and insulin concentrations in man. Diabetologia 28:412–419. Noshad H (2012) Neuropathy in type 1 diabetic renal transplanted patients. Saudi J Kidney Dis Transpl 23:719– 723. O’Byrne S, Forte P, Roberts LJ 2nd, Morrow JD, Johnston A, Anggard E, Leslie RD, Benjamin N (2000) Nitric oxide synthesis and isoprostane production in subjects with type 1 diabetes and normal urinary albumin excretion. Diabetes 49:857–862. Orman D, Vardi N, Ates B, Taslidere E, Elbe H (2015) Aminoguanidine mitigates apoptosis, testicular seminiferous tubules damage, and oxidative stress in streptozotocininduced diabetic rats. Tissue Cell 47:284–290. Payne AH, Hales DB (2004) Overview of steroidogenic enzymes in the pathway from cholesterol to active steroid hormones. Endocr Rev 25:947–970. Reis AF, Ye WZ, Dubois-Laforgue D, Bellanne-Chantelot C, Timsit J, Velho G (2000) Mutations in the insulin promoter factor-1 gene in late-onset type 2 diabetes mellitus. Eur J Endocrinol 143:511–513. Rendell M (2000) Dietary treatment of diabetes mellitus. N Engl J Med 342:1440–1441. Roy S, Metya SK, Rahaman N, Sannigrahi S, Ahmed F (2014) Ferulic acid in the treatment of post-diabetes testicular damage: relevance to the down regulation of apoptosis correlates with antioxidant status via modulation of TGFbeta1, IL-1beta and Akt signalling. Cell Biochem Funct 32:115–124. Ruan CT, Lam SH, Chi TC, Lee SS, Su MJ (2012) Borapetoside C from Tinospora crispa improves insulin sensitivity in diabetic mice. Phytomedicine 19:719–724. Sisman AR, Kiray M, Camsari UM, Evren M, Ates M, Baykara B, Aksu I, Guvendi G, Uysal N (2014) Potential novel biomarkers for diabetic testicular damage in streptozotocininduced diabetic rats: nerve growth factor beta and vascular endothelial growth factor. Dis Markers 2014:108106. Srivastava RK, Taylor MF, Mann DR (1993) Effect of immobilization stress on plasma luteinizing hormone, testosterone, and corticosterone concentrations and on 3 beta-hydroxysteroid dehydrogenase activity in the testes of adult rats. Proc Soc Exp Biol Med 204:231–235. Stocco DM, Clark BJ (1996) Regulation of the acute production of steroids in steroidogenic cells. Endocr Rev 17:221–244. Stocco DM, Wang X, Jo Y, Manna PR (2005) Multiple signaling pathways regulating steroidogenesis and steroidogenic acute regulatory protein expression: more complicated than we thought. Mol Endocrinol 19:2647– 2659. Tanaka S, Kobayashi T, Momotsu T (2000) A novel subtype of type 1 diabetes mellitus. N Engl J Med 342:1835–1837.


C.-Y. Liu et al.

Viswanathan V, Chamukuttan S, Kuniyil S, Ambady R (2000) Evaluation of a simple, random urine test for prospective analysis of proteinuria in Type 2 diabetes: a six year followup study. Diabetes Res Clin Pract 49:143–147. Wakabayashi S (1993) The effects of indigestible dextrin on sugar tolerance: III. Improvement in sugar tolerance by indigestible dextrin on the impaired glucose tolerance model. Nihon Naibunpi Gakkai Zasshi 69:594–608. Wang RS, Yeh S, Tzeng CR, Chang C (2009) Androgen receptor roles in spermatogenesis and fertility: lessons from



testicular cell-specific androgen receptor knockout mice. Endocr Rev 30:119–132. Wild S, Roglic G, Green A, Sicree R, King H (2004) Global prevalence of diabetes: estimates for the year 2000 and projections for 2030. Diabetes Care 27:1047–1053. Xu Y, Lei H, Guan R, Gao Z, Li H, Wang L, Song W, Gao B, Xin Z (2014) Studies on the mechanism of testicular dysfunction in the early stage of a streptozotocin induced diabetic rat model. Biochem Biophys Res Commun 450:87– 92.

373