Disease-specific accumulation of mutant ubiquitin

Download PDF
12 downloads 0 Views 496KB Size Report
Comment
Eggers, and Joost Verhaagen for their help with the lentiviral experiments and Inge Huitinga for the experiments on MS. We thank Dr. J. M. Ruijter (University of ...
Disease-specific accumulation of mutant ubiquitin as a marker for proteasomal dysfunction in the brain DAVID F. FISCHER, ROB A. I. DE VOS,* RENSKE VAN DIJK, FEMKE M. S. DE VRIJ, EVELIEN A. PROPER,† MARC A. F. SONNEMANS, MARIAN C. VERHAGE, JACQUELINE A. SLUIJS, BARBARA HOBO, MOHAMED ZOUAMBIA, ERNST N. H. JANSEN STEUR,* WOUTER KAMPHORST,‡ ELLY M. HOL, AND FRED W. VAN LEEUWEN1 Graduate School for Neurosciences Amsterdam and Netherlands Institute for Brain Research, Amsterdam, The Netherlands; *Pathological Laboratory Oost Nederland and Medisch Spectrum Twente, Enschede, The Netherlands; †Rudolf Magnus Institute for Neurosciences, Utrecht Medical Centre, The Netherlands; and ‡Department of Neuropathology, University Hospital Free University, Amsterdam, The Netherlands Molecular misreading of the ubiquitin-B (UBB) gene results in a dinucleotide deletion in UBB mRNA. The resulting mutant protein, UBBⴙ1, accumulates in the neuropathological hallmarks of Alzheimer disease. In vitro, UBBⴙ1 inhibits proteasomal proteolysis, although it is also an ubiquitin fusion degradation substrate for the proteasome. Using the ligase chain reaction to detect dinucleotide deletions, we report here that UBBⴙ1 transcripts are present in each neurodegenerative disease studied (tauo- and synucleinopathies) and even in control brain samples. In contrast to UBBⴙ1 transcripts, UBBⴙ1 protein accumulation in the ubiquitin-containing neuropathological hallmarks is restricted to the tauopathies such as Pick disease, frontotemporal dementia, progressive supranuclear palsy, and argyrophilic grain disease. Remarkably, UBBⴙ1 protein is not detected in the major forms of synucleinopathies (Lewy body disease and multiple system atrophy). The neurologically intact brain can cope with UBBⴙ1 as lentivirally delivered UBBⴙ1 protein is rapidly degraded in rat hippocampus, whereas the K29,48R mutant of UBBⴙ1, which is not ubiquitinated, is abundantly expressed. The finding that UBBⴙ1 protein only accumulates in tauopathies thus implies that the ubiquitin-proteasome system is impaired specifically in this group of neurodegenerative diseases and not in synucleinopathies and that the presence of UBBⴙ1 protein reports proteasomal dysfunction in the brain.OFischer, D. F., de Vos, R. A. I., van Dijk, R., De Vrij, F. M. S., Proper, E. A., Sonnemans, M. A. F., Verhage, M. C., Sluijs, J. A., Hobo, B., Zouambia, M., Jansen Steur, E. N. H., Kamphorst, W., Hol, E. M., van Leeuwen, F. W. Disease-specific accumulation of mutant ubiquitin as a marker for proteasomal dysfunction in the brain. FASEB J. 17, 2014 –2024 (2003) ABSTRACT

Key Words: tauopathies 䡠 synucleinopathies 䡠 molecular misreading 䡠 UBB⫹1 䡠 lentivirus

Alzheimer disease (AD) is a multifactorial disease. Current views on the etiology of AD range from the 2014

␤-amyloid hypothesis (1) and aberrant tau metabolism (2) to a combination of genetic (apolipoprotein E polymorphism) (3) and nongenetic risk factors, such as age, and a reduction of neuronal activity (4). Regarding the genetic contribution, only a minority of cases concerns autosomal dominant forms of AD with mutations in the ␤-amyloid precursor protein (APP) or the presenilin genes (5). The presence of one or two ApoE4 alleles can contribute to neurodegeneration in ⬃30% of all AD cases (3). We earlier reported on a novel type of transcript mutation in neurons of elderly people and in those of sporadic AD and Down syndrome (DS) patients (6, 7). In these patients, dinucleotide deletions (⌬GA, ⌬GU, ⌬CU) were found in two transcripts (i.e., ␤APP and ubiquitin B, UBB) implicated in these neurodegenerative diseases (7). Hot spots for these dinucleotide deletions appear to be simple repeats, such as GAGAG motifs (8). The process of unfaithful transcription of genomic information into aberrant mRNA and the subsequent production of frameshifted proteins has been termed “molecular misreading” (9). These mutant proteins, carboxyl-terminally translated in the ⫹1 reading frame of the mRNA, have been called ⫹1 proteins. In Alzheimer disease and Down syndrome, APP⫹1 and UBB⫹1 accumulate in affected regions of the brain and coexist in the neuritic plaques and tangles (7). During the development of neuropathology and/or aging, neurons either start producing aberrant transcripts or lose the ability to degrade these transcripts and ⫹1 proteins. In other words, during aging and particularly in neurodegenerative disease, transcript and protein quality control mechanisms, such as proteasomal protein degradation, may work less efficiently (9). Several groups have already shown that 1 Correspondence: Netherlands Institute for Brain Research, Meibergdreef 33, 1105 AZ Amsterdam The Netherlands. E-mail: [email protected] doi: 10.1096/fj.03-0205com

0892-6638/03/0017-2014 © FASEB

UBB⫹1 protein blocks the proteasome (10, 11), which can result in neuronal apoptosis (12). The accumulation of UBB⫹1 protein in the hallmarks of AD and DS raises the question whether the manifestation of molecular misreading is restricted to these forms of dementia or whether it occurs in other nonAlzheimer type neurodegenerative diseases (i.e., the tauo- and synucleinopathies) as well. In a great number of neurodegenerative disease, ubiquitin or ubiquitinated proteins accumulate, which are thought to be involved in the development of these diseases (18). In the present study we examined the major forms of tauopathiesOPick disease (PiD), frontotemporal dementia (FTD), progressive supranuclear palsy (PSP), and argyrophilic grain disease (AGD) (13, 14)Oand the most frequently occurring forms of synucleinopathies (15, 16)OLewy body disease (LBD, clinically Parkinson’s disease) and multiple system atrophy (MSA)Ofor the presence of mutant ubiquitin. We detected a clear difference in UBB⫹1-containing inclusions between tauopathies and synucleinopathies. Experiments performed with lentiviral vectors in the rat hippocampus indicate that proteasomal dysfunction could be the reason for the differential accumulation in neurodegenerative disease.

