Distinctive gene expression profile deregulated by ... - Semantic Scholar

Download PDF
3 downloads 67 Views 2MB Size Report
Comment
Aug 7, 2002 - analyzed gene expression profiles by serial analysis of gene .... to gene map“ (SAGEmap) from the Cancer Genome Anatomy Project at the ...
The FASEB Journal express article 10.1096/fj.02-0074fje. Published online August 7, 2002.

SAGE transcript profiles of normal primary human hepatocytes expressing oncogenic hepatitis B virus X protein Chuan-Ging Wu,*,‡Marshonna Forgues,* Shabina Siddique,* Julie Farnsworth,† Kristoffer Velerie,† and Xin Wei Wang* *

Laboratory of Human Carcinogenesis, Center for Cancer Research, National Cancer Institute, Bethesda, MD 20892-4255, ‡Division of Hematology, Center for Biologies Evaluation and Research, Food and Drug Administration, Bethesda, MD, and †Department of Radiation Oncology, Medical College of Virginia, Richmond, VA 23298-0058

Corresponding author: Xin Wei Wang, Laboratory of Human Carcinogenesis, National Cancer Institute, National Institutes of Health, 37 Convent Dr., MSC 4255, Building 37, Room 2C25, Bethesda, MD 20892-4255. E-mail: [email protected] ABSTRACT Hepatitis B virus (HBV) is a major risk factor for hepatocellular carcinoma (HCC). HBV encodes an oncogenic HBx gene that functions as a transcriptional coactivator of multiple cellular genes. To understand the role(s) of HBx in the early genesis of HCC, we systematically analyzed gene expression profiles by serial analysis of gene expression (SAGE) in freshly isolated human primary hepatocytes infected with a replication-defective adenovirus containing HBx. A total of 19,501 sequence tags (representing 1443 unique transcripts) were analyzed, which provide a distribution of a transcriptome characteristic of normal hepatocytes and a profile associated with HBx expression. Examples of the targeted genes were confirmed by the Megarray analysis with a significant correlation between quantitative SAGE and Megarray (r = 0.8, P < 0.005). In HBx-expressing hepatocytes, a total of 57 transcripts (3.9%) were induced, and 46 transcripts (3.3%) were repressed by more than fivefold. Interestingly, most of the HBxup-regulated transcripts can be clustered into three major classes, including genes that encode ribosomal proteins, transcription factors with zinc-finger motifs, and proteins associated with protein degradation pathways. These results suggest that HBx may function as a major regulator in common cellular pathways that, in turn, regulate protein synthesis, gene transcription, and protein degradation. Key words: liver cancer • Megarray • nuclear export signal

H

epatitis B virus (HBV) is a major etiological factor of hepatocellular carcinoma (HCC) that has been broadly acknowledged (reviewed in refs 1–7). HBV encodes four overlapping open-reading frames, including PreS/S, PreC/C, P, and HBx. HBV is often integrated in various truncated forms into the host genome during HCC development, and the integrated HBx appears to be the most frequent viral marker found in HCC (8, 9). HBx expression is detected in a high percentage of human livers chronically infected with HBV and also in HCC (10, 11). Taken together, these results indicate that HBx possesses an intrinsic property contributing to HBV-mediated oncogenicity. Consistently, HBx was found to be

