Dermacentor andersoni and Dermacentor variabilis. Amblyomma maculatum. Rhipicephalus san- guineus. Human. Human. Dermacentor nuttalli. Kashmir, India ...
JOURNAL OF CLINICAL MICROBIOLOGY, Mar. 1994, p. 803-810 0095-1 137/94/$04.00+0 Copyright © 1994, American Society for Microbiology
Vol. 32, No. 3
Differentiation among Spotted Fever Group Rickettsiae Species by Analysis of Restriction Fragment Length Polymorphism of PCR-Amplified DNA MARINA EREMEEVA, XUEJIE YU, AND DIDIER RAOULT* Unite des Rickettsies, Faculte de Medecine, Centre National de la Recherche Scientifique EP J0054, 27 Boulevard Jean Moulin, 13385 Marseille Cedex 05, France Received 12 July 1993/Returned for modification 5 November 1993/Accepted 29 November 1993
Restriction fragment length polymorphism (RFLP) analysis of PCR-amplified genes was used to study spotted fever group (SFG) rickettsiae, extending the previous work of Regnery et al. (R. L. Regnery, C. L. Spruill, and B. D. Plikaytis, J. Bacteriol. 173:1576-1589, 1991). Twenty-six strains of SFG rickettsia were studied, including several recognized species which have never been studied (R. parkeri, R. helvetica, and R. japonica) as well as strains which are not currently classified. Two previously used primer pairs derived from the R. prowazekii citrate syntase gene and the R. rickeffsii 190-kDa protein antigen gene were studied, as were primer pairs obtained from the R. rickettsii 120-kDa protein antigen gene. By using three amplifications and three enzyme digestions, it was possible to differentiate between almost all of the known SFG rickettsia species and to differentiate between several strains of the R. conorii complex. Two human pathogens, "R. africae" and the Israeli tick typhus rickettsia, were first separated by using BG-12 pair primer amplification and then RsaI restriction endonuclease digestion. The proposed simplified model of identification may be useful in studying the geographical distributions of SFG rickettsiae.
(negative control) were washed three times in distilled water by centrifugation at 17,500 x g for 5 min and were then boiled for 10 min. PCR amplification was performed by using previously described (26) oligonucleotide primer pairs Rp CS.877p and Rp CS.1258n generated from the citrate syntase (CS) gene of Rickettsia prowazekii and Rr 190.70p and Rr 190.602n generated from the 190-kDa antigen gene of R. rickettsii. We also used primer pairs BG1-21 and BG2-20 (BG-12) generated from the 120-kDa antigen gene of R. rickettsii (Bioprobe Systems, Montreuil-sous-Bois, France). Primer pairs BG1-21 and BG2-20 were designed by B. E. Anderson (Center for Disease Control and Prevention, Atlanta, Ga.). The nucleotide sequences of the primers are given in Table 2. Each of the 35 cycles of amplification consisted of denaturation at 95°C for 20 s, annealing at 48°C for 30 s, and sequence extension at 60°C for 2 min, according to the protocol described by Regnery et al. (26). A total of 100 ,u of the reaction mixture, which contained 10 pul of prepared sample, 59.5 pI of distilled H20, 10 pul of lOx Taq buffer (Boehringer Mannheim, Meylan, France), 10 plI of deoxynucleotide triphosphates (2% dATP, 2% dTTP, 2% dCTP, and 2% dGTP [Boehringer Mannheim]) in distilled water, 5 pul of each component of the primer pair, and 0.5 pu1 of Taq polymerase (5,000 U/ml; Boehringer Mannheim) was prepared and processed by using a thermal cycler (PREM III; Lep Scientific, Flobio, Courbevoie, France). To verify the result of the PCR amplifications, 10 plI of the amplified material was electrophoresed at 100 V in a 1% agarose gel (Sigma) for 1 h. The DNA molecular mass marker VI (mixture of fragments from the cleavage of pBR328 DNA with the restriction endonuclease BglI and pBR328 DNA with the restriction endonuclease Hinfl [Boehringer Mannheim]) was used. Aliquots of 23.3 pul of the amplified product were digested with 1 plI (10 to 20 U) of RsaI, PstI, and AluI restriction endonucleases (New England Biolabs, Beverly, Mass.) for 2 h at 37°C, and the restriction products were separated in an 8% polyacrylamide gel that was run at 100 V
The spotted fever group (SFG) rickettsiae are small, gramnegative, obligate intracellular bacteria. The SFG rickettsiae are defined by their ability to enter the nucleus (35). Over the past few years, new rickettsial species from all over the world have been identified, including Rickettsia helvetica (6, 22), Rickettsia japonica (31), and Rickettsia massiliae (7) as well as different strains with nondefined taxonomic position such as Thai tick typhus rickettsia (27), Israeli tick typhus rickettsia (17), and strains M-1 (18) and Barbash (29, 34). Similarly, known SFG rickettsial species have been isolated and identified in places where they were previously unknown, such as Rickettsia sibirica in the People's Republic of China (14), Rickettsia rhipicephali in France (12), and Rickettsia slovaca in France (5). In order to simplify the detection of rickettsia in ticks, genomic amplification by PCR has been proposed (4, 14). Regnery et al. (26) suggested a simple method for the identification of SFG rickettsiae using restriction fragment length polymorphism (RFLP) on two amplified genes. Their proposed model does not identify all isolates, and the purpose of the present work was to describe an identification model that uses one other primer pair derived from the 120-kDa outer membrane protein gene of Rickettsia rickettsii to identify the remaining isolates and thus to extend the work of Regnery et al. (26).