MATERIALS AND METHODS Ligase chain reaction Detection of UBB mRNA containing a GU dinucleotide deletion was performed using a ligase chain reaction (LCR) (17). Two micrograms of total RNA was reverse-transcribed with hexanucleotides and Expand reverse transcriptase (Roche Diagnostics Nederland BV, Almere, The Netherlands). The UBB cDNA was amplified by PCR using primers 5⬘ACCGGCAAGACCATCACCCT and 5⬘-GGGTCTTCACGAAGATCTGCA and Expand High Fidelity polymerase (Roche). The PCR product was purified on silica powder in guanidine thiocyanate and used in a ligase chain reaction of 20 ␮L containing 20 mM Tris-Cl (pH7.5), 20 mM KCl, 10 mM MgCl2, 0.1% NP-40, 0.01 mM ATP, 1 mM DTT, 5 ␮g salmon sperm DNA, 8 u Pfu DNA ligase (Stratagene Europe, Amsterdam, The Netherlands), and 5 pmol of each oligonucleotide: 5⬘-TTCCTGGTCCTGCGTCTGAGAGG, 5⬘-phosphate-CTCTCAGACGCAGGACCAGG, 5⬘-phosphate-GTATGCAGATCTTCGTGAAGACC, 6-FAM-5⬘TTGTCTTCACGAAGATCTGCATACC. Reaction conditions were: 4 min 92°C, 4 min 65°C, 35 cycles of 20 s 92°C, 20 s 65°C. Samples were run on an 8% polyacrylamide gel and scanned with a STORM 860 imager (Molecular Dynamics, Sunnyvale, CA, USA). Sensitivity of the ⌬GU LCR was 10 amol dsDNA; specificity was 1 ⌬GU cDNA in 80,000 wild-type UBB cDNA. Autopsy material Postmortem material of the major types of tauopathies and synucleinopathies was obtained from different sources (Pathological Laboratory Oost-Nederland, Enschede; Netherlands Brain Bank, Amsterdam and Utrecht Medical Center). We were able to identify almost pure forms of each type of neurological disorder by neurohistological prescreenings, excluding cases showing a combination of different neuroMUTANT UBIQUITIN IN TAUO- AND SYNUCLEINOPATHIES

pathological entities, such as Lewy body disease and AD. All these neurological disorders were studied in 6 ␮m paraffin sections using reported immunocytochemical methodology (7). Antibodies Specificity (including Western blot analysis, ref 12) of four different UBB⫹1 antisera [rabbits were immunized with different specific peptides of the UBB⫹1 protein: Y-Q (11AA, #160294), UBB1⫹1, R-Q (11AA, UBB 2⫹1, #010994, and #020698 Ubi2A), and Y-Q (20AA, # 050897, Ubi3] has been reported before (7, 12) and was confirmed in the present study (Fig. 2). Absorption with the homologous antigen resulted in an absence of staining. Other antibodies were used as the positive immunohistochemical controls: MC 1 and AT 8, both markers for aberrant or hyperphosphorylated tau (19); human leukocyte antigen (HLA) DP-DR-DQ (CR3/43, DAKO) for activated microglia; 22C11, a gift from Dr. T. Hartmann, Heidelberg, Germany, for ␤APP; MoAb 3-39 (7) and a rabbit antibody (Z 0458, DAKO, Glostrup, Denmark) for ubiquitin; NCL-A SYN (clone KM51, Novacastra) for ␣-synuclein. Lentiviral injections cDNAs for GFP, UBB⫹1, and UBB⫹1 containing a Lys to Arg mutation at positions 29 and 48 were cloned in the lentiviral transfer plasmid pRRLsin-PPThCMV-GFP-pre (20, 21). VSV-G pseudotyped lentivirus was produced by cotransfection of the transfer plasmid and helper plasmids (pCMVdeltaR8.74 and pMD.G.2) in 293T cells. Medium was harvested 24 and 48 h after transfection and concentrated by ultracentrifugation. Virus pellets were resuspended in PBS containing 0.5% bovine serum albumin. Stocks were titered with a HIV-1 p24 coat protein ELISA (NEN Research, Boston, MA, USA). Lentiviral vectors were used to infect SH-SY5Y neuroblastoma cells at a multiplicity of infection (moi) of 10. After 48 h epoxomicin was added to the culture medium (0.5 ␮M, Affinity Research, Exeter, UK) for 16 h to inhibit the proteasome. Cells were scraped in Laemmli buffer and analyzed on Western blot (Ubi3 antibody). Detection was performed with enhanced chemiluminescence (ECL, Perkin-Elmer Life Science, Norwalk, CT, USA). Before injection into rat brain, stocks for LV-UBB⫹1 and GFP (green fluorescent protein) were mixed and diluted with PBS containing 0.5% BSA, resulting in 4.105 particles LVUBB⫹1 and 4.104 particles LV-GFP per microliter. Male adult Wistar rats (200 –250 g, Harlan NL, n⫽3) were anesthestized with 1 mL/kg Hypnorm (0.315 mg/mL fentanyl citrate, 10 mg/mL fluanisone). The skull was exposed and coordinates for injection (–3.3 mm anterior-posterior, 1.7 mm lateral, and –3.5 dorsoventral from the dura) were read against bregma (22). Stereotactic injection of 1 ␮L was performed with a 30G stainless steel needle connected to a motor-driven Hamilton syringe for 5 min at 0.2 ␮L/min. After the needle was slowly (over 5 min) withdrawn, the skin was sutured. Seven days after injection the animals were perfused intracardially with PBS, followed by PBS containing 4% paraformaldehyde. Brains were cut on a vibratome in 50 ␮m-thick sections and stained with anti-UBB⫹1 (Ubi3, 1:500) or anti-GFP (Chemicon AB3080 1:50) serum, followed by a peroxidase/anti-peroxidase sandwich and DAB-Ni color reaction. GFP was imaged directly with confocal laser scanning microscopy (Zeiss LSM 410), whereas UBB⫹1 protein was visualized with the Ubi3 antibody and donkey anti-rabbit Cy3. DNA was counterstained with TO-PRO-3 (Molecular Probes, Leiden, The Netherlands). All animal experiments were performed under the guidance of the local animal experimentation committee. 2015

neuronal cell lines (Fig. 1 and Table 1). Unexpectedly, even brain samples (hippocampus and cortex) of young nondemented controls (i.e., 38 – 49 years old) contain UBB⌬GU mRNA.

RESULTS UBB mRNA with a dinucleotide deletion is not disease-specific To analyze dinucleotide deletions (⌬GU) in ubiquitin-B transcripts in an array of neurological disorders, we analyzed the mRNA from a large number of samples. The mRNA was isolated from the areas affected in the disease studied (e.g., hippocampus in Pick disease, amygdala in AGD, Table 1 and Table 2). A new strategy was followed, enabling a sensitive and specific assessment of molecular misreading of the UBB gene at the mRNA level. Dinucleotide deletions (⌬GU) in UBB mRNA are detected by a ligase chain reaction (LCR) (17, 23). In this assay four primers flank the GT dinucleotide in UBB cDNA. If these primers hybridize on a cDNA lacking this dinucleotide, adjacent oligonucleotides can be ligated by a thermostable ligase. The ligated oligonucleotides are a substrate in the subsequent rounds of amplification. If the oligonucleotides hybridize on wild-type UBB cDNA (which is present in excess), the high reaction temperature and specificity of the ligase do not allow ligation. We can detect UBB mRNA containing a dinucleotide deletion in every tested brain sample of all types of neurological disorders, but not in samples of genomic DNA or in various