essential for HBV viral replication in vivo and can be oncogenic in certain strains of transgenic mice (12–16). HBx is considered to be a transcriptional coactivator of many genes without any detectable DNA-binding activity, and it exerts a pleiotropic effect on diverse cellular functions (6, 17–19). Although the precise mechanism by which HBx regulates transcription is unclear, it is thought that the pleiotropic functions of HBx are mainly the results of its ability to deregulate cellular genes. Consequently, HBx can modulate several cellular processes, including the stimulation of cell proliferation, abrogation of p53-mediated apoptosis, activation of mitogen activation protein kinase (MAPK) pathways, and the induction of apoptosis by altering tumor necrosis factor (TNF)α and NFκB signaling pathways (6, 17). More recently, we showed that HBx activates NFκΒ by inducing its nuclear translocation in a nuclear export signal (NES)-dependent manner (20). We hypothesized that a persistent alteration of multiple cellular genes by HBx may provide a growth advantage for hepatocytes and may contribute to HCC development. Therefore, a systematic analysis of gene expression on a global genome scale may be helpful in understanding the molecular mechanism of HBx. Gene expression in mammalian cells is highly complex, and the complexity of their transcription is dependent on tissue type. Techniques such as subtractive hybridization, differential display, subtraction-enhanced differential display, and the expressed sequence tag (EST) approach (21, 22) do not provide the abundance of a certain gene or its expression pattern. Two novel techniques, namely serial analysis of gene expression (SAGE) and cDNA microarray (23, 24), offer promise for the analysis of gene expression on a global genome scale. Recently, we have determined a common gene expression pattern that is associated with HBx in primary normal hepatocytes and in liver samples from chronic active hepatitis patients (25). However, the cDNA microarray approach limits our detection only to those genes that are available on the arrays. In addition, the cDNA microarray technique is relatively insensitive in detecting genes with low abundances. In this study, we have applied SAGE to compare expression profiles in human primary hepatocytes expressing HBx transiently. In addition to previously known target genes, we have identified many novel transcripts that may be potential targets of HBx. Strikingly, most of the liver genes up-regulated by HBx expression can be clustered into three major groups, including genes encoding ribosomal proteins, transcription factors with zinc-finger motifs, and proteins associated with protein degradation pathways. These results led us to generate the hypothesis that HBx may function as a major regulator in a common cellular pathway that, in turn, regulates protein synthesis, gene transcription, and protein degradation. MATERIALS AND METHODS Construction of high titered adenovirus encoding HBx Recombinant adenoviruses were made by the Massey Cancer Center Virus Vector Shared Resource, Medical College of Virginia, Virginia Commonwealth University, as described previously (25). In brief, a hemaglutanin (HA) epitope-tagged HBx cDNA (adr subtype) was inserted into the adenovirus transfer plasmid, pZerotag-TGCMV, between the HindIII and ClaI

sites, which were then cloned into the adenovirus (E1-, E3-). The resulting adenoviruses (AdHBx, carrying HBx; and Ad-CMV, a control virus without an insert) were amplified in 293 cells. High titer viruses were selected as previously described (25). HBx expression in normal human primary hepatocytes Freshly isolated normal human primary hepatocytes were obtained through BioWhittaker (Walkersville, MD) or the LTPADS program of University of Minnesota from organ donors who died of trauma. These cells were plated in fibronectin-coated plates at a density of 1 × 105 cells per cm2 and were maintained in hepatocyte culture medium (HCM) medium (BioWhittaker) for 24 h before adenovirus infection. Hepatocytes were infected with Ad-HBx or Ad-CMV at multiplicity of infection (MOI) of 5 and were incubated for an additional 48 h before harvesting. HBx expression was detected by Western blot analysis, using anti-HBx monoclonal antibody as reported previously (25, 26), and Northern blot analysis. RNA extraction Isolation of total RNA from cell cultures was performed by adding Trizol reagent directly to the culture flask and following the manufacturer’s protocol (Gibco BRL, Gaithersburg, MD). The quality of extracted RNA was determined by the presence of the characteristic 28S and 18S rRNA fragments on a 1% agarose gel. SAGE SAGE analysis was performed according to the SAGE protocol (23), with the following modifications: Ditags were polymer chain reaction (PCR)-amplified using biotinylated primers and digested with NlaIII enzyme. Concatemers were heated for 15 min at 65°C and chilled on ice for 10 min before being separated on an 8% polyacrylamide gel. The concatemers were then cloned into the SphI site of the pZero vector (Invitrogen, Carlsbad, CA). Concatenated tags were screened by PCR, using M13 forward and reverse primers. PCR products with inserts >500 bp were isolated and sequenced with the M13 forward primer on an automated ABI 310 DNA sequencer (Perkin-Elmer, Wellesley, MA). SAGE data analysis The SAGE libraries were analyzed with the SAGE 300 program software package. Tags were matched to the SAGE reliable map (release 10/26/2000). P values were calculated using Monte Carlo simulations. Transcripts were identified by comparing the tags in the database with the “tag to gene map” (SAGEmap) from the Cancer Genome Anatomy Project at the NCBI (http://www.ncbi.nlm.nih.gov/SAGE). This database links Unigene clusters to SAGE tags. The gene assignments were checked subsequently by hand for sequencing errors causing incorrect tags and for erroneous gene assignments based on hybrid Unigene clusters.

