Brief Communications
CELLULAR REPROGRAMMING Volume 14, Number 2, 2012 ª Mary Ann Liebert, Inc. DOI: 10.1089/cell.2011.0074
Direct Conversion of Porcine Embryonic Fibroblasts into Adipocytes by Chemical Molecules Jianguo Zhu,* Daxin Pang,* Yang Zhou,* Xiaochun Tang, Yongye Huang, Wanhua Xie, Fei Gao, Liangxue Lai, Mingjun Zhang, and Hongsheng Ouyang
Abstract
Direct reprogramming of terminally differentiated cells to specify different cell types may allow somatic cells to be reprogrammed to an alternative, differentiated fate without intervening stem or progenitor cells. Recent studies have shown that the conversion of fibroblasts to other cell lines can be accomplished by the introduction of master regulator transcription factors. These findings have raised the question as to whether chemical molecules could replace transcription factor cocktails to directly alter defined somatic cell fate. Here, we demonstrate the generation of adipocytes directly from porcine embryonic fibroblasts (PEFs) using defined chemical molecules. Treatment with SB431542 and Thiazovivin, which are transforming growth factor-beta (TGF-b) and ROCK signaling pathway inhibitors, respectively, allowed PEFs to directly convert to fat-laden adipocytes. These induced adipocytes expressed multiple fat marker genes. We believe that these findings demonstrate that committed adipocytes can be directly reprogrammed from differentiated somatic cells using defined chemical molecules. The generation of adipocytes from nonadipogenic lineages has important implications for studies of adipogenesis, obesity modeling, and regenerative medicine. Additionally, these findings may enlighten a new method that direct reprogramming committed cell lines to other somatic cells using defined chemical molecules.
Ascl1, Brn2, and Myt1l (Vierbuchen, et al., 2010), and the direct conversion of fibroblasts into functional cardiomyocytes using a combination of the developmental transcription factors Gata4, Mef2c, and Tbx5 (Ieda et al., 2010). The usage of small chemical molecules, which can replace transgenes for induction to ensure the utility of the resulting iPSCs, has not been reported in lineage conversion. Obesity is an epidemic that has become a major problem throughout the world in recent years (Roth et al., 2004). Adipose tissue is an important metabolic organ that is crucial for whole-body insulin sensitivity and energy homeostasis (Rosen and Spiegelman, 2006). Adipogenesis or adipocyte hyperplasia occurs throughout life in response to caloric intake that exceeds nutritional requirements (Prins and O’Rahilly, 1997). Being overweight or obese is associated with major health risks, such as cardiovascular disease, diabetes, nonalcoholic fatty liver disease, and cancer (Prins and O’Rahilly, 1997). Additionally, cachexia, a complex metabolic syndrome, results from the severe wasting of both fat and fat-free mass in certain disease states, such as cancer and
Introduction
R
ecent work shows that lineage-specific transcription factors are sufficient to reprogram fully differentiated cells into either induced pluripotent stem cells (iPSCs) or other types of cells. These findings have demonstrated that a transcription factor cocktail can direct dramatic cell fate changes in committed somatic cells. The iPSCs first generated by Yamanaka and colleagues (Takahashi and Yamanaka, 2006) initiated a revolutionary era in cell-based therapies. Given the formation of tumors and the difficulty in the generation of sufficient and pure iPSC-derived functional somatic cells, lineage conversion has become a competitive strategy for generating the desired types of cells. This strategy was first applied in the direct conversion of fibroblasts to skeletal muscle via the ectopic expression of MyoD (Davis et al., 1987). Subsequent examples included the induction of macrophagelike cells via the coexpression of PU.1 and C/EBPa in fibroblasts (Feng et al., 2008), the conversion of fibroblasts into functional neurons by delivering the transcription factors
Jilin Provincial Key Laboratory of Animal Embryo Engineering, College of Animal Science and Veterinary Medicine, Jilin University, Changchun, Jilin 130062, People’s Republic of China. *These authors contributed equally to this work.