Neuropathological hallmark identification and antibody specificity studies Characteristic neuropathological hallmarks of each disease (e.g., Pick bodies and tangles, see also legends of Fig. 2 and Fig. 3) were first positively identified using antibodies against aberrant, hyperphosphorylated tau (13, 19), ubiquitin, or ␣-synuclein (15) (Fig. 3 and Fig. 4, left and right column, Table 1). In consecutive sections of the hippocampus of four Pick patients (boldface in Table 2), four UBB⫹1 antisera directed against three different epitopes stained the same population of pyramidal cells in the CA1 area (Fig. 2a– d). Antibody specificity controls for UBB⫹1 staining (e.g., preabsorption with the antigen) were negative (Fig. 2e). Tauopathies In each of the tauopathies reported here [Pick disease (PiD, Fig. 2a– d, and 3b), (Fig. 2e), progressive supranuclear palsy (PSP, Fig. 3h, i; see also ref 24), and argyrophilic grain disease (AGD, Fig. 3m)], we could

TABLE 1. Summary of ⫹1 immunoreactivities (ICC) and transcript detection by LCR in various types of neuropathology Protein

mRNA

(ICC) UBB⫹1 (LCR) (n) UBB⌬GUe (n)

Disease

Brain areas investigated

Hallmarks

⫺ (20)

⫹f (3)

Cortex, hippocampus

⫹ (21)

⫹f (3)

Down syndromea

⫹ (7)

⫹f (3)

Pick’s diseasea Fronto-temporal dementiaa

⫹ (10) ⫹ (8)

⫹f (6) ⫹ (4)

Progressive supranuclear palsya

⫹ (5)

⫹ (3)

Argyrophilic grain diseasea Synucleinopathies Lewy body diseasebcd

⫹ (6)

⫹ (2)

Frontal cortex (BA11), temporal Tangles, neuritic plaques, cortex (BA38), hippocampus neuropil threads (CA1, subiculum) Similar areas as AD Tangles, neuritic plaques, neuropil threads Frontal cortex, hippocampus Pick bodies Frontal cortex (BA11), temporal Immunoreactive inclusions cortex (BA38) (no Pick bodies) Prefrontal cortex (A6) Neurofibrillary tangles, glial inclusion (astrocytic and oligodendroglial) Amygdala, hippocampus Grains

⫺ (30)

⫹ (4)

Multiple system atrophybc Control diseases Multiple sclerosis Epilepsy

⫺ (5) ⫺ (11) ⫺ (12)

Nondemented controls Tauopathies Alzheimer’s diseasea

No neuropathology

Classical and cortical Lewy bodies, Lewy neurites

⫹ (2)

Substantia nigra, striatum, hippocampus, temporal cortex (BA38), anterior cingulate gyrus cinguli (BA24), hippocampus (CA2) Putamen

⫹ (3) ⫹ (2)

Periventricular areas Hippocampus

Plaques Gliosis

Glial cytoplasmic inclusions

b c MC1 or AT-8 and ubiquitin (DAKO) immunopositive. Ubiquitin (DAKO) immunopositive. ␣-Synuclein immunoposid e tive. Clinically Parkinson’s disease; both the substantia nigra and cortex were analyzed for the existence of Lewy bodies. As f determined by ligase chain reaction. ⌬GU deletions already assessed by immunoscreening; see also ref. 7 for young and aged nondemented controls. In Pick’s disease one patient (# 90116) was immunoscreened in addition to LCR tested ones. BA ⫽ Brodman area. a

2016

Vol. 17

November 2003

The FASEB Journal

FISCHER ET AL.

TABLE 2. Details of patients with different types of neurological disease

Patient number

Age

Sex

PMD (h)

Fixation duration (days)

Brain weight (g)

Cause of death

Tau mutation

Pick’s diseased 18001 96064 96012 95086* 92079* 90116* 91053* 96135* 93082* 96099

54 60 64 64 67 68 71 76 77 88

Male Female Female Male Male Male Male Female Male Male

20 10 8 5 5 4 4 6 6 4

26 21 34 41 40 69 86 50 122 48

1120 994 1260 1353 796 908 1256 1064 1120 1356

Volvulus, peritonitis Bronchopneumonia Stomach bleeding Myocard infarction Cachexia Heart failure Cachexia Cachexia Dehydration, uremia Lung emphysema

Frontotemporal dementiad 94075 92019* 93036* 94111*a

52 60 66 70

Male Male Female male

7 5 6 5

97 44 45 61

1087 1331 856 1121

99005*a 96113a 96498 94033

71 76 76 80

Female Female Female Male

6 6 24 2

33 37 38 74

905 1006 1120 1145

Dehydration, cachexia n.a. Heart failure, cachexia Lung emboly, cardiac problems Dehydration with respiratory tract infection Dehydration Bronchopneumonia, cachexia Cachexia

P301L P301L P301L R406W R406W P301L n.a. n.a.

Progressive supranuclear palsy 96280* 96481*

61 71

Male Male

20 22

26 22

1442 1384

98208* 21047

71 79

Male Female

36 4

28 22

1310 915

98198

81

Male

25

25

1410

Bronchopneumonia, aspiration Bronchopneumonia Bronchopneumonia, aspiration, myocardial infarct Bronchopneumonia Urinary bladder carcinoma, myocardial ischemia

Dementia with argyrophilic grains

9521070 97204*

65 67

Male Female

21 17

24 26

1365 1364

9520661 94043* 98058 98006

75 78 81 86

Male Female Male Male

13 4 21 37

22 51 20 22

1434 1260 1430 1234

Bronchopneumonia, pyelonefritis, metastatic urinary bladder carcinoma Bronchopneumonia Valvular aorta stenosis, calcific myocardial hypertrophy Cardiac decompensation and cachexia Bronchopneumonia, myocardial infarct Bronchopneumonia, myocardial infarct

Lewy body disease 91056 20517 97112* 96056 9319604 94026 96239

59 61 61 68 68 68 69

Male Male Male Male Female Male Female

9 15 37 16 24 6 10

60 22 24 24 24 51 22

1377 1424 1536 1246 1470 1356 1248

8917559 9520678 91037 92055 96182 9319470 93142 89009

70 70 70 72 73 73 73 74

Female Female Female Male Male Male Male Male

24 60 4 4 43 10 7 3

24 23 132 27 21 22 68 37

1150 1262 1217 1423 n.a. 1134 1458 1200

Dehydration Bronchopneumonia Myocardial infarct Bronchopneumonia Lung emboli Pneumonia Bronchopneumonia Lung emphysema, decompensatio cordis Bronchopneumonia, lung emboli Pneumonia Pneumonia n.a. Bronchopneumonia Bronchopneumonia Dehydration, cachexia continued on next page

MUTANT UBIQUITIN IN TAUO- AND SYNUCLEINOPATHIES

2017

TABLE 2.(continued)

Patient number

Age

Sex

PMD (h)

Fixation duration (days)

Brain weight (g)

Cause of death

Tau mutation

Lewy body disease (continued) 94099 94120 96096 9218860 9520708 97252* 96028 94029 90129 21044 96426 9017618