Northern blot analysis Northern blot analysis was conducted as described previously (27). Total RNA (10 µg) was separated on a 1% agarose gel stained with ethidium bromide. The RNA was then transferred to a Hybond-N nylon membrane (Amersham Pharmacia, Piscataway, NJ). The HBx probe was labeled with α-32P-dCTP (Amersham) according to the hexamer-random-primed method following the manufacturer’s protocol (Promega, Madison, WI). Megarray analysis To simultaneously quantify multiple gene expression levels, more than 40 cDNA clones (20–40 ng, Research Genetics, Carlsbad, CA) corresponding to genes identified by SAGE were loaded in duplicate onto Hybond-N nylon membranes (Amersham). After ultraviolet (UV) cross-linking, the membranes were prehybridized for 1 h at 65°C in 6XSSC (saline sodium citrate), 5× Denhardt’s solution, 0.5% sodium dodecyl sulfate (SDS), 100 µg/µl of herring sperm DNA. Probes were labeled with α-32P-dCTP (Amersham), with 50 µg of total RNA from HBxexpressing hepatocytes and control, following a reverse transcription reaction according to the manufacturer’s protocol (Gibco BRL). Membranes were hybridized under the same conditions as stated for prehybridization overnight and were then washed four times for 15 min, each time with 1× SSC/0.1% SDS and once with 0.2× SSC/0.1% SDS at 65°C. The membranes were exposed and scanned with a Phosphorimager radio-analytic scanning system (Fuji Medical Systems, Stamford, CT) to quantify the amount of radioactivity of individual dots. The glyceraldehyde-3phosphate dehydrogenase (GAPDH) signal was used to normalize the intensity of each sample dot. Semiquantitative reverse transcriptase-polymer chain reaction (RT-PCR) analysis To determine whether the multiple gene deregulation by HBx was mediated by its nuclear translocation in an NES-dependent manner, semi-quantitative RT-PCR was performed with primers of HBx (5'-ATGGCTGCTCGGGTGTG and 5'-GGCAGAGGTGAAAAAGTTG), ribosomal protein L26 (5'-GTTTAATCCCTTTGTGACTTCC and 5'-TATTTGCCCTTTTCCTTTCCTACT), ribosomal protein L14 (5'-CCGGGTGGCCTATGTCTCCTT and 5'AGCAGCAGCAGCAGCAGCAGTA), ribosomal protein L4 (5'CAGGGGCCCGTGCATCATCTAT and 5'-GCAACCGCCGCCTTCTCATCT), and 18S ribosomal RNA from Ambion (Gaithersburg, MD). The reverse transcription reaction was conducted from total RNA (10 ng) isolated from primary hepatocytes infected with an adenovirus containing mutant HBx-NES, wild-type HBx, and control, respectively. RESULTS SAGE libraries in human primary hepatocytes expressing HBx To systematically analyze the gene expression profiles and to identify target genes deregulated by HBx, we applied the SAGE technique to human primary hepatocytes expressing HBx. Freshly isolated human hepatocytes have a very low proliferative capacity. To ensure a high efficiency of HBx expression in these cells, we constructed an adenoviral vector encoding HBx.