MATERUILS AND METHODS All species and strains of rickettsia tested in the present study and their origins are listed in Table 1. All of the rickettsiae were cultivated in Vero cell monolayers. These were infected with rickettsiae and maintained at 32°C. Cell culture medium (minimal essential medium; Seromed, Berlin, Germany) was supplemented with 4% fetal bovine sera (Seromed), L-glutamine, and bicarbonate. To prepare samples for PCR, infected and noninfected Vero cells Corresponding author. 803
804
EREMEEVA ET AL.
J. CLIN. MIC ROBIOL. TABLE 1. Species and strains of rickettsiae studied
No.
Species and strain
Source
Origin (yr of isolation)
Reference
I 2
R. akari MK (Kaplan) R. akari Toger
Human Human
United States (1946) Russia (1950)
Huebner et al. (19) None
3
R. australis Phillips
Human
Queensland, Australia (1944)
Andrew et al. (3)
4" 5
R. bellii 369L42-1 R. conorii Moroccan
Dermacentor andersoni Unknown
United States Morocco
6
R. conorii India tick typhus
Philip et al. (24) Bell and Stoenner (10) Philip et al. (23)
7
Rhipicephalus sanguineus R. conorii Kenya tick typhus Haemaphysalis leachii
8
R. conorii M-1
9
R. conorii Barbash
Kashmir, India (1950) Nairobi, Kenya (1953)
Bell and Stoenner (10) Golinevitch (18)
Note
ATCC VR-148 Obtained from N. Balayeva (Gamaleya Institute, Moscow) Obtained from G. Dasch (Naval Medical Research Institute, Bethesda, Md.) Obtained from G. Dasch ATCC VR-141 ATCC VR-597
Obtained from G. Dasch
Rhipicephalus sanguineus Unknown tick
Suchumi, Georgia (1947)
10" R. helvetica C9P9
Ixodes ricinus
Switzerland (1978)
11" R. japonica YH
Human
Japan (1985)
12 R. montana tick strain
Montana (1961)
15 R. rickettsii Sheila Smith 16 R. sibirica 232 (Nezvetaev) 17 R. sibirica 246 (K-1)
Dermacentor andersoni and Dermacentor variabilis Amblyomma maculatum Rhipicephalus sanguineus Human Human Dermacentor nuttalli
Montana (1946) Altai area, Russia (1946) Krasnojarsk, Russia (1949)
18
R. sibirica Gornyi-54/88
Dermacentor nuttalli
Altai, Russia (1988)
19 20
R. sibirica Prymorye 20/84 R. sibirica IMTO-85
Haemaphysalis concinna Prymorye region, Russia (1988) Reschetnikova" Dermacentor nuttalli People's Republic of China Fan et al. (13)
Obtained from N. Balayeva Obtained from Institute of Epidemiology and Microbiology, Bei-
21
R. slovaca 13-B
Dermacentor marginatus Slovakia (1969)
Obtained from G. Dasch
13 R. parkeri maculatum 20
14 R. rhipicephali 3-7-6
Prymorye region, Russia
Mississippi (1948) Mississippi (1973)
Obtained from N. Balayeva
Tarasevich and So- Obtained from Institute of Epidemov (29); 003 miology and Microbiology BeiWorld Health jing, People's Republic of China Organization EP5, 13 May 1970 Peter et al. (22) Obtained from W. Burdorfer (Rocky Mountain Laboratories, Hamilton, Mont.) Uchida et al. (31) Obtained from D. Walker (University of Texas, Galveston) Bell et al. (8) Obtained from D. Walker
Bell and Pickens (9) Burgdorfer et al. (11) Bell and Pickens (9) Bell et al. (8) Bell and Stoenner (10) Rudakov and
Obtained from D. Walker Obtained from G. Dasch ATCC VR-149 Obtained from G. Dasch Obtained from N. Balayeva, ATCC VR-151 Obtained from N. Balayeva
Schpanov"
jing 22" Thai tick typhus rickettsia 1T-1 18 23" R. africae ESF 2500-1 24a Israeli tick typhus rickettsia ISTIT CDC1 25a R. massiliae Mtul 26a Mtu5 isolate '
"
Ixodes and Rhipicephalus larval ticks Amblyomma variegatum Rhipicephalus sanguineus Rhipicephalus turanicus Rhipicephalus turanicus
Thailand (1962) Shulu province, Ethiopia Israel France (1990) France (1990)
Urvolgyi and Brezina (32) Robertson and Wisseman (27) Gear (15) Goldwasser et al. (17) Beati et al. (4) Beati et al. (4)
Obtained from G. Dasch, ATCC VR-599 Obtained from G. Dasch Obtained from G. Dasch
Rickettsial isolates which are not included in the current classification of rickettsiae (35). Data for strains 18 and 19 are unpublished, but information can be found at the Rickettsial Museum of Gamaleya Institute.
for 4 h, stained with ethidium bromide, and transilluminated (365 nm). DNA molecular mass marker V (plasmid pBR322 DNA digested with HaeIII [Boehringer Mannheim]) was run simultaneously with the samples to determine the molecular masses of the observed DNA fragments. The computer program QGel-1D (Quantigel Corporation, Madison, Wis.) was used to calculate the fragment sizes as a function of their relative electrophoretic mobilities.
