revealed by MC.34(D2S63). O.Seminol, A.Torroni1, L.Ferretti2 and A.S.Santachiara. Benerecettil, 3, *. 1Dipartimento di Genetica e Microbiologia, Universita' di.
Nucleic Acids Research, Vol. 19, No. 22 6345
Dinucleotide repeat polymorphism at the human ,B1 subunit of the GABAA receptor gene (GABRB1) M.H.Polymeropoulos, D.S.Rath, H.Xiao and C.R.Merril National Institute of Mental Health Neuroscience Center, St Elizabeths Hospital, Room 131, 2700 Martin Luther King Avenue, Washington, DC 20032, USA
Source/Description: The polymorphic (AC)n repeat begins at base pair 420 of the human gene for the 31 subunit of the GABAA receptor on chromosome 4pl2-pl3 (1). The polymorphism can be typed using the polymerase chain reaction (PCR) as described previously (2). The predicted length of the amplified sequence was 98 bp. Primer Sequences: CGTAAGCGTGCACTATACCCT (AC strand); CTGAGGATTCATCCACCTG (TG strand). Frequency: Estimated from 78 chromosomes of unrelated individuals. Heterozygosity Index = 72%. PIC = 0.68. Allele (bp) Frequency Bi 99 0.10 B2 97 0.21 B3 95 0.44 B4 93 0.18 B5 91 0.06 Mendelian Inheritance: Co-dominant segregation was observed in two informative families. Chromosomal Localization: GABRB1 has been assigned to chromosome 4pl2-pl3 (1). Other Comments: The PCR reaction was performed on 80 ng of genomic DNA using 100 pmoles of each oligonucleotide primer. The samples were processed as described (3) except that the denaturation cycle at 94°C was extended to 1.4 minutes. The dinucleotide repeat was based on a (AC)19 sequence. References: 1) Kirkness,E.F. et al. (1991) Genomics 10, 985-995. 2) Weber,J.L. and May,P.E. (1989) Am. J. Hum. Genet. 44, 388-396. 3) Weber,J.L. et al. (1990) Nucl. Acids Res. 18, 4637.
Two additional Mspl RFLPs revealed by MC.34 (D2S63) O.Seminol, A.Torroni1, L.Ferretti2 and A.S.Santachiara Benerecettil, 3,
*
1Dipartimento di Genetica e Microbiologia, Universita' di Pavia, Via Abbiategrasso, 207, 27100 Pavia; 21.D.V.G.A., C.N.R. Milano and 3Dipartimento di Biologia Cellulare, Universita' della Calabria, Italy
Description, Source and method: The MC.34 is a 6.2 kb EcoRI fragment isolated from a library of a sorted human minichromosome (1) and subcloned in pUC19. Preliminary observations indicated that this fragment revealed two RFLPs when probed BamHI and MspI DNA digests (2). The MspI electrophoretic pattern was characterized by two allelic bands (of about 2.1 and 1.8 kb) and by three constant bands of about 2.3, 1.5 and 1.0 kb. A more extended population survey has revealed that both the 2.3 and 1.5 kb bands also had alternative forms. Thus, in the MspI digests the MC.34 probe identifies three polymorphic sites: site MA and Mc producing alternative fragments to the 2.3 and 1.5 kb bands and site MB causing the previously reported polymorphism (2). Polymorphisms: Studied in 50 unrelated Italians mainly from Northern Italy Site Alleles Size (kb) Frequency 2.3 MspI-A 0.78 MA. 1 1.6 + 0.7 0.22 MA.2 MspI-C 1.6 0.23 Mc. 1 1.5 0.77 Mc.2 Other Enzymes Tested and Negative: TaqI, BglII, Haell and Hincd (2). Chromosomal Localisation: MC.34 was localised at 2q1.2- 1.4 by in situ hybridization (2). Mendelian Inheritance: Codominant inheritance of RFLPs was observed in four informative families with 23 children. Probe Availability: Contact L.F. Other Comments: These two RFLPs can be studied separately by the two Haefl subfragments of the probe. 33 individuals were informative for the haplotype identification. Among these 66 haplotypes only the associations MAl-MC2 and MA2- MCI were found with the exception of one MA-MCI haplotype. The previously reported Italian sample (2) must be considered not classified for MspI A and C RFLPs. Acknowledgements: This work was supported by the C.N.R. Target Project on Biotechnology and Bioinstrumentation and by P.F. Ingegneria Genetica C.N.R. References: 1) Ferretti,L. et al. (1987) Cytotechnology 1, 712. 2) Torroni,A. et al. (1988) N.A.R. 16, 9061.
*
To whom
correspondence should be addressed