Ad-HBx infection at an MOI of 5 resulted in an efficient HBx expression in freshly isolated hepatocytes, determined by Western blotting with anti-HBx monoclonal antibodies and Northern blot analysis (Fig. 1A). No visible cytotoxic effect was observed in hepatocytes infected with Ad-HBx or Ad-CMV at this MOI (data not shown). SAGE libraries were constructed from AdHBx and Ad-CMV-infected human primary hepatocytes. A total of 19,501 tags were generated, in which 9815 were from Ad-HBx-infected primary hepatocytes and 9686 were from control AdCMV (Table 1). Sequence analysis identified a total of 1184 distinct genes from the Ad-HBxinfected primary hepatocytes and 1426 from the control. In total, 93% were known genes, 2.2% were ESTs, 3.6% were unknown transcripts as listed in the SAGE database, and 1.2% were unmatched in the SAGE database. The introduced HBx gene also contains a SAGE tag (GAGACCACCG). The MOI dose used in this experiment produced a moderate abundance of HBx transcripts, which represented 0.14% of total transcripts analyzed, similar to the expression of genes encoding profilin1, gelsolin, or apolipoproteins. The abundance of HBx transcripts is less than that of many other cellular transcripts, such as β-actin (0.2%), ferritin (0.25%), GAPDH (0.38%), antitrypsin (0.68%), albumin (0.78%), and M-phase phosphoprotein homologue (2.73%). Gene expression pattern characteristic of normal hepatocytes From nearly 10,000 SAGE tags analyzed in normal human hepatocytes, we have listed about 70 genes that were expressed in most abundance, and these genes represented >19% of the total transcripts analyzed. Examples of these transcripts include albumin, antitrypsin, serum amyloid A1, orosomucoid 1, and glucose phosphate isomerase, which represent most abundant liverspecific genes, as well as many common housekeeping genes such as actins, myosin, GAPDH, and many ribosomal genes. Data are summarized in Table 2. The profile of the differentially expressed genes deregulated by HBx In the transcripts analyzed, 81.6% were not altered by HBx expression, whereas 9.8% were induced and 8.6% were repressed more than threefold (Fig. 1B). A total of 57 genes were upregulated more than fivefold (Table 3), which includes two genes with a more than 10-fold increase in HBx-expressing cells. A total of nine unknown genes were identified. We designated these genes as XIG1-9 (HBx-induced genes 1-9). Most of the known genes were categorized as enzymes, transcription factors, and ribosomal proteins. In contrast, 46 genes were downregulated at least fivefold, and many of them are either unknown genes or ESTs, including four genes over a 10-fold decrease compared with the control (Table 4). We designated these genes as XSG1-22 (HBx-suppressed genes 1-22). Validation of SAGE data by Megarray To validate the identity and the quantification of genes identified by SAGE, we selected 39 known genes according to the gene consortium databases (Research Genetics) that matched our SAGE tags. These clones were chosen on the basis of their known identity and their wide ranges of expression profiles. Two unknown clones also were included in this analysis. The cDNA of these clones were quantitatively spotted in an array manner onto a 5 × 6 cm membrane, which we named Megarray.