RESULTS PCR amplification of DNA with CS pair primers from R. prowazekii. Nucleotide primers from the R. prowazekii CS gene
primed the synthesis of the 380- to 397-bp DNA fragment from all of the SFG rickettsial species studied. Four migration bands of 43, 84, 91, and 124 bp were obtained after AluI digestion. Two bands of 43 bp were demonstrated, which indicated that there were four AluI sites in the primed sequence of the genome. These digestion profiles were found for most of the SFG rickettsiae, including a number of strains of Rickettsia conorii, R. sibirica, R. helvetica, Rickettsia parkeri, and "Rickettsia africae" which were not studied previously (Fig. 1). Fragments of 180 and/or 90 bp could sometimes be amplified from noninfected Vero cells. The profiles of the investigated species Rickettsia bellii, Rickettsia australis, Rickettsia akari, R. massiliae, R. japonica,
PCR-RFLP FOR RICKETTSIAE
VOL. 32, 1994
805
TABLE 2. Oligonucleotide primers used for genotypic identification of SFG rickettsiae species and strains Primer
Species
Gene
Amplified product
Nucleotide sequence (5'-3')
BG 1-21 BG 2-20
R. rickettsii
120-kDa antigen
GGCAATTAATATCGCTGACGG GCATCTGCACTAGCACTTTC
650
Rr 190.70p Rr 190.602n
R. rickettsii
190-kDa antigen
ATGGCGAATATTTCTCCAAAA AGTGCAGCATTCGCTCCCCCT
532
RpCS.877p RpCS.1258n
R. prowazekii
Cs
GGGGGCCTGCTCACGGCGG
381
ATTGCAAAAAGTACAGTGAACA
and strain Mtu5 differed from those of the other SFG rickettsiae and from each other (Fig. 1 and 2). R. japonica, R. australis, and R. bellii had only one low-molecular-mass band of 38 to 43 bp and did not have an 84-bp band. Additional high-molecular-mass bands of 132, 129, and 131 bp were found in R. japonica, R. australis, and R. bellii, respectively. R. massiliae and strain Mtu5 each exhibited three bands of 43, 85, and 89 bp, which is in common with the SFG rickettsiae, but they also had an unique high-molecular-mass fragment of 172 bp. The differences with other SFG rickettsiae noted above were associated with the loss of one AluI restriction site. R. akari was the most different from the other species tested and had a very specific AluI digestion profile consisting of migration bands of 126, 85, 69, and 48 bp (Fig. 2). We did not observed the previously described band of 21 bp (26), probably because of its low molecular mass. Amplification and RFLP analysis with the Rr 190.70p and Rr 190.602n pair primer. The Rr 190.70p-Rr 190.602n DNA fragment was amplified from most of the species and strains studied, and these could be easily differentiated after RsaI and PstI restriction analyses (Fig. 3). Only R helvetica, R akari, R australis, and R. bellii samples were not amplified. R. sibirica K-1, Prymorye 20/84, Gornyi 54/88, and IMTO-85, which were isolated from different species of ticks in Russia and the People's Republic of China, primed the same DNA
fragment of 563 bp, which was similar to that by R. sibirica Nezvetaev, which was isolated from the blood of a patient. The amplified DNA fragments had three RsaI and four PstI restriction sites and were cleaved in fragments of 223 and 107 bp and in fragments of 273, 124, and 81 bp, respectively (Fig. 3). R conorii Moroccan had the same RsaI and PstI profiles as reported before (26). The RsaI endonuclease digested the primed DNA into fragments of 343 and 234 bp, and the PstI endonuclease digested the primed DNA into fragment of 257,
SFG
Jap
H
Mas
___-------
Ak
Aust
E
Bel
[
E H~~----------- -----H I
F85
H1-----
S 1 2 3 4 5 67
Mtu5
-----
i
8 91011 S
..- 267 | l l ,/
-~~-184 -124 - 80
--51
FIG. 1. Ethidium bromide-stained polyacrylamide gel of AluI restriction endonuclease digestion of DNA amplified by using the Rp CS.877p and Rp CS.1258n primer pair. Lane 1, R. conorii Moroccan; lane 2, R. conorii M-1; lane 3, R. conorii Barbash; lane 4, R. conorii India tick typhus; lane 5, R. conorii Kenya tick typhus; lane 6, Israeli tick typhus rickettsia; lane 7, "R. africae"; lane 8, R parkeri; lane 9, R helvetica; lane 10, R. japonica; lane 11, noninfected Vero cells; lanes S, standard DNA size marker V. Sizes are in base pairs.