99
100 immunodeficiency diseases. The conversion of adipocytes is therefore of great significance for studies on the mechanism of adipogenesis, the prevention of some fat-related diseases, and therapies for cachexia-accompanied diseases. Some signaling pathways have been studied that play a vital role in regulating adipogenesis. Transforming growth factor-beta (TGF-b) regulates the differentiation program of a variety of cell types, including myoblasts, chondrocytes, osteoblasts, and adipocytes (Ballock et al., 1993; Choy et al., 2000; Janssens et al., 2005; Massague et al., 1986). TGF-b can inhibit the adipose differentiation of some preadipocyte cell lines (Ignotz and Massague, 1985; Petruschke et al., 1994), retain undifferentiated preadipocyte states (Ignotz and Massague, 1985; Sparks et al., 1992), reverse the adipocyte phenotype of some maturate adipocytes (Torti et al., 1989), and reduce the expression of differentiation markers of adipocytes (Petruschke et al., 1994). In TGF-b1 transgenic mice, both white and brown adipose tissue masses were reduced, and adipocyte differentiation was inhibited (Clouthier et al., 1997). Apart from TGF-b, Rho-associated kinase (ROCK) is also involved in adipogenesis. During adipogenesis, the actin cytoskeleton regulates the cell morphology of fibroblastic cells to round and fat-laden cells ( Jaffe and Hall, 2005). ROCK regulates the reorganization of the actin cytoskeleton and cytoskeletal tension, and the inhibition of ROCK enhances adipogenesis (Noguchi et al., 2007). In this study, we treated PEFs with the TGF-b signaling pathway inhibitor SB431542 and the ROCK signaling pathway inhibitor Thiazovivin to induce adipocytes. The induced adipocytes showed large lipid drops and the expression of the multiple fat marker genes. Moreover, we excluded the possibility that the induced adipocytes originated from meschenchemal stem cell (MSC) or progenitor cells and confirmed that the conversion occurred directly from the porcine embryonic fibroblasts (PEFs), without initial reversion to the pluripotent state. Our finding provides a new method for adipocyte differentiation that may result from adipogenesis. Importantly, our chemical molecule cocktail may serve as a new method with great potential for generating converted cell lines for regenerative therapies. Materials and Methods Ethics statement Animal experiments were done in accordance with the guidelines on animal care and use established by the Jilin University Animal Care and Use Committee. Cell culture The PEFs were isolated from the 35-day-old fetuses of a 10week-old Chinese miniature pig. After removing the head, tail, limbs, skeleton, and all internal organs, the fetuses were minced into pieces (1 mm3) and digested by Collagenase IV (Invitrogen, Carlsbad, CA) at 39C for 4 h. Next, the cells were washed and seeded with 15 mL DMEM containing 15% fetal bovine serum (FBS) in 100-mm dishes. The culture medium for the fibroblasts was composed of DMEM supplemented with 10% FBS, 0.1 mM nonessential amino acids, 0.055 mM 2mercaptoethanol, and 2 mM L-glutamine (Invitrogen). During induction, the PEFs were seeded at a density of 106 cells per dish in 60-mm dishes and were maintained in both chemical
ZHU ET AL. and hormonal induction medium at 39C and 5% CO2. The chemical induction medium contained DMEM/F12 (Invitrogen), 15% Knockout Serum Replacement (Invitrogen), 0.1 mM nonessential amino acids (Invitrogen), 0.055 mM 2-mercaptoethanol (Invitrogen), 2 mM L-glutamine (Invitrogen), 2 lM Thiazovivin (Stemgent, San Diego, CA), and 0.5 lM SB431542 (Stemgent). The hormonal induction medium contained DMEM (Invitrogen), 15% FBS (Invitrogen), 0.1 mM nonessential amino acids (Invitrogen), 0.055 mM 2-mercaptoethanol (Invitrogen), 2 mM L-glutamine (Invitrogen), 5 lg/mL insulin (Sigma, St. Louis, MO), 1 lM dexamethasone (Sigma), and 0.5 mM isobutylmethylxanthine (Sigma). Adipose conversion assay The cells were washed twice with