Probes were made from the same RNA samples used for the SAGE library construction, and derived from primary hepatocytes infected with either Ad-HBx or Ad-CMV by reverse transcription with 32P-labeling. Probes were then hybridized to the Megarray in duplicates (Fig. 2A). The ratios of the dot intensity between Ad-HBx and Ad-CMV were plotted against the folds of SAGE tags (Fig. 2B). There is a significant correlation between the two methods (r = 0.8, P < 0.005), with an exception of only three clones. A summary of the actual quantitative results is shown as supplementary Table 1. Among these three clones, the SAGE tag (ACTGGGGAAT) that was originally identified as Ran-binding protein 1 was shown to have a wrong identity, because of an error in the Unigene database. Thus, the Megarray analysis proved to be a useful tool to validate our SAGE data and provides confidence for the identity of the HBx-targeted transcripts. Up-regulation of genes involved in protein synthesis, gene transcription, and protein degradation Close inspection of the liver cell transcripts that were up-regulated by HBx revealed an interesting gene expression profile. HBx expression in primary human hepatocytes appeared to be associated with an induction of genes belonging to three categories. From a total of 71 ribosomal protein transcripts identified, 35 of them are increased twofold or greater in HBxexpressing hepatocytes (Table 5). The other two categories included nine transcripts encoding transcription factors with a zinc-finger motif and nine transcripts encoding proteasome subunits and ubiquitin or ubiquitin-associated proteins, respectively. Some of the ribosomal genes L4, L26, and L38 showed a significant change in response to HBx expression with an increase of six-, seven-, or eightfold, respectively. Some of the ribosomal transcripts can only be detected in the HBx group. Similarly, all of nine transcription factors with zinc-finger motifs and seven of nine proteasome-associated factors were undetectable in the CMV group. It is possible that the magnitudes of induction in these transcripts by HBx expression may be underestimated. Activation of ribosomal genes by HBx is independent of the presence of an NES motif HBx is a nuclear-cytoplasmic shuttling protein primarily localized at the cytoplasm due to the presence of an NES sequence (20). We sought to determine whether the multiple gene deregulations by HBx are through a nuclear export pathway in a NES-dependent manner. We used a semiquantitative RT-PCR and analyzed the expression level of three representative ribosomal transcripts (RPL26, RPL14, and RPL4) as standardized by 18S ribosomal RNA, in primary hepatocytes infected with an adenovirus containing wild-type HBx or an exportdeficient HBx mutant with mutations at its NES motif. We found no significant difference between mutant and wild-type HBx expressions of all three ribosomal proteins (Fig. 3). These data indicate that HBx-mediated gene deregulation, at least for ribosomal proteins, is associated with other mechanisms rather than its NES motif. DISCUSSION SAGE has been used recently for analyzing human transcriptomes (28), identifying markers for cancer (29), and providing gene expression profiles of particular diseases (30, 31). In an effort to better understand the functions of HBx at the molecular level, we have generated global gene