397 386 FIG. 2. Schematic electrophoretic migration patterns of PCR-amplified rickettsial DNA with the Rp CS.877p and Rp CS.1258n primer pair digested with AluI restriction endonuclease. The sizes of each fragment are displayed as the number of nucleotide base pairs. Doublet bands are indicated with an asterisk. Comigrating fragments are connected by dashed lines. Several SFG rickettsiae had identical fragment patterns (grouped together under SFG): R conorii (Con) strains including strain Moroccan (Mor); strain M-1 (M-1), strain Barbash (Barb), strain India tick typhus (Ind), strain Kenya tick typhus (Ken); R sibirica (Sib) strains including strain Nezvetaev, strain K-1, strain IMTO-85, strain Prymorye 20/84, strain Gornyi 54/88; Israeli tick typhus rickettsia (Isr); "R africae" (Afr); R. rhipicephali (Rhipi); R. parkeri (Park); R. montana (Mon); R. rickettsii (Rick); R slovaca (Slo); Thai tick typhus rickettsiae (Ttt); and R. helvetica (Hel). Japn, R japonica; Mas, R massiliae, Mtu5, new isolate from Rhipicephalus turanicus; Aust, R. australis; Ak, R akari strains including strain MK and strain Toger; Bel, R bellii. The 21-bp band was added to R. akari 385
390
389
389
profile as described previously (26).
381
806
EREMEEVA ET AL. Sib
Park
Isr
Afr
Mor
Ind
Ken
A
~
J. CLIN. MICROBIOL. M 1 Barb
Jap
Mas
Rick
Slo
Ttt
Rhi
Non
MtuS
Fmenl
Ii [I ~~~~~~~~~~~~~~~~~ H
H H
E
E~~~~E~
[
H
~~~~~~~~~~------------__
H
1111----------------------------553 Sib
1E
-----
563
578
563
577
592
592
411
560
553
546
Park
Isr
Afr
Nor
Ind
Ken
M 1 Barb
Jap
Nas
Mtu5
553
Rick
534
Slo
543
Ttt
566
Rhi
Mon
539
540
B
H H1EH H [E E E ~~~~--------1~~~~~~ HH
E H H
[E
H
H
E [31 559
559
553
[E -----------
553
548
558
----
------
~~~~~~~~~-----------------
]-------------------
558
413
559
558
566
551
554
550
FIG. 3. Schematic electrophoretic migration patterns of PCR-amplified rickettsial DNA with the Rr 190.70p and Rr 190.602n primer pair digested with RsaI (A) and PstI (B) restriction endonucleases. Abbreviations are described in the legend to Fig. 2.
210, and 81 bp (Fig. 3 and 4). Subtle differences between the strains Moroccan (Fig. 4, lane 1), India (Fig. 4, lane 2), and Kenya (Fig. 4, lane 3) were noted after RsaI and PstI digestions. These strains produced very similar profiles but had specific digestion profiles different from those of other species. R. conorii M-1 and the Barbash strain were found to be identical but different from R conorii Moroccan and from other species of the SFG rickettsiae (Fig. 3 and Fig. 4, lanes 4 and lane 5). The primed DNA fragments obtained from the
M-1 and Barbash strains were 411 to 413 bp, whereas they were 548 to 592 bp for all of the other SFG rickettsiae; the PstI and RsaI digestion profiles of the M-1 and Barbash strains also differed from those of the other strains. Israeli tick typhus rickettsia (Fig. 4, lane 7) and "R africae" (Fig. 4, lane 6) were shown to be different only from R. conorii after PstI digestion. Fragments of R. conorii, Israeli tick typhus rickettsia, and "R. africae" did not differ in size by more than 5% by using the RsaI restriction endonuclease. R. parkeri-
807
FOR RICKETTFSIAE VOL. 1994 ~~~~~~~~~~~PCR-RFLP VOL. 1994 32,32,
A S 1 2 3 4 5 6 7 8 9 10OS
Si1 23 4 5S 6 7 8910 S
--587 --434
-1033 -- 653 - 394 - 234
---267 -184 --
80 51
C B FIG. 4. Differentiation by PCR-RFLP of SFG rickettsia strains amplified with the Rr 190.70p-Rr 190.602n primer pair. (A) PCR amplification patterns analyzed by 1% agarose gel electrophoresis. (B) Ethidium bromide-stained 8% polyacrylamide gel of Rsal restriction endonuclease digestion of amplified rickettsial DNA. (C) Ethidium bromide-stained 8% polyacrylamide gel of Pstl restriction endonuclease digestion of amplified rickettsial DNA. Lanes 1, R. conorii Moroccan; lanes 2, R. conorii India tick typhus; lanes 3, R. conorii Kenya tick typhus; lanes 4, R. conorii M-1; lanes 5, R. conorii Barbash; lanes 6, "R. africae"; lanes 7, Israeli tick typhus rickettsia; lanes 8, R. parkeri; lanes 9, R. japonica; lanes 10, noninfected Vero cells; lanes S, standard DNA size marker VI (for panel A) and marker V (for panels B and C). Sizes are in base pairs.
primed DNA fragments after digestion with the Rsal and Pstl restriction endonucleases (Fig. 4, lane 8) produced patterns identical to those of "R. africae". Restriction DNA fragments primed from R. japonica and R. massiliae confirmed that they belong to SFG rickettsiae and separated them from each other. R. japonica was recognized by the absence of the Rsal restrictioni site in the 560-bp amplified DNA fragment, which was digested with Pstl and produced three bands (Fig. 4, lane 9). Amplified DNA fragments from R. massiliae and the Mtu5 strain were digested with Rsal to three bands which were very similar in size: 99, 1 11, and 116 bp. The RFLP pattern of R. massiliae with Pstl was similar to those of Thai tick typhus rickettsiae, R. rickettsii, and R. conorii, and the RFLP pattern of the Mtu5 isolate was similar to that of R.
rhipicephali (Fig. 3).