phosphate-buffered saline (PBS) (Invitrogen), fixed with 10% formaldehyde (Invitrogen) for 30 min, and then rinsed with 60% isopropanol (Sigma). After drying, 0.6% (w/v) Oil Red O (Sigma) solution (six parts 0.5% Oil Red O dye in isopropanol and four parts water) was used to stain the cells at room temperature for 30 min. Excess dye was quickly removed with 30% isopropyl alcohol, after which the cells were washed five times with water. To achieve relative quantitative measurements of lipid accumulation, the stained cells were covered with 2 mL isopropyl alcohol for 10 min, the extracted dye was collected, and its absorbance was measured at 510 nm. Efficiency calculation The total number of the adipocytes, defined as a round, fat-laden cell that can be stained with Oil Red O, was quantified after 20 days of induction. This number was determined in 10 randomly selected · 20 visual fields from three independent experiments. The average per field was calculated and then was used to estimate the total number of the cells in the entire dish based on the known area of the · 20 visual field and the entire dish. Then this number was divided by the number of plated PEFs before induction to get the efficiency of conversion. Real-time reverse transcription-polymeras chain reaction (RT-PCR) analysis The total RNA was isolated using Trizol (Invitrogen) from triplicate samples at five different time points during adipogenesis. The total RNA was purified with DNaseI (Fermentas, Hanover, MD) to remove genomic DNA contamination, and the RNA concentrations were measured using a NanoDrop-1000 (Thermo, Pittsburgh, PA). The cDNA was reversely transcribed using SuperScript III Reverse Transcriptase (Invitrogen). The expression of adipogenic transcription factors was determined by quantitative real-time RT-PCR using the SYBR Green PCR Master Mix (Invitrogen); all of the primers are listed in Table 1. b-Actin was used as an internal reference. The annealing temperatures of the primers were as follows: 60C for b-actin and Adpioq, 62C for PPARc2, 55C for C/EBPa, 57C for C/EBPb, and Fabp4, 58C for C/EBPd, 59C for Lpl and Cfd, 53C for Slc2a4. The cycle thresholds of all of the samples used for analysis were within the linear portion of the standard curve. The relative gene expression was calculated using the comparative Ct method with the formula 2 - DDCt (Livak and
ADIPOGENESIS FROM PORCINE EMBRYONIC FIBROBLASTS
101
Table 1. Genes, Primer Sequences, and Amplicon Sizes Gene PPARc C/EBPa C/EBPb LPL FABP4 Adipod CFD SLC2A4 C/EBPd Nanog Oct3/4 b-actin
Primer
Sequence (5¢ to 3¢)
Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse
CTGACCAAAGCAAAGGCGAG ACCCCTGAAAGATGCGAATG CAAGAACAGCAACGAGTA GTCATTGTCACTGGTCAG CAGCGACGAGTACAAGAT CTGCTCCACCTTCTTCTG GCGTGTGGCTTCAGAGTC CAGGAATGAGATGGCAAGTGT CGAACTCTACAACACTCTG ACCAACAAGCATATTGAACA ACTTGAAGGATGTGAAGGT ATGTTGTGGTAGAGAAGGAA CATGATCTCCTCCTGCTGAAG CCTCGTGGTCCTCTCGTT AGTATGTTGCGGATGCTA TAGGAAGGTGAAGATGAAGAA GCTATCGTCAGGTCAGTTA TCTCCATAATCAGTGTCCAA TCCTCTTCCTTCCTCCAT TCCTTCTCTGTGCTCTTC AAGCAGTGACTATTCGCAAC CAGGGTGGTGAAGTGAGG GAACCCCAAAGCCAACCGT CCTCGTAGATGGGCACCGT
Amplicon Size (bp)
GenBank Accession number
172
NM_214379.1
130
XM_003127015.1
148
NM_001199889.1
150
NM_214286.1
114
NM_001002817.1
229
NM_214370.1
88
XM_003122985.1
83
NM_001128433.1
127
XM_001925928.3
108
NM_001129971.1
136
NM_001113060.1
173
XM_003357928.1
FIG. 1. (A) Adipogenesis of PEFs by SB431542 on day 20 and Oil Red O staining of induced adipocytes (200 · microscope). (B) Oil Red O staining of adipocytes induced by SB431542, Thiazovivin, and their combination on days 5, 10, 15, and 20. (C) Lipid accumulation was assessed by the quantification of A510 in destained Oil Red O with isopropanol. Data are expressed as the mean – SD from triplicate experiments. The resulting value from the SB431542- and Thiazovivin-treated group was significantly increased *p < 0.05, **p < 0.01 (Student’s t-test) compared with the SB431542-treated group.