74 75 75 76 76 76 77 77 79 80 80 81

Male Male Female Male Female Female Male Female Female Female Female Female

8 8 8 8 32 12 10 10 17 n.a. 36 24

67 38 24 22 22 24 25 87 n.a. 22 22 26

1390 1323 1346 1354 1354 1290 1320 1115 1237 1168 1188 1142

9600004 97022* 97208*

82 84 87

Male Male Male

60 4 16

21 26 24

1278 1572 1198

n.a. n.a. Sepsis (septichaemia) Myocardial infarct Myocardial infarct Bronchopneumonia Bronchopneumonia n.a. Sepsis n.a. Bronchopneumonia Bronchopneumonia Peritonitis, empyema of the gall bladder, bronchopneumonia Bronchopneumonia Bronchopneumon

Multiple system atrophy 97056* 20483 19915 20991* 20709

50 61 68 69 72

Male Female Male Female Male

n.a. 13 48 24 9

22 24 22 26 22

1448 1142 1546 1300 1300

Bronchopneumonia Lung emboli Pyelonephritis Bronchopneumonia Bronchopneumonia

Multiple sclerosis 96025 96040 96074* 95065 91070 95095 96039 96087 96026* 96036*

34 35 40 41 47 56 57 67 69 74

Female Female Female Female Female Male Female Female Female Female

7 6 7 4 5 5 6 5 9 6

36 32 30 99 30 28 32 34 34 27

1099 1113 1134 1294 1010 1375 1179 1410 1272 1258

96076

81

Female

4

28

1159

Heart failure Complete health decline Dehydration Respiratory insufficiency Aspiration pneumonia, gastritis Respiratory insufficiency Sepsis Euthanasia Severe multiple sclerosis Comatose Cachexia, recurrent urinary tract infection

Epilepsy hippocampal sclerosisb 1* 2 3 4 5 6* nonhippocampal sclerosisb 1 2 3 4 5 6 Alzheimer control 96083a

31 32 35 37 38 45

Female Male Male Male Male Male

x x x x x x

1 1 1 1 1 1

11 Female x 1 24 Female x 1 36 Female x 1 40 Male x 1 40 Male x 1 44 Male x 1 (matched for short postfixation delay) 73 Female 28 1

X X X X X X

x x x x x x

X X X X X X

x x x x x x

1350

Stroke in thalamus continued on next page

2018

Vol. 17

November 2003

The FASEB Journal

FISCHER ET AL.

TABLE 2.(continued)

Patient number

Age

Sex

PMD (h)

Fixation duration (days)

Brain weight (g)

Cause of death

Tau mutation

Nondemented controlsc 97162* 99079 94060* 99076 98169* 99010 98129 99019

38 44 45 48 49 54 56 75

Male Male Male Female Male Male Female Female

11 15 9 14 10 12 18 38

37 1 47 1 35 1 1 1

1618 1700 1440 1240 1730 1720 1130 1460

Wegener, aluminium intoxication Accident Hypovolemic shock, melaena Kahler’s disease Sudden death Metastasis Metastasis of rectum carcinome Myocard infarct

* Cryomaterial used for the assessment of dinucleotide deletions (⌬GU) by LCR, as shown before in Alzheimer’s disease by immunoa b c screening (7); n.a. ⫽ not available. UBB⫹1 protein positive. Biopsy material. Other nondemented controls (n⫽12). Note that in aged controls UBB⫹1 protein is present (7); see www.nih.knaw.nl (added in Table 1 resulting in a total number of 20). Control status was established both by the clinical status and on postmortem brain material. Clinical details of Alzheimer patients reported in Table 1 (n ⫽ 21) d were reported previously (7) as well. Pick’s disease: numbers in boldface were used for specificity studies (Fig. 2). In Pick’s disease all cases were positive for hyperphosphorylated Tau (MC1) or ubiquitin, whereas the tangle load was absent or minimal. In frontotemporal dementia, no Pick bodies were found whereas the tangle load varied between minimal and severe. In patient #99005 globoid tangles were reported (Fig. 3d–f ). Patient #96498 was suggested to have FTD with motor neuron disease.

detect UBB⫹1 protein in their neuropathological hallmark inclusions. UBB⫹1 protein is observed in a subpopulation of the ubiquitin-positive inclusions, such as Pick bodies in PiD (granular cells of the dentate gyrus of the hippocampus and pyramidal cells in the CA1 area), neurofibrillary and glial tangles in gray matter of the prefrontal cortex in PSP, and coiled bodies in white matter of PSP (Fig. 3i). These data show that besides neurons, glial cells can express proteins derived from mRNAs with dinucleotide deletions. In all AGD cases (13, 25), grains in the amygdala (Fig. 3m) and hippocampus (not shown) are very intensely labeled by the UBB⫹1antibodies. In cases of FTD, a disease that can be linked to a mutation in tau (26 –27) (see Tables 1 and 2 for details and type of mutation), three of eight examples show

UBB⫹1 protein staining (Fig. 3e). The immunopositive structures, such as cytoplasmic inclusions in the dentate gyrus (globoid tangles) and pyramidal cells of the CA1 of the hippocampus, are also positive for abnormal, hyperphosphorylated tau and for ubiquitin. The heterogeneity in the clinical phenotype of frontotemporal dementia, perhaps reflected here in the heterogeneous UBB⫹1 protein staining, has recently been discussed (27–28). The observation that in most cases ubiquitin staining is more intense than UBB⫹1 staining could be due to sensitivity; for instance, ubiquitinated UBB⫹1 with several ubiquitin molecules attached, ref 10) has only one epitope for anti-UBB⫹1, but most likely several epitopes for ubiquitin antibodies. On the other hand, this difference in staining pattern could reflect the accumulation of UBB⫹1 after the accumulation of other ubiquitinated proteins. Synucleinopathies

Figure 1. Ligase chain reaction was performed on human genomic DNA and on a nontemplate RT-PCR (left lanes) as negative controls or on mRNA from human brain tissue (1 ␮L of RT-PCR or 0.1 ␮L of RT-PCR in pairs of lanes). The samples were 1 and 2: nondemented controls # 97162 and # 98169; 3 and 4: DS # 94058 and # 93028; 5 and 6: AGD # 97204 and # 94043; 7 and 8 FTD # 94111 and # 99005; 9: PSP # 98208; 10 and 11: PiD # 95086 and # 92079; 12: LBD # 97252. No signal was obtained in various cell lines (SK-N-SH, SK-N-AS and CHP-100, data not shown). Primers and reaction product (UBB⌬GU) are indicated. Other samples tested are indicated in Table 2 by an asterisk (*). MUTANT UBIQUITIN IN TAUO- AND SYNUCLEINOPATHIES