S 1 2934 S~5
7R8S 910111213145
Amplification with the primer pair derived from 120-kDa protein gene of R. rickettsii. To differentiate SFG rickettsiae which were not identified by using PCR-RFLP analysis with the primer pairs described above, we amplified rickettsiae with the primer pair which was obtained from the 120-kDa protein
gene of R. rickettsii. Results of the PCR-RFLP are shown in Fig. 5 and 6. The DNA fragment primed with this primer pair was 650 bp. As a result of Rsal digestion, the BG-12-primed DNA product of R. rickettsii was restricted to five fragments of 182, 163, 162, 91, and 81 bp (Fig. 5, lane 6). Only R. slovaca (Fig. 5, lane 9) had a pattern similar to that of R. rickettsii, but with a single 160-bp band instead of both 163- and 162-bp bands, as shown for R. rickettsii. Other SFG rickettsiae had three bands in common with R. rickettsii: 156 to 165, 98 to 105, and 79 to 88 bp.
5 1516175S
18195S20215S 225S
-434 -267 -184 -124 - 80 - 51
FIG. 5. Differentiation of SFG rickettsiae on DNA fragments amplified with the BG-12 primer pair following Rsal restriction endonuclease digestion. Lane 1, R. australis; lane 2, R. japonica; lane 3, R. montana; lane 4, R. rhipicephali; lane 5, R. parkeri; lane 6, R. rickettsii; lane 7, strain Mtu5; lane 8, Thai tick typhus rickettsia; lane 9, R. slovaca; lane 10, R. sibirica K-i; lane 1 1, R. sibirica Nezvetaev; lane 12, R. sibirica IMTO-85; lane 13, R. sibirica Prymorye 20/84; 14, R. sibirica Gornyi 54/88; lane 15, "R. africae"; lane 16, Israel tick typhus rickettsia; lane 17, R. conorii Moroccan; lane 18, R. conorii India tick typhus; lane 19, R. conorii Kenya tick typhus; lane 20, R. conorii Barbash; lane 21, R. conorii M-1; lane 22, noninfected Vero cells; lanes 5, standard DNA size marker V. Sizes are in base pairs.
808
J. CLIN. MICROBIOL.
EREMEEVA ET AL. Mon
Aust
Rick
[
Rhipi MtuS
----
Sib
Slo
Ttt
-------------
~
~
~
Afr
~
~
Park
--
--
Isr
-
--
--
Con
_
_
_
Jap
_
-
filJ
_____
[--L ----------------------
Eli
-----------
E
E
E-----------------------
-----------E [
E
FIG. 6. Schematic electrophoresis migration patterns of PCR-amplified rickettsial DNA with the BG 1-21 and BG 2-20 primer pair digested with RsaI restriction endonuclease. The abbreviations are described in the legend to Fig. 2.
BG-12 primers also produced a specific DNA fragment for R. australis (Fig. 5, lane 1), Rickettsia montana (Fig. 5, lane 3), R. japonica (Fig. 5, lane 2), R. sibirica (Fig. 5, lanes 10 to 14), R. conorii (Fig. 5, lanes 17 to 21), and Thai tick typhus rickettsia (Fig. 5, lane 8). This primer pair allowed a distinction to be made between Israeli tick typhus rickettsia (Fig. 5, lane 16), which had RsaI digestion patterns with bands at 163, 135, 119, 103, and 60 to 61 bp, which is identical to the patterns for R. conorii strains, and "R. africae" (Fig. 5, lane 15), which had five patterns of 165, 133, 102, 88, and 60 bp that were identical to the patterns of R. parkeri (Fig. 5, lane 5) and R. sibirica. It is necessary to emphasize that at times the total length of digested DNAs was less than the length of the amplified DNA fragment, showing that some patterns could be repeated. However, the number of comigrating bands could be determined only after DNA sequences of the fragment were amplified. R. akari, R. belli, R. helvetica, and R. massiliae were not amplified with the BG-12 primer pair. DISCUSSION PCR-RFLP analysis is a rapid method for the identification and classification of bacteria. Studies on rickettsia were begun by Regnery et al. (26), who found that the 190-kDa antigen gene-derived pair primer amplified a part of the rickettsial genome which has a high degree of species specificity among the rickettsiae and a CS pair primer generated from the CS gene of R prowazekii, which provides group specificity. In addition to the findings described by Regnery et al. (26) showing the specific AluI digestion profiles of the CS-primed DNA fragments in R. akari, R. australis, and R. belli, we found a specific profile for R. massiliae and the Mtu5 isolate and a
profile for R. japonica which was similar to that for R. australis. It was not possible to differentiate between the other species and strains of SFG rickettsiae. The similarities of these fragments in different species can be explained by the conservation of that part of the genome which is responsible for the synthesis of a main metabolic rickettsial enzyme, CS (35, 36). Amplification of 90- to 180-bp fragments from noninfected Vero cells shows that these cells, originated from African green monkey kidney cells, may have some common sequence with the rickettsial CS gene, as was previously found for an identical enzyme from a pig heart (36). In contrast to the CS primer pair, the primers derived from the 5'-end nucleotide sequences of the 190-kDa antigen and the 120-kDa antigen gene of R. rickettsii gave DNA fragments with specific nucleotide sequences for the different species and isolates. As a result, it was possible to identify almost all of the SFG rickettsiae studied. Only R. akari, R. bellii, and R. helvetica were not amplified with primers from the R. rickettsii surface protein antigen gene. R. australis could be differentiated only after amplification with the BG-12 pair primer. The absence of DNA amplification for R. helvetica, R. akari, R. bellii, and R. australis with the primer pair of the R. rickettsii genome shows the genetic differences between these rickettsial species. In addition to the strains mentioned above, R. helvetica, R. akari, and R. australis were found to have protein profiles widely different from those of the other species of SFG rickettsiae (6, 13, 22). R. sibirica isolates obtained from different ticks and in different parts of the north Asian tick typhus area had very strong similarities with the strain Nezvetaev isolated from the blood of a patient. This method differentiated R. sibirica and R. slovaca. R. slovaca was similar to R. rickettsii, but it could be