102 Schmittgen, 2001). The amplified PCR products were separated by 1.0% agarose gel electrophoresis and were then purified and confirmed by DNA sequencing. Immunocytochemistry The cells were washed twice with PBS, fixed with 4% formaldehyde for 30 min, and then covered with 0.1% Triton
ZHU ET AL. X-100 in PBS (Sigma) for 30 min. Five percent goat serum containing 0.1% Triton X-100 in PBS was added to block cells for 30 min at room temperature. The cells were incubated with 0.2% anti-PPARc, C/EBPa, and C/EBPb antibody (Sigma) containing 0.1% Triton X-100 in PBS for 3 h at 4C. The cells were then treated with FITC goat antirabbit or antimouse antibodies (Sigma). The results were observed using a
FIG. 2. Real-time RT-PCR analysis of the mRNA levels of fat marker genes (PPARc, C/EBPa, C/EBPb, C/EBPd, Lpl, Fabp4, Cfd, Slc2a4, and Adipoq) by induction with SB431542, combined SB431542 and Thiazovivin, and the hormonal cocktail. The expression levels of PPARc, C/EBPa, Lpl, Fabp4, Cfd, Slc2a4, and Adipoq that were induced by combined SB431542 and Thiazovivin were significantly increased *p < 0.05, **p < 0.01 (Student’s t-test) compared to the levels from SB431542 alone (n = 3). The expression levels of C/EBPb showed no remarkable change.
ADIPOGENESIS FROM PORCINE EMBRYONIC FIBROBLASTS laser scanning confocal fluorescence microscope (Olympus, Melville, NY). Western blot analysis The cells were washed twice with cold PBS and harvested in NP40 Cell Lysis Buffer (Invitrogen) with phenylmethylsulfonyl fluoride (PMSF). After centrifugation, the supernatants were collected and quantitated by the QuantiPro BCA Assay Kit (Sigma). The protein samples were separated using SDS-PAGE and transferred electrophoretically onto polyvinylidene difluoride membranes (Amersham Biosciences, Piscataway, NJ). After blocking with 2% milk, the membranes were incubated with primary antibodies at 4C overnight. The primary antibodies against PPARc, C/ EBPa, and C/EBPb were from Sigma, and those against bactin were from Abcam (Cambridge, MA). After washing with PBST, the membranes were incubated with horseradish peroxidase-conjugated secondary antibodies (Sigma) for 2 h at room temperature. The signals were visualized by enhanced chemiluminescence (Perkin-Elmer, Norwalk, CT). Statistical analysis The results of lipid accumulation assay and real-time RTPCR are expressed as the mean – SD (n = 3). The statistical analysis was performed using Student’s t-test for acomparison between two groups. The differences were considered significant if p < 0.05. Results and Discussion The inhibition of the TGF-b and ROCK signaling pathway is sufficient for adipocyte induction After culturing with SB431542 and Thiazovivin for 10 to 15 days, adipocytes were observed. During the subsequent induction, triacylglycerol lipid droplets accumulated and were stained with Oil Red O (Fig. 1A and B). The extend of adipose conversion, determined by the extraction of Oil Red O from stained cultures, was much higher in the induction using both SB431542 and Thiazovivin than when SB431542 was used alone (Fig. 1B and C). To determine the conversion efficiency, we estimated the total number of induced adipocytes in the entire dish on the day 20, and divided this number by the number of plated cells before induction to get a percentage of the starting population of cells that adopted adipocytes characteristics. The efficiency of using both inhibitors was 27.0% – 5.7%, which is much higher than when using only SB431542 