We have examined two synucleinopathies: Lewy body disease (clinically Parkinson disease) and MSA. We failed to detect UBB⫹1-positive inclusions in LBD, Lewy neurites, or cortical or classical Lewy bodies (Fig. 4a– c) in an even larger group of patients than previously reported (7). MSA reveals no detectable UBB⫹1 protein (Fig. 4e), whereas ␣-synuclein (Fig. 4d) and ubiquitin (Fig. 4f ) stainings were intense. UBBⴙ1 does not accumulate due to neuronal damage or overactivation To investigate the mechanism for the differential accumulation of UBB⫹1 in neurodegenerative disease, we checked the expression of UBB⫹1 protein in two other neurological diseases (multiple sclerosis and epilepsy) as a control for neuronal damage or overactivation, respectively. UBB⫹1 protein was not detected in areas 2019

Figure 2. Consecutive sections (a– c) of the hippocampus of a Pick’s disease patient (#93082) incubated with three different UBB⫹1 antisera. a) Ubi 1⫹1 #160294;1;300, b) Ubi 2⫹1 #010994;1;400, c) Ubi2A #020698;1:400) showing UBB⫹1 immunoreactive inclusions in the pyramidal cells of the CA1 area. Note their colocalization in various cells (Œ). * ⫽ capillary. d) In an adjacent section the same cell group was stained with UBB⫹1 antiserum Ubi3 #050897 (1:400) whereas e) the absorption control of #020698 (1:400) was shown. Amino acid sequences against which the antibodies to UBB⫹1 were raised are shown below panels a– e. Magnification bar ⫽ 25 ␮m.

surrounding the various types of plaques in multiple sclerosis (29), whereas ␤APP could be readily detected in damaged axons (29) and HLA-expressing microglia can be seen in an active lesion (Fig. 5). Furthermore, in the hippocampal area in temporal lobe epilepsy, we did not detect UBB⫹1 (data not shown). These data suggest that UBB⫹1 accumulation is not a secondary response to neurodegeneration.

UBBⴙ1 is degraded by the ubiquitin-proteasome system in the hippocampus Our findings indicate that in syncleinopathies and control subjects (7), either UBB⫹1 mRNA is not translated or, which is more likely, the degradation of UBB⫹1 protein occurs very efficiently as we have shown in cell lines (11). The degradation in vitro of UBB⫹1 is

Figure 3. Immunocytochemical staining of various tauopathies. a– c) Pick’s disease (#18001); d–f) frontotemporal dementia (#99005); g– k) progressive supranuclear palsy (#98198); l–n) argyrophilic grain disease (#98058). Hyperphosphorylated tau (MC1) staining in left column (a, d, g, l), UBB⫹1 protein staining in middle column (b, e, h, I, m) and ubiquitin in right column (c, f, j, k, n). a– c) Note MC1, UBB⫹1, and ubiquitin-positive Pick bodies in granular cells of the gyrus dentatus (gd) of the hippocampus. b) Insert shows nuclei next to dense Pick bodies (Œ). In FTD (#99005, d–f ) within the granular layer of the gd of the hippocampus, tangle-like (globoid) inclusions can be seen with MC1, UBB⫹1 protein and ubiquitin. The same goes for the pyramidal cells of CA1 of the hippocampus. In PSP in the gray matter of the preforontal cortex both MC1 (g), UBB⫹1 protein (h), and ubiquitin (k) immunoreactive tangles can be seen. UBB⫹1 protein (i) and ubiquitin (k) immunoreactive cytoplasmic inclusions can be seen in the glial cells of the white matter. In argyrophilic grain disease (l–n), abundant MC1, UBB⫹1, and ubiquitin-positive grains can be seen in the amygdala. Magnification bars in all panels ⫽ 25 ␮m; b) insert ⫽ 15 ␮m.

2020

Vol. 17

November 2003

The FASEB Journal

FISCHER ET AL.

Figure 4. Immunocytochemical staining in two synucleinopathies. In adjacent sections of LBD (a– c) the characteristic ␣-synuclein (a), UBB⫹1 (b), and ubiquitin (c) immunoreactive fibers can be seen in CA2 of the hippocampus (a– c #96028). Inserts: a) Lewy neurites (right corner), immunoreactive for ␣-synuclein or ubiquitin can be seen. Left insert shows ␣-synuclein-positive Lewy bodies (#21044); c) ubiquitin immunoreactive cortical Lewy bodies in the gyrus cinguli (#96056; arrowheads) are shown. On the other hand, UBB⫹1 protein (b) is not detectable in CA2 (GD⫽dentate gyrus) nor in cortical Lewy bodies of the gyrus cingulatus. Classical Lewy bodies in the substantia nigra had already been shown to be negative (7). b) Insert shows UBB⫹1 protein negative Lewy body. In multisystem atrophy (d–f, #20991), astroglial cells (f, note characteristic ubiquitin immunoreactive cytoplasmic structure: ”hood”) are present in the white matter of the putamen of consecutive sections, immunoreactive for ␣-synuclein (d) and ubiquitin ( f ), whereas UBB⫹1 protein is absent (e) (*⫽capillary). In both types of synucleinopathies it can be seen that ␣-synuclein (a, d) is more abundant than ubiquitin (c, f ). Magnification ⫽ 100 ␮m (a–f ), 25 ␮m (inserts: a– c, f ).

dependent on the proteasome and requires ubiquitination of the lysine residues at positions 29 and 48 of UBB⫹1 (11). We wanted to test whether UBB⫹1 expression is monitored by the proteasome in vivo in the hippocampus, an area affected in a number of neurodegenerative diseases. Lentiviral vectors (19, 20) were generated for UBB⫹1 and a stable mutant of UBB⫹1 that lacks the lysine residues at positions 29 and 48. We first tested the activity of the lentiviral vectors on SH-SY5Y neuroblastoma cells. UBB⫹1 protein was expressed at low levels, whereas the K29,48R mutant is expressed at high levels (Fig. 6A). The low expression of UBB⫹1 is due to degradation by the proteasome, as addition of the proteasome inhibitor epoxomicin to the culture medium boosts the expression levels. The K29,48R mutant is not degraded by the proteasome

and, as expected, expression is not stimulated by epoxomicin (which is slightly cytotoxic at these concentrations). Note the presence of ubiquitinated UBB⫹1 protein, which is not present in the K29,48R mutant. Subsequently, lentiviral vectors were spiked with a lentiviral GFP vector as a positive control and injected stereotactically in the adult rat hippocampus. The animals were perfused after 7 days and stained for UBB⫹1 and GFP protein expression (Fig. 6B). Clearly, very few cells are positive for UBB⫹1 protein whereas the K29,48R mutant of UBB⫹1 is abundantly present in the dentate gyrus of the hippocampus. The GFP vector gives similar expression in all animals, indicating that UBB⫹1 protein in the neurologically intact brain is efficiently degraded by the ubiquitin-proteasome system.

Figure 5. Adjacent sections of an MS patient (#91070). Intense staining for ␤APP by antibody 22C11 (a) and HLA DP-DR-DQ(c) is shown in the capsula interna near an active MS lesion (for details, see ref 29), whereas UBB⫹1 protein is not detected (b). c) Magnification bar ⫽ 80 ␮m.