expression profiles from normal primary human hepatocytes and HBx-expressing hepatocytes. A total of 19,501 SAGE tags were analyzed in this study, and a group of genes differentially expressed between Ad-HBx-infected hepatocytes and control were identified. Although this SAGE library may represent only ∼20% of the entire transcriptome of human primary hepatocytes, the profile displays a unique molecular fingerprint representing human hepatocytes and HBx expression. First, the transcriptome of the control group appears to be tightly linked to the expression profile predicted in normal hepatocytes. Among genes that represent 19% of total transcripts analyzed with a relative abundance of 0.12% or greater, the liver-specific genes such as albumin (0.78%), serum amyloid A1 (0.75%), antitrypsin (0.68%), orosomucoid 1 (0.34%), and ferritin (0.25%) were positively identified. Other common housekeeping genes such as βactin (0.20%), GAPDH (0.38%), and myosin (0.20%) were also identified. Second, we found that the HBx transcript (0.14%) was detected only in the HBx-infected hepatocyte library, which served as an ideal experimental control. The relatively low abundance of HBx transcripts in these samples suggests that HBx is not overproduced. Third, our Megarray analysis provides a confirmation for most of the representative genes in a quantitative manner, indicating that SAGE tags are an accurate representation of individual transcripts for the transcriptome of human hepatocytes. Fourth, it is striking that most of the genes up-regulated by HBx expression can be grouped into three major categories, namely, ribosomal proteins, transcription factors with zincfinger motifs, and proteins that are involved in the proteosome-mediated protein degradation pathway. These results indicate that HBx may function as a major regulator in a common cellular pathway that, in turn, regulates protein synthesis, gene transcription, and protein degradation. For the first time, we have showed the transcriptome of isolated primary normal human hepatocytes, which may provide a useful database for future SAGE analysis of liver diseases. The liver-specific genes such as albumin, glucose phosphate isomerase, serum amyloid A1, antitrypsin, orosomucoid 1, and ferritins are expressed with relatively high abundance in isolated normal human hepatocytes. These results are consistent with the recent data obtained from normal liver tissue (31). Interestingly, the most abundant genes in these cells are M-phase phosphoprotein homologue (2.73%), prolactin (0.89%), and an unknown EST clone (0.96%), which are also ubiquitously present in many other SAGE databases from different cell types, suggesting they may function as housekeeping genes in cells. Among the 57 up-regulated genes (≥ fivefold) in HBx-expressing hepatocytes, the three most differentially expressed transcripts are lipopolysccharide-binding protein (LBP) (>fivefold), XIG2 (>20fold) and XIG1 (>fivefold). The significance of the two most differentially expressed novel genes is under investigation. LBP is known for its essential role in inflammatory-mediated responses (32). Although the significance of up-regulation of LBP by HBx in primary hepatocytes is unclear, it is possible that this may be a stress response because of the viral HBx protein expression. Another interesting gene, encoding an RNA polymerase II elongation factor ELL2, is a frequent target for translocation in acute myeloid leukemia (33). It is interesting to speculate that ELL2 may play an oncogenic role in HBx-mediated liver cell transformation and that HBx may up-regulate ELL2, thereby deregulating the transcription of many other cellular genes that are under the control of RNA pol II transcriptional regulation. However, among the 46 down-regulated transcripts, at least 22 transcripts are novel genes. Examples of interesting targeted genes are nucleophosmin 1, tissue inhibitor of metalloproteinase (TIMP1), and NM23B. Nucleophosmin 1 is involved in centrosome duplication, and abnormal centrosome duplication is

closely associated with tumor aneuploidy (34). NM23B and TIMP1 are involved in the suppression of tumor metastasis (35). It is possible that HBx may promote metastasis of HCC by repressing the expression of these genes. Gene expression profiling is a useful tool to generate hypotheses (as illustrated in Figure 4). Recently, we found in a microarray study that several groups of genes including cell cyclerelated genes, oncogenes, and tumor suppressors were deregulated in hepatocytes expressing HBx, suggesting that the HBx expression may favor cell proliferation (25). In the present study, we have observed that genes of many ribosomal proteins were highly expressed, up to eightfold in HBx-expressing hepatocytes. Interestingly, a recent report by Boon showed that many ribosomal genes also were up-regulated by c-myc expression, a target known to be regulated by HBx (36). It is plausible that HBx may induce c-myc expression, thereby inducing ribosomal genes, which may be necessary to enhance protein synthesis during HBx-stimulated cell proliferation and cell transformation. In addition, we observed that many transcription factors, including the zinc-finger protein family such as c-myc associated zinc-finger protein and zfp-36 (37, 38) as well as activating transcription factor 4 (39), were induced in HBx-expressing hepatocytes. Moreover, we found that HBx can induce the expression of genes belonging to the protein degradation pathway such as ubiquitin, ubiquitin-specific protease 25, and proteasome alpha type 2, which is consistent with a recent study that HBx both structurally and functionally interacted with proteasome complex resulting in the transactivation of multiple genes (40). The up-regulation of proteins in proteasome complex could be a feedback response to eliminate overexpressed HBx in hepatocytes after infection. An increase in expression of these genes by HBx may explain the unusual ability of HBx to function as a transcription coactivator of multiple genes. We developed a Megarray method to validate the SAGE data that allows us to detect multiple genes simultaneously. We observed a linear correlation between the intensity measured by the Phosphoimager and the varied amount (ranging from 5 to 160 ng) of DNA loaded on array (data not shown). From a total of 41 representative genes identified by SAGE, we found a significant correlation between the intensity ratio detected by Megarray and the fold changes in transcripts detected by SAGE analysis of most genes differentially expressed from HBx-expressing cells. This analysis demonstrates the feasibility of SAGE and that Megarray is a useful and efficient tool to validate expression profiles. Moreover, our Megarray also provides another advantage that facilitates the comparison of the relative abundance among the detected genes on the same array, which is especially useful for the validation of SAGE data. Only 3 of 41 genes showed inconsistency by these two methods. Among them, RanBP1 was shown as down-regulated by the SAGE analysis but as up-regulated by the Megarray analysis. It was found that this inconsistency was the result of the incorrect identity of this gene due to database errors in the Unigene cluster. The leucine-rich NES that HBx harbors is used to shuttle large cellular proteins from the nucleus to the cytoplasm. We have recently demonstrated that HBx is a nuclear-cytoplasmic shuttling protein and is mainly exported to the cytoplasm through its presence of NES motif. Moreover, HBx activates NFκΒ by inducing its nuclear translocation in an NES-dependent manner (20). We hypothesized that HBx may influence cellular gene transcription through its ability to interact with the NES-dependent pathway. However, our results of semiquantitative RT-PCR