VOL. 32, 1994
PCR-RFLP FOR RICKETTSIAE
809
New rickettsia
isolate
Rp
-
-
-
PCR/RFLP CS.877-1258 pn with Alul
R. akari R. australis, R. japonica R. belli R. massiliae, Mtu5 SFG
PCR/RFLP Rr 190.70-602 pn with Rsa I -
-
Thai tick typhus rickettsia R. rhipicephali
-
Ml, Barbash strains R. japonica R. massiliae, Mtu5 R. conorii, Israeli
-
tick typhus rickettsia, R.africae, R. parkeri R. rickettsii,
-
R. slovaca R. montana
-
PCR/RFLP Rr 190.70-602 pn with Pst I
PCR/RFLP BG1-21 and BG2-20 with RsaI
R. japonica R. slovaca Ml, Barbash strains R. conorii R. rickettsii
Thai tick typhus rickettsia R. massiliae R. montana R. sibirica, Israeli tick typhus rickettsia, R africae, R. parkeri R. rhipicephali, Mtu5
-
-
-
-
-
rickettsii slovaca australis montana Thai tick typhus rickettsia R. japonica R. rhipicephali, Mtu5 R. conorii, Israeli tick typhus rickettsia R. sibirica, R. parkeri, R. africae R. R. R. R.
.
FIG. 7. Specific identification of SFG rickettsiae and serotypes by PCR-RFLP analysis. Each column represents the amplification and digestion needed for definite identification.
differentiated from R. rickettsii after digestion with RsaI restriction endonuclease of the Rr 190.70p-Rr 190.602n pair primer or of the BG-12 pair primer-amplified DNA product. Comparison of the DNA patterns of the so-called R. conorii complex amplified from the 190- and 120-kDa antigen genes could be used to distinguish between the strains. In our studies, we noted that it was possible to distinguish strains India and Kenya. The standard Moroccan strain had subtle differences from the India and Kenya strains; these were the lengths of the amplified DNA fragments and comigrating digested DNA fragments. Israeli tick typhus rickettsia and "R africae" differed from the strains mentioned above and were similar to each other after PstI and RsaI restriction of the DNA fragment primed from the 190-kDa antigen gene. RsaI restriction of the BG-12-primed DNA patterns was useful for distinguishing Israeli tick typhus rickettsia and "R. africae" from each other. Throughout the study, R conorii M-1 (18), isolated in the Black Sea region (Suchumy, Georgia), differed widely from the other strains. Unexpectedly, the Barbash strain isolated in the Prymorye region of Russia appeared to be similar to strain M-1. Initially, the Barbash strain was identified as R. sibirica and was used as a standard for serotyping (29). Recently, the Barbash strain was reexamined and was found to be a strain of R. conorii (34). Similarity between the M-1 and Barbash strains and their differences from all of the other R. conorii strains in the lengths of their amplified DNA fragments may be a result of a deletion or insertion of sequences in this part of the rickettsial genome. The M-1 and Barbash strains were both isolated from ticks and occur in areas that are climatically similar to areas where R. conorii is found. They represent new genotypes of the SFG rickettsiae but are phenotypically and antigenically closely related to R. conorii. Our data concerning the heterogeneity of the strains of R. conorii agree with numerous data on the antigenic variability of R. conorii strains isolated from different regions (21, 30, 33). Our identification system did not make it possible to differentiate R parkeri from "R. africae", both of which were isolated from Amblyomma ticks. R. parkeri and "R. africae" share common sequences in the CS gene and in the 190- and 120-kDa antigen genes, but they were found to have quite different chromosomal DNA
restriction profiles by pulsed-field gel electrophoresis (28). Goldwasser et al. (17) determined that the Israeli tick typhus rickettsia has an unique serotype. Kelly et al. (20, 21) noted that recently isolated SFG rickettsiae from ticks in Zimbabwe were different from the R. conorii Simko strain (21) but identical to "R. africae" (20). In Sicily, at least two new subtypes of SFG rickettsiae which differed from the R. conorii Moroccan strain were found (30). The antigenic diversity of R. conorii (Moroccan, M-1, Simko, India tick typhus, Kenya tick typhus, and Malish 7) have been shown previously (33). Data concerning the differences between other species of SFG rickettsiae agreed with the results of microimmunofluorescence (25) and toxin neutralization (10) tests in mice. It is not surprising that different methods of identification gave similar results, because these identification methods are based on analysis of the major surface proteins of the rickettsiae. R. rickettsii possesses two dominant surface proteins with molecular masses of 190 and 120 kDa (1, 2). These two proteins and their analogous proteins in other SFG rickettsiae determine the protective immune response, and their antigenic properties are used to classify SFG rickettsiae. The 190-kDa protein gene contains a fragment of tandemly repeated sequences, which have polymorphisms between species of the SFG rickettsiae and even strains of R. rickettsii (16). This is analogous to the situation in R. conorii, in which we found two different genotype strains (strains Moroccan and M-1) with a common
serotype.