which is 17.3% – 2.6%, and there was no adipocyte induction when using only Thiazovivin. The expression of the fat marker genes including PPARc2, C/EBPa, C/EBPb, C/EBPd, Lpl, Fabp4, Cfd, Slc2a4, and Adipoq was examined by real-time RT-RCR at different time points during the induction (5, 10, 15, and 20 days). As time passed, the expression of PPARc, C/EBPa, Lpl, Fabp4, Cfd, Slc2a4, and Adipoq increased significantly, and the expression of C/EBPb and C/EBPd showed no remarkable differences (Fig. 2). Furthermore, the expression of these fat markers was much higher in the induction that utilized both inhibitors than it was when SB431542 was used alone, which further demonstrates that SB431542 is sufficient to convert PEFs to adipocytes and that Thiazovivin can promote the efficiency of the
103
induction. The Western blot and immunofluorescence analysis also revealed the expression of PPARc, C/EBPa, and C/ EBPb (Figs. 3–4). To confirm that SB431542 actually induced adipogenesis by regulating the TGF-b signaling pathway, we treated PEFs with SB431542 and TGF-b1 simultaneously and found no adipogenesis (data not shown). These results illustrate that PEFs can be converted into adipocytes by inhibiting the TGF-b signaling pathway and that the efficiency of adipogenesis can be promoted by downward modulation of the ROCK signaling pathway. The interaction of the adipogenic transcription factors may provide insight into the molecular mechanism of adipogenesis. In response to hormonal stimulation, C/EBPb and C/ EBPd are essential initiators of adipocyte differentiation, and they in turn activate the expression of PPARc and C/EBPa (Fajas et al., 1998). Following adipocyte differentiation, the expression of C/EBPb is downregulated, and C/EBPa, which exhibited increased expression induced by PPARc activation, may also produce feedback that increases the expression of PPARc. C/EBPa and C/EBPb trigger growth arrest and initiate full adipocyte differentiation (Freytag and Geddes, 1992; Umek et al., 1991), whereas C/EBPa cooperates with PPARc to activate the expression of adipocyte genes (Wu et al., 1999). During our adipocyte differentiation that used both SB431542 and Thiazovivin, the expression of C/EBPb and C/ EBPd was nearly unchanged, and the expression of PPARc and C/EBPa increased significantly (Fig. 2). The unchanged expression level of C/EBPb and C/EBPd may be in agreement with the observation that the inhibition of adipogenesis by TGF-b was accompanied by reduced mRNA levels of PPARc and C/EBPa but not C/EBPb and C/EBPd (Choy et al., 2000). TGF-b targets the transcription factor cascade that is upstream of PPARc, possibly by repressing the functions of C/ EBPb and d (Choy et al., 2000). The enhancement of adipogenesis through the inhibition of the ROCK signaling pathway was likely due to the regulation of cell shape. Cell shape has been reported to regulate the commitment of human mesenchymal stem cells (hMSCs) by modulating endogenous RhoA, specifically via its effects on ROCK-mediated cytoskeletal tension (McBeath et al., 2004). A previous study has shown that expressing dominant-negative RhoA committed hMSCs to become adipocytes (McBeath et al., 2004), which provides a possible explanation for our finding that
FIG. 3. Western blot analysis shows the expression of PPARc, C/EBPa, and C/EBPb that was induced by SB431542 alone and by combined SB431542 and Thiazovivin treatment on days 5, 10, 15, and 20. b-Actin served as the loading control.
104
ZHU ET AL.