MUTANT UBIQUITIN IN TAUO- AND SYNUCLEINOPATHIES

2021

Figure 6. A) Western blot of lentivirus-transduced SH-SY5Y neuroblastoma cells. After transduction with UBB⫹1 or K29,48R mutant UBB⫹1 viral vectors, the proteasome was inhibited with epoxomycin (Epx). Lysates were probed with Ubi3 antibody. UBB⫹1 protein has an apparent molecular mass of 11 kDa (indicated by the arrowhead). Note the presence of UBB⫹1 in the UBB⫹1 lentiviral vector transduced cells after proteasome inhibition, whereas K29,48R mutant UBB⫹1 expression does not depend on proteasome inhibition. B) Adjacent sections of the rat brain after lentiviral transduction of the dentate gyrus of the hippocampus. 4.105 particles LV-UBB⫹1 and 4.104 particles LV-GFP were mixed and injected. Representative animal, stained for GFP (left panel) or UBB⫹1 protein (middle panel). In the right panel, UBB⫹1 protein expression of granule cells of the dentate gyrus is visualized in the red channel, GFP in the green channel; DNA staining (TO-PRO) is in the blue channel. The upper panels are from an animal injected with a mixture of LV-GFP and LV-UBB⫹1, the lower panels from an animal injected with LV-GFP and LV-UBB⫹1-K29,48R constructs. Note that in the upper panel only a single UBB⫹1-positive cell (red) is present, whereas in the lower panel many UBB⫹1-positive cells are visible. Colocalization of UBB⫹1-K29,48R and GFP immunoreactvity is detectable (yellow).

DISCUSSION Previously we reported that we did not detect UBB⫹1 protein in young controls as long as they were devoid of neuropathology, whereas in an elderly control (with some neuropathology) ⌬GU deleted transcripts and UBB⫹1 protein were found (7). The present study shows that UBB⫹1 transcripts are generated in the human brain, irrespective of neuropathology, and can even be detected in nondemented controls. The process of molecular misreading (i.e., the generation of transcripts with a dinucleotide deletion) is apparently widespread in tissues, and neuropathological differences arise at the UBB⫹1 protein level. The possibility that the accumulation of UBB⫹1 protein is a secondary response to general neuronal dysfunctioning is unlikely, as indicated by the absence of staining in multiple sclerosis and in epilepsy. Moreover, molecular misreading was first described in apparently normally functioning vasopressin neurons (30) and also occurs in non-neuronal cells such as hepatocytes (31). The data presented in this paper show that UBB⫹1 accumulates in those neuropathological aggregates that also contain ubiquitin or ubiquitinated proteins. We have shown that UBB⫹1 is a ubiquitin fusion degradation 2022

Vol. 17

November 2003

substrate that is ubiquitinated (11). If UBB⫹1 is expressed at low levels in cell lines, it can be degraded by the proteasome (Fig. 6A) (11). However, at higher levels UBB⫹1 can also inhibit the proteasome in vitro and in cell lines (10, 11) and subsequently induce cell death (12). The expression of UBB⫹1 protein could thus, after it has crossed a threshold, induce further accumulation of UBB⫹1. In the rat hippocampus transduced with lentiviral vectors, UBB⫹1 protein is degraded efficiently by the proteasome whereas (K29,48R) mutant UBB⫹1 protein, which is neither tagged by ubiquitin nor degraded by the proteasome, accumulates to high levels. Consequently, we suggest that accumulation of UBB⫹1 protein is a marker for proteasomal dysfunction in the human brain. The remarkable differential neuropathological accumulation of UBB⫹1 protein (tauopathies vs. synucleinopathies) and the presence of UBB⫹1 transcripts in both diseases could be caused by differences in protein degradation via the ubiquitin-proteasome system (32). As we cannot detect UBB⫹1 protein in synucleinopathies, whereas tauopathies show high levels of UBB⫹1 protein, we propose that specifically in tauopathies the proteasome is inhibited. Recently it has been shown

The FASEB Journal

FISCHER ET AL.

biochemically that the proteasome is (partially) inhibited in Alzheimer disease (41, 47). In vitro, tau paired helical filaments can inhibit the proteasome (47), which is further evidence for our proposal that UBB⫹1 accumulates in tauopathies due to proteasome inhibition. An impairment of the ubiquitin-proteasome system resulting in the aggregation of aberrant proteins has been suggested in a number of neurological disorders (33). Ubiquitinated dot-like structures and accumulation of ␤APP were observed in the nervous system of mice suffering from axonal gracile dystrophy due to an intragenic deletion of the UCH-L1 gene (43). Furthermore, mutation of the E6-AP ubiquitin ligase gene can modify the number of nuclear inclusions in a mouse model for spinocerebellar ataxia-1 (SCA-1) (44). For Parkinson disease it has been suggested that ␣-synuclein, present in Lewy bodies, is mono- and di-ubiquitinated (34, 45). It was shown that Parkin, which is mutated in autosomal recessive Parkinson disease, acts as an E3 ubiquitin ligase for ␣-synuclein (34). Very recently a mutation in the DJ-1 gene was reported with autosomal recessive early-onset Parkinsonism (35). Database comparison suggests the involvement of DJ-1 protein in the oxidative stress response. It is of great interest that ubiquitin-conjugation is not required for the degradation of oxidized proteins by the proteasome (36). Indeed, it was reported that ␣-synuclein metabolism and aggregation are linked to ubiquitin-independent degradation by the proteasome (37). The fact that in LBD as well as in MSA, ␣-synuclein is more prominent in cells than ubiquitin (Fig. 4), also points to a less important role for general proteasome dysfunction in synucleinopathies (ref 38; R. A. I. de Vos, unpublished data). Nevertheless, it was also shown that a loss of ␣ subunits of the proteasome occurs in the substantia nigra in Parkinson’s disease (39). However, it has been suggested that a systemic, global disturbance in the catalytic activity and degradation ability of the proteasome itself is probably not causal for Parkinson disease (40, 42, 46). In conclusion, the presence of UBB⫹1 protein in neuronal and glial inclusions acts as a reporter for an impaired activity of the proteasome in these cells. We believe that UBB⫹1 levels can be used as a general measure for proteasome inhibition in a variety of human tissues (e.g., the liver; ref 31). The accumulation of ubiquitinated UBB⫹1 could inhibit the proteasome even further (10 –12), an aspect that is under further study. Apparently, proteasomal activity in tauopathies is more severely impaired compared with synucleinopathies. We thank Dr. Naldini of the Institute for Cancer Research, University of Torino Medical School, Italy for the lentiviral plasmids and protocols. We thank Simone Niclou, Ruben Eggers, and Joost Verhaagen for their help with the lentiviral experiments and Inge Huitinga for the experiments on MS. We thank Dr. J. M. Ruijter (University of Amsterdam) for his critical remarks and Nienke Nieuwenhuizen, Olga Pach, Wilma Verweij, and Gerben van der Meulen for their skilled assistance. We are grateful to the technicians of the NetherMUTANT UBIQUITIN IN TAUO- AND SYNUCLEINOPATHIES

lands Brain Bank (Anne Holtrop, Michiel Kooreman, Jose´ Wouda, and Afra van den Berg; coordinator Rivka Ravid, Amsterdam, the Netherlands), to G. Jansen, C. W. M. van Veelen, and P. C. van Rijen (Utrecht Medical Centre) for supplying brain material and to P. Davies (New York) for MC1 antiserum. Dr. R. Benne and the Department of Biochemistry of the University of Amsterdam are thanked for helpful discussions and the use of the STORM apparatus, respectively. Financial support was given by the 5th Framework “Quality of life and management of living resources” EU grant (QLRT-1999-02238), IBRO (research fellowship M. Zouambia), The van Leersum Foundation, Human Frontier Science Program Organization (HFSP: RG0148/1999-B), Hersenstichting Nederland (H00.06), Platform Alternatieven voor Dierproeven (#98-19) Jan Dekker en dr. Ludgardine Bouwmanstichting, Internationale Stichting Alzheimer Onderzoek (ISAO), Van Leersum Fund, and NWO Geheugenprocessen en Dementie.