Our data allow us to propose an algorithm of identification for all SFG rickettsiae (Fig. 7) by using three amplifications and three enzyme digestions. Because of the increasing interest in studying the geographical distributions of SFG rickettsiae in ticks worldwide (4, 5, 12, 14), we believe that this simplified procedure will help in the identification of series of samples of new rickettsial isolate. ACKNOWLEDGMENTS grateful to N. M. Balayeva for constructive discussions and L. Matthewman for reviewing the manuscript. We especially thank L. Beati, M. Drancourt, H. Tissot Dupont, and G. Vestris for technical help and I. Domingo and V. Pinero for secretarial assistance. We
are
810
EREMEEVA ET AL.
M. Eremeeva received financial support from Assistance Publique de Marseille, X. Yu received financial support from Assistance Publique de Marseille and a grant from region PACA.
REFERENCES 1. Anacker, R. L., R. H. List, R. E. Mann, and D. L. Wiedbrank. 1986. Antigenic heterogeneity in high- and low-virulence strains of Rickettsia rickettsii. Infect. Immun. 51:653-660. 2. Anacker, R. L., R. E. Mann, and C. Gonzales. 1987. Reactivity of monoclonal antibodies of Rickettsia rickettsii with spotted fever and typhus group rickettsiae. J. Clin. Microbiol. 25:167-171., 3. Andrew, R., J. M. Bonnin, and S. Williams. 1946. Tick typhus in north Queensland. Med. J. Aust. 2:253. 4. Beati, L., J. P. Finidori, B. Gilot, and D. Raoult. 1992. Comparison of serologic typing, sodium dodecyl sulfate-polyacrylamide gel electrophoresis protein analysis, and genetic restriction fragment length polymorphism analysis for identification of rickettsiae: characterization of two new rickettsial strains. J. Clin. Microbiol. 30:1922-1930. 5. Beati, L., J. P. Finidori, and D. Raoult. 1993. First isolation of Rickettsia slovaca from Dermacentor marginatus in France. Am. J. Trop. Med. Hyg. 48:257-268. 6. Beati, L., 0. Peter, W. Burgdorfer, A. Aeschlimann, and D. Raoult. 1993. Confirmation that Rickettsia helvetica sp. nov. is a distinct species of the spotted fever group of rickettsiae. Int. J. Syst. Bacteriol. 43:521-526. 7. Beati, L., and D. Raoult. 1993. Rickettsia massiliae sp. nov. A new spotted fever group rickettsia. Int. J. Syst. Bacteriol. 43:839-840. 8. Bell, E. J., G. M. Kohls, H. G. Stoenner, and D. B. Lackman. 1963. Nonpathogenic rickettsias related to the spotted fever group isolated from ticks, Dermacentor variabilis and Dermacentor andersoni from Eastern Montana. J. Immunol. 90:770-781. 9. Bell, E. J., and E. G. Pickens. 1953. A toxic substance associated with the rickettsias of the SFG. J. Immunol. 70:461. 10. Bell, E. J., and H. G. Stoenner. 1960. Immunologic relationships among the spotted fever group of rickettsias determined by toxin neutralisation tests in mice with convalescent animal serums. J. Immunol. 84:171-182. 11. Burgdorfer, W., D. J. Sexton, R. K. Gerloff, R. L. Anacker, R. N. Philip, and L. A. Thomas. 1975. Rhipicephalus sanguineus: vector of a new spotted fever group rickettsia in the United States. Infect. Immun. 12:205-210. 12. Drancourt, M., R. L. Regnery, and D. Raoult. 1991. Identification of tick-isolates by centrifugation-shell vial assay followed by polymerase chain reaction and restriction endonuclease length polymorphism analysis, p. 232-238. In J. Kazar and D. Raoult (ed.), Rickettsiae and rickettsial diseases. Publishing House of the Slovak Academy of Sciences, Bratislava, Slovakia. 13. Fan, M. Y., X. J. Yu, and D. H. Walker. 1988. Antigenic analysis of Chinese strains of spotted fever group rickettsiae by protein immunoblotting. Am. J. Trop. Med. Hyg. 39:497-501. 14. Gage, K. L., R. D. Gilmore, R. H. Kartens, and T. G. Schwan. 1992. Detection of Rickettsia rickettsii in saliva, hemolymph and triturated tissues of infected Dermacentor andersoni ticks by polymerase chain reaction. Mol. Cell. Probes 6:333-341. 15. Gear, J. H. S. 1988. Other spotted fever group rickettsioses: clinical signs, symptoms, and pathophysiology, p. 101-104. In D. H. Walker (ed.), Biology of rickettsial disease, vol. 1. CRC Press, Inc., Boca Raton, Fla. 16. Gilmore, R. D., and T. Hackstadt. 1991. DNA polymorphism in the conserved 190 kDa antigen gene repeat region among spotted fever group Rickettsiae. Biochim. Biophys. Acta 1097:77-80. 17. Goldwasser, R. A., Y. Steiman, W. Klingberg, T. A. Swartz, and M. A. Klingberg. 1974. The isolation of strains of rickettsiae of the spotted fever group in Israel and their differentiation from other members of the group by immunofluorescence methods. Scand. J. Infect. Dis. 6:53-62. 18. Golinevitch, H. 1960. A propos de la differenciation de quelques rickettsies du groupe de la fievre pourpr6e a tiques. Arch. Inst. Pasteur Tunis 37:13-22.