FIG. 4. Immunofluorescence analysis of the expression of PPARc, C/EBPa, and C/EBPb in adipocytes induced by SB431542 on day 20. PEFs, which are untreated with inhibitors served as the control. Nuclei were stained with DAPI. Scale bar: 50 lm.
the RhoA effector, which is a ROCK inhibitor, increased the efficiency of adipogenesis. The induced adipocytes were converted directly from PEFs As it is known that MSCs and preadipocytes have the potential to generate adipocytes, we induced PEFs using a standard hormonal cocktail containing dexamethasone, isobutylmethylxanthine, and insulin to exclude the possibility that adipocyte progenitors existing in the isolated PEFs gave rise to adipocytes. After induction, there was no generation of adipocytes (Fig. 5A), little expression of PPARc, and the expression levels of C/EBPa and C/EBPb were lower and higher, respectively, than those found for treatment with SB431542 and Thiazovivin (Figs. 2 and 5B). The inability to induce high levels of PPARc expression may be the most important reason that adipogenesis did not occur. These results excluded the possibility that the adipocytes arose from MSCs or preadipocytes that contaminated the PEFs. To determine if the induced adipocytes passed through a stem-like state, we analyzed the expression of stem cell marker genes in four stages of adipocyte conversion. There was no expression of Nanog or Oct3/4 (Fig. 5C), which provided supporting evidence that the process of conversion to adipocytes bypassed the pluripotent state. In summary, our results indicate that the induced adipocytes were directly converted from PEFs. In conclusions, our successful conversion of PEFs into adipocytes helps to improve the understanding of the mechanisms involved in adipogenesis and the prevention of diseases involved in adipogenesis. Future studies to improve the efficiency of the conversion are necessary to advance this technology for potential regenerative therapies. Our findings suggest that the utilization of signaling pathway inhibitors to convert cell lines can initiate sufficient expression of the endogenous genes that are involved in specific cell fate determination. In addition, cell shape, which changes dramatically during lineage reprogramming, can serve as a driving factor of this process. Furthermore, our chemical moleculebased method has more economical applications than the
FIG. 5. (A) Oil Red O staining of adipocytes inducted by SB431542, combined SB431542 and Thiazovivin and a hormonal cocktail on day 20. (B) Western blot analysis shows the expression of PPARc, C/EBPa, and C/EBPb that was induced by the hormonal cocktail on day 20. (C) Nanog and Oct3/4 were detected during adipogenesis by induction with SB431542 only and combined SB431542 and Thiazovivin on days 0, 5, 10, 15, and 20. Water was used as a negative control. The RT-PCR products from the templates containing the Nanog and Oct3/4 genes served as positive controls.
ADIPOGENESIS FROM PORCINE EMBRYONIC FIBROBLASTS transgenic cocktail because it effectively eliminates any risk of genomic modification, it offers the safest method for altering the cell fates that have been described so far. Acknowledgments The authors express their gratitude to all the members of our laboratory for technical support and helpful discussion, and the staff at Embryo Engineering Center for technical assistance and taking care of the animals. This work was supported by China National Key Basic Research Program (973 Program, No. 2009CB941001, No. 2011CBA01003, and No. 2011CB944200). Author Disclosure Statement The authors declare that no conflicting financial interests exist. References Ballock, R.T., Heydemann, A., Wakefield, L.M., et al. (1993). TGF-beta 1 prevents hypertrophy of epiphyseal chondrocytes: regulation of gene expression for cartilage matrix proteins and metalloproteases. Dev. Biol. 158, 414–429. Choy, L., Skillington, J., and Derynck, R. (2000). Roles of autocrine TGF-beta receptor and Smad signaling in adipocyte differentiation. J. Cell Biol. 149, 667–682. Clouthier, D.E., Comerford, S.A., and Hammer, R.E. (1997). Hepatic fibrosis, glomerulosclerosis, and a lipodystrophy-like syndrome in PEPCK-TGF-beta1 transgenic mice. J. Clin. Invest. 