REFERENCES 1. 2. 3.

4.

5.

6.

7.

8. 9. 10.

11.

12.

Selkoe, D. J. (2001) Alzheimer’s disease: genes, proteins, and therapy. Physiol. Rev. 81, 741–766 Lee, V. M., Goedert, M., and Trojanowski, J. W. (2001) Neurodegenerative tauopathies. Annu. Rev. Neurosci. 24, 1121–1159 Corder, E. H., Saunders, A. M., Strittmatter, W. J., Schmechel, D. E., Gaskell, P. C., Small, G. W., Roses, A. D., Jaines, J. L., and Pericak-Vance, M. A. (1993) Gene dose of apolipoprotein E type 4 allele and the risk of Alzheimer’s disease in late onset families. Science 261, 921–933 Swaab, D. F., Lucassen, P. J., Salehi, A., Scherder, E. J. A., Van Someren, E. J. W., and Verwer, R. W. H. (1998) Reduced neuronal activity and reactivation in Alzheimer’s disease. In Neuronal Degeneration and Regeneration: From Basic Mechanisms to Prospects for Therapy (Van Leeuwen, F. W., Salehi, A., Giger, R. J., Holtmaat, A. J. G. D., and Verhaagen, J., eds) Progress in Brain Research, Vol. 117, pp. 343–377, Elsevier, Amsterdam Van Broeckhoven, C. (1998) Alzheimer’s disease: identification of genes and genetic risk factors. In Neuronal Degeneration and Regeneration: From Basic Mechanisms to Prospects for Therapy (Van Leeuwen, F. W., Salehi, A., Giger, R. J., Holtmaat, A. J. G. D., and Verhaagen, J., eds) Progress in Brain Research, Vol. 117, pp. 315–325, Elsevier, Amsterdam Van Leeuwen, F. W., Fischer, D. F., Kamel, D., Sluijs, J. A., Sonnemans, M. A. F., Benne, R., Swaab, D. F., Salehi, A., and Hol, E. M. (2000) Molecular misreading: a new type of transcript mutation expressed during aging. Neurobiol. Aging 21, 879 – 891 Van Leeuwen, F. W., De Kleijn, D. P. V., Van den Hurk, W. H., Neubauer, A., Sonnemans, M. A. F., Sluijs, J. A., Ko¨ ycu¨ , S., Ramdjielal, R. D. J., Salehi, A., and Martens, S. J., et al. (1998) Frameshift mutants of ␤ amyloid precursor protein and ubiquitin-B in Alzheimer’s and Down patients. Science 279, 242–247 Van den Hurk, W. H., Willems, H. J., Bloemen, M., and Martens, G. J. (2001) Novel frameshift mutations near short simple repeats. J. Biol. Chem. 276, 11496 –11498 Van Leeuwen, F. W., Burbach, J. P. H., and Hol, E. M. (1998) Mutations in RNA: a first example of molecular misreading in Alzheimer’s disease. Trends Neurosci. 21, 331–335 Lam, Y. A., Pickart, C. M., Alban, A., Landon, M., Jamieson, C., Ramager, R., Mayer, R. J., and Layfield, R. (2000) Inhibition of the ubiquitin-proteasome system in Alzheimer’s disease. Proc. Natl. Acad. Sci. USA 97, 9902–9906 Lindsten, K., De Vrij, F. M., Verhoef, L. G., Fischer, D. F., Van Leeuwen, F. W., Hol, E. M., Masucci, M. G., and Dantuma, N. P. (2002) Mutant ubiquitin found in neurodegenerative disorders is a ubiquitin fusion degradation substrate that blocks proteasomal degradation. J. Cell Biol. 157, 417– 427 De Vrij, F. M. S., Sluijs, J. A., Gregori, L., Fischer, D. F., Hermens, W. T. J., Goldgaber, D., Verhaagen, J., Van Leeuwen, F. W., and Hol, E. M. (2001) Mutant ubiquitin expressed in Alzheimer’s disease causes neuronal death. FASEB J. 15, 2680 – 2688

2023

13. 14. 15. 16. 17. 18. 19.

20.

21.

22. 23. 24.

25.

26.

27. 28.

29. 30.

31.