J. CLIN. MICROBIOL.
19. Huebner, R. J., P. Stamps, and C. Armstrong. 1946. Rickettsialpox-a newly recognized rickettsial disease. Public Health Rep. 61:1605. 20. Kelly, P. J., L. Beati, P. Mason, R. Makombe, L. Matthewman, D. Raoult, and M. Dreary. 1992. African tick-bite fever-a new spotted fever group rickettsiosis under an old name. Lancet 340:982-983. 21. Kelly, P. J., and P. R. Mason. 1990. Serological typing of spotted fever group rickettsia isolates from Zimbabwe. J. Clin. Microbiol. 28:2302-2304. 22. Peter, O., J. C. Williams, and W. Burgdorfer. 1985. Rickettsia helvetica, a new spotted fever group rickettsiae: immunochemical analysis of the antigens of 5 spotted fever group rickettsiae, p. 99-108. In J. Kazar (ed.), Rickettsiae and rickettsial diseases. Proceedings of the Third International Symposium, 1984, Slovak Academy of Sciences, Bratislava, Slovakia. 23. Philip, C. B., L. E. Hughes, K. N. A. Rao, and S. L. Kalra. 1950. Studies on Indian tick typhus and its relation to other human typhus-like rickettiosis, p. 571. 5th International Congress of Microbiology Rio de Janeiro, Brazil. 24. Philip, R. N., E. A. Casper, R. L. Anacker, J. Cory, S. F. Hayes, W. Burgdorfer, and E. Yunker. 1983. Rickettsia bellii sp. nov.: a tick-borne rickettsia, widely distributed in the United States, that is distinct from the spotted fever and typhus biogroups. Int. J. Syst. Bacteriol. 33:94-106. 25. Philip, R. N., E. A. Casper, W. Burgdorfer, R. K. Gerloff, L. E. Hugues, and E. J. Bell. 1978. Serologic typing of Rickettsiae of the spotted fever group by microimmunofluorescence. J. Immunol. 121:1961-1968. 26. Regnery, R. L., C. L. Spruill, and B. D. Plikaytis. 1991. Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. J. Bacteriol. 173:1576-1589. 27. Robertson, R. G., and C. L. Wisseman, Jr. 1973. Tick-borne rickettsiae of the spotted fever group in west Pakistan. II. Serological classification of isolates from west Pakistan and Thailand: evidence for two new species. Am. J. Epidemiol. 97:55-64. 28. Roux, V., and D. Raoult. 1993. Genotypic identification and phylogenetic analysis of the spotted fever group rickettsiae using pulsed-field gel electrophoresis. J. Bacteriol. 175:4895-4904. 29. Tarasevich, I. V., and G. P. Somov. 1966. Comparative serological study of tick-borne typhus of northern Asia and tsutsugamushi fever. J. Microbiol. Epidemiol. Immunol. 1:83-86. (In Russian.) 30. Tringali, G., R. Regnery, A. Sferlazzo, V. Intonazzo, C. Spruill, A. M. Perna, and G. La Rosa. 1989. Epidemiology of boutonneuse fever in western Sicily: demonstration of multiple spotted fever group-rickettsiae subtypes. Microbiologica 12:189-194. 31. Uchida, T., T. Uchiyama, K. Kumano, and D. H. Walker. 1992. Rickettsia japonica sp. nov., the etiological agent of spotted fever group rickettsiosis in Japan. Int. J. Syst. Bacteriol. 42:303-305. 32. Urvolgyi, J., and R. Brezina. 1978. Rickettsia slovaca: a new number of spotted fever group rickettsiae, p. 299-305. In J. Kazar, R. A. Ormsbee, and I. V. Tarasevich (ed.), Rickettsiae and rickettsial diseases. Proceedings of the Second International Symposium, 1976, Slovak Academy of Sciences. Slovak Academy of Sciences, Bratislava, Slovakia. 33. Walker, D. H., Q. H. Liu, X. J. Yu, H. Li, C. Taylor, and H. M. Feng. 1992. Antigenic diversity of Rickettsia conorii. Am. J. Trop. Med. Hyg. 47:78-86. 34. Wang, J. G., D. D. Walker, H. Li, B. Lenz, and T. R. Jerrells. 1987. Barbash strain spotted fever group rickettsia is a strain of Rickettsia conorii and differs from Rickettsia sibirica. Acta Virol. (Praha) 31:489-498. 35. Weiss, E., and J. W. Moulder. 1984. Order I. Rickettsiales, Gieszczkiewicz 1939, p. 687-701. In N. R. Kreig and J. G. Holt (ed.), Bergey's manual of systematic bacteriology, vol. 1. The Williams & Wilkins, Co., Baltimore. 36. Wood, D. O., L. R. Williamson, H. H. Winkler, and D. C. Krause. 1987. Nucleotide sequence of the Rickettsia prowazekii citrate synthase gene. J. Bacteriol. 169:3564-3572.