100, 2697–2713. Davis, R.L., Weintraub, H., and Lassar, A.B. (1987). Expression of a single transfected cDNA converts fibroblasts to myoblasts. Cell 51, 987–1000. Fajas, L., Fruchart, J.C., and Auwerx, J. (1998). Transcriptional control of adipogenesis. Curr. Opin. Cell Biol. 10, 165–173. Feng, R., Desbordes, S.C., Xie, H., et al. (2008). PU.1 and C/ EBPalpha/beta convert fibroblasts into macrophage-like cells. Proc. Natl. Acad. Sci. USA 105, 6057–6062. Freytag, S.O., and Geddes, T.J. (1992). Reciprocal regulation of adipogenesis by Myc and C/EBP alpha. Science 256, 379–382. Ieda, M., Fu, J.D., Delgado-Olguin, P., et al. (2010). Direct reprogramming of fibroblasts into functional cardiomyocytes by defined factors. Cell 142, 375–386. Ignotz, R.A., and Massague, J. (1985). Type beta transforming growth factor controls the adipogenic differentiation of 3T3 fibroblasts. Proc. Natl. Acad. Sci. USA 82, 8530–8534. Jaffe, A.B., and Hall, A. (2005). Rho GTPases: biochemistry and biology. Annu. Rev. Cell Dev. Biol. 21, 247–269. Janssens, K., ten Dijke, P., Janssens, S., and Van Hul, W. (2005). Transforming growth factor-beta1 to the bone. Endocr. Rev. 26, 743–774. Livak, K.J., and Schmittgen, T.D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25, 402–408. Massague, J., Cheifetz, S., Endo, T., et al. (1986). Type beta transforming growth factor is an inhibitor of myogenic differentiation. Proc. Natl. Acad. Sci. USA 83, 8206–8210.
105
McBeath, R., Pirone, D.M., Nelson, C.M., et al. (2004). Cell shape, cytoskeletal tension, and RhoA regulate stem cell lineage commitment. Dev Cell 6, 483–495. Noguchi, M., Hosoda, K., Fujikura, J., et al. (2007). Genetic and pharmacological inhibition of Rho-associated kinase II enhances adipogenesis. J. Biol. Chem. 282, 29574–29583. Petruschke, T., Rohrig, K., and Hauner, H. (1994). Transforming growth factor beta (TGF-beta) inhibits the differentiation of human adipocyte precursor cells in primary culture. Int. J. Obes. Relat. Metab. Disord. 18, 532–536. Prins, J.B., and O’Rahilly, S. (1997). Regulation of adipose cell number in man. Clin. Sci. (Lond.) 92, 3–11. Rosen, E.D., and Spiegelman, B.M. (2006). Adipocytes as regulators of energy balance and glucose homeostasis. Nature 444, 847–853. Roth, J., Qiang, X., Marban, S.L., et al. (2004). The obesity pandemic: where have we been and where are we going? Obes. Res. 12(Suppl. 2), 88S–101S. Sparks, R.L., Allen, B.J., and Strauss, E.E. (1992). TGF-beta blocks early but not late differentiation-specific gene expression and morphologic differentiation of 3T3 T proadipocytes. J. Cell Physiol. 150, 568–577. Takahashi, K., and Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, 663–676. Torti, F.M., Torti, S.V., Larrick, J.W., and Ringold, G.M. (1989). Modulation of adipocyte differentiation by tumor necrosis factor and transforming growth factor beta. J. Cell Biol. 108, 1105–1113. Umek, R.M., Friedman, A.D., and McKnight, S.L. (1991). CCAAT-enhancer binding protein: a component of a differentiation switch. Science 251, 288–292. Vierbuchen, T., Ostermeier, A., Pang, Z.P., et al. (2010). Direct conversion of fibroblasts to functional neurons by defined factors. Nature 463, 1035–1041. Wu, Z., Rosen, E.D., Brun, R., et al. (1999). Cross-regulation of C/EBP alpha and PPAR gamma controls the transcriptional pathway of adipogenesis and insulin sensitivity. Mol. Cell. 3, 151–158.
Address correspondence to: Mingjun Zhang Jilin Provincial Key Laboratory of Animal Embryo Engineering College of Animal Science and Veterinary Medicine Jilin University Changchun, Jilin 130062, People’s Republic of China E-mail:
[email protected] OR Hongsheng Ouyang Jilin Provincial Key Laboratory of Animal Embryo Engineering College of Animal Science and Veterinary Medicine Jilin University Changchun, Jilin 130062, People’s Republic of China E-mail:
[email protected] 