2024

Braak, H., and Braak, E. (1998) Argyrophilic grain disease: frequency of occurrence in different age categories and neuropathological diagnostic criteria. J. Neural Transm. 105, 801– 819 Spillantini, M. G., and Goedert, M. (1998) Tau protein pathology in neurodegenerative diseases. Trends Neurosci. 21, 428 – 433 Spillantini, M. G., Schmidt, M. L., Lee, V. M., Trojanowski, J. Q., Jakes, R., and Goedert, M. (1997) Alpha-synuclein in Lewy bodies. Nature (London) 388, 839 – 840 Goedert, M. (2001) The significance of tau and alpha-synuclein inclusions in neurodegenerative diseases. Curr. Opin. Genet. Dev. 11, 343–351 Barany, F. (1991) Genetic disease detection and DNA amplification using cloned thermostable ligase. Proc. Natl. Acad. Sci. USA 88, 189 –193 Alves-Rodrigues, A., Gregori, L., and Figueiredo-Pereira, M. E. (1998) Ubiquitin, cellular inclusions and their role in neurodegeneration. Trends Neurosci. 21, 516 –520 Jicha, G., Bowser, A. R., Kazam, I. G., and Davies, P. (1997) Alz-50 and MC 1, a new monoclonal antibody raised to paired helical filaments, recognize conformational epitopes on recombinant tau. J. Neurosci. Res. 48, 128 –132 Naldini, L., Blomer, U., Gage, F. H., Trono, D., and Verma, I. M. (1996) Efficient transfer, integration, and sustained long-term expression of the transgene in adult rat brains injected with a lentiviral vector. Proc. Natl. Acad. Sci. USA 93, 11382–11388 Naldini, L., Blomer, U., Gallay, P., Ory, D., Mulligan, R., Gage, F. H., Verma, I. M., and Trono, D. (1996) In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science 272, 263–267 Paxinos, G., and Watson, C. (1998) The Rat Brain in Stereotaxic Coordinates, Academic Press, Sydney, 4th ed. Wiedmann, M., Wilson, W. J., Czajka, J., Luo, J., and Batt, C. A. (1994) Ligase chain reaction (LCR)Ooverview and applications. PCR Methods Appl. 3, S51–S64 Fergusson, J., Landon, M., Lowe, J., Ward, L., Van Leeuwen, F. W., and Mayer, R. J. (2000) Neurofibrillary tangles in progressive supranuclear palsy brains exhibit immunoreactivity to frameshift mutant ubiquitin-B protein. Neurosci. Lett. 279, 69 –72 Braak, H., Del Tredici, K., Bohl, J., Bratzke, H., and Braak, E. (2000) Pathological changes in parahippocampal region in select non-Alzheimer’s dementias. Ann. N. Y. Acad. Sci. 911, 221–239 Hutton, M., Lendon, C. L., Rizzu, P., Baker, M., Froehlich, S., Houlden, H., Pickering-Brown, S., Chakraverty, S., and Isaacs, A. (1998) Association of missense and 5⬘-splice-site mutations in tau with the inherited dementia FTDP-17. Nature (London) 393, 702–705 Ingram, E. M., and Spillantini, M. G. (2002) Tau gene mutations: dissecting the pathogenesis of FTDP-17. Trends Mol. Med. 8, 555–562 Poorkaj, P., Grossman, M., Steinbart, E., Payami, H., Sadnovnick, A., Nochlin, D., Tabira, T., Trojanowski, J. Q., Borson, S., Galasko, D., et al. (2001) Frequency of tau gene mutations in familial and sporadic cases of non-Alzheimer dementia. Arch. Neurol. 58, 383–387 Huitinga, I., De Groot, C. J. A., Van der Valk, P., Kamphorst, W., Tilders, F. J. H., and Swaab, D. F. (2001) Hypothalamic lesions in multiple sclerosis. J. Neuropathol. Exp. Neurol. 60, 1208 –1218 Evans, D. A. P., Van der Kleij, A. A. M., Sonnemans, M. A. F., Burbach, J. P. H., and Van Leeuwen, F. W. (1994) Frameshift mutations at two hotspots in vasopressin transcripts in postmitotic neurons. Proc. Natl. Acad. Sci. USA 91, 6059 – 6063 McPhaul, L. W., Wang, J., Hol, E. M., Sonnemans, M. A. F., Riley, N., Nguyen, V., Yuan, Q. X., Lue, Y. H., Van Leeuwen, F. W., and French, S. W. (2002) Molecular misreading of the ubiquitin B gene and hepatic Mallory body formation. Gastroenterology 122, 1878 –1885

Vol. 17

November 2003

32. 33. 34.

35.

36.

37. 38.

39.

40.

41. 42.

43.

44.

45.

46.

47.

Schwartz, A. L., and Ciechanover, A. (1999) The ubiquitinproteasome pathway and pathogenesis of human diseases. Annu. Rev. Med. 50, 57–74 Bence, N. F., Sampat, R. M., and Kopito, R. R. (2001) Impairment of the ubiquitin-proteasome system by protein aggregation. Science 292, 1552–1555 Hasegawa, M., Fujiwara, H., Nonaka, T., Wakabayashi, K., Takahashi, H., Lee, V. M., Trojanowski, J. Q., Mann, D., and Iwatsubo, T. (2002) Phosphorylated alpha-synuclein is ubiquitinated in alpha-synucleinopathy lesions. J. Biol. Chem. 277, 49071– 49076 Bonifati, V., Rizzu, P., Van Baren, M. J., Schaap, O., Breedveld, G. J., Krieger, E., Dekker, M. C., Squitieri, F., Ibanez, P., Joosse, M., et al. (2003) Mutations in the DJ-1 gene associated with autosomal recessive early-onset Parkinsonism. Science 299, 256 –259 Shringarpure, R., Grune, T., Mehlhase, J., and Davies, K. J. (2002) Ubiquitin-conjugation is not required for the degradation of oxidized proteins by the proteasome. J. Biol. Chem. 278, 311–318 Tofaris, G. K., Layfield, R., and Spillantini, M. G. (2001) ␣-Synuclein metabolism and aggregation is linked to ubiquitinindependent degradation by the proteasome. FEBS Lett. 509, 22–26 Spillantini, M. G., Crowther, R. A., Jakes, R., Ciarns, N. J., Lantos, P. L., and Goedert, M. (1998) Filamentous ␣-synuclein inclusions link multiple system atrophy with Parkinson’s disease and dementia with Lewy bodies. Neurosci. Lett. 251, 205–208 McNaught, K., St. P., Belizaire, R., Jenner, P., Olanow, C. W., and Isaacson, O. (2002) Selective loss of 20S proteasome ␣-subunits in the substantia nigra pars compacta in Parkinson’s disease. Neurosci. Lett. 326, 155–158 Furukawa, Y., Vigouroux, S., Wong, H., Guttman, M., Rajput, A. H., Ang, L., Briand, M., Kish, S. J., and Briand, Y. (2002) Brain proteasomal function in sporadic Parkinson’s disease and related disorders. Ann. Neurol. 51, 779 –782 Keller, J. N., Hanni, K. B., and Markesbery, W. R. (2000) Impaired proteasome function in Alzheimer’s disease. J. Neurochem. 75, 436 – 439 Leroy, E., Boyer, R., Auburger, G., Leube, B., Ulm, G., Mezey, E., Harta, G., Brownstein, M. J., Jonnalagada, S., Chernova, T., et al. (1998) The ubiquitin pathway in Parkinson’s disease. Nature (London) 395, 451– 452 Saigoh, K., Wang, Y.-L., Suh, J.-G., Yamanishi, T., Sakai, Y., Kiyosawa, H., Harada, T., Ichihara, N., Wakana, S., Kikuchi, T., et al. (1999) Intragenic deletion in the gene encoding ubiquitin carboxy-terminal hydrolase in gad mice. Nat. Genet. 25, 47–51 Cummings, C. J., Reinstein, E., Sun, Y., Antalffy, B., Jiang, Y., Ciechanover, A., Orr, H., Beaudet, A. L., and Zoghbi, H. Y. (1999) Mutation of the E6-AP ubiquitin ligase reduces nuclear inclusion frequency while accelerating polyglutamine-induced pathology in SCA1 mice. Neuron 24, 879 – 892 Shimura, H., Schlossmacher, M. G., Hattori, N., Frosch, M. P., Trockenbacher, A., Schneider, R., Mizuno, Y., Kosik, K. S., and Selkoe, D. J. (2001) Ubiquitination of a new form of ␣-synuclein by parkin from human brain: implications for Parkinson’s disease. Science 293, 263–269 Liu, Y., Fallon, L., Lashuel, H. A., Liu, Z., and Lansbury, P. T., Jr. (2002) The UCH-L1 gene encodes two opposing enzymatic activities that affect alpha-synuclein degradation and Parkinson's disease susceptibility. Cell 111, 209 –218 Keck, S., Nitsch, R., Grune, T., and Ullrich, O. (2003) Proteasome inhibition by paired helical filament-tau in brains of patients with Alzheimer's disease. J. Neurochem. 85, 115–122

The FASEB Journal

Received for publication March 25, 2003. Accepted for publication June 12, 2003.

FISCHER ET AL.