analysis for three representative ribosomal genes do not support this hypothesis, suggesting other pathways are involved. SAGE has been useful in identifying novel transcripts deregulated by HBx. For example, among the 103 differentially expressed candidate genes (>fivefolds), 12 are found only in the EST libraries and 23 have never been identified. Cloning and characterization of these genes and the rest of the inventory genes may shed light on some of the genetic alterations during early liver cancer development. ACKNOWLEDGMENTS We are grateful to Drs. Curtis Harris and Ana Robles for critical reading of the manuscript, Dr. Kenneth Kinzler for advice on SAGE analysis, Dr. Stephen Strom for providing hepatocytes, Ms. Elise Bowman for her help in data analysis, Ms. Lily Wong and Mr. Haress Rahim for their technical assistance, and Ms. Dorothea Dudek for editorial assistance. This work was supported by the Intramural Research Program of the National Cancer Institute. REFERENCES 1. Beasley, R. P. (1988) Hepatitis B virus. The major etiology of hepatocellular carcinoma. Cancer 61, 1942–1956 2. Robinson, W. S. (1999) Hepatitis B Virus and Hepatocellular Carcinoma. In Microbes and Malignancy: Infection as a Cause of Human Cancers (Parsonnet, J., ed) pp. 232–266, Oxford University Press, New York 3. Butel, J. S. (2000) Viral carcinogenesis: revelation of molecular mechanisms and etiology of human disease. Carcinogenesis 21, 405–426 4. Feitelson, M. A. (1999) Hepatitis B virus in hepatocarcinogenesis. J. Cell Physiol. 181, 188–202 5. Bradley, D. W. (1999) Hepatitis viruses: their role in human cancer. Proc. Assoc. Am. Physicians 111, 588–593 6. Murakami, S. (1999) Hepatitis B virus X protein: structure, function and biology. Intervirology 42, 81–99 7. Maddrey, W. C. (2000) Hepatitis B: an important public health issue. J. Med. Virol. 61, 362–366 8. Unsal, H., Yakicier, C., Marcais, C., Kew, M., Volkmann, M., Zentgraf, H., Isselbacher, K. J., Ozturk, M. (1994) Genetic heterogeneity of hepatocellular carcinoma. Proc. Natl. Acad. Sci USA 91, 822–826 9. Paterlini, P., Poussin, K., Kew, M., Franco, D., Brechot, C. (1995) Selective accumulation of the X transcript of hepatitis B virus in patients negative for hepatitis B surface antigen with hepatocellular carcinoma. Hepatology 21, 313–321

10. Su, Q., Schroder, C. H., Hofmann, W. J., Otto, G., Pichlmayr, R., Bannasch, P. (1998) Expression of hepatitis B virus X protein in HBV-infected human livers and hepatocellular carcinomas. Hepatology 27, 1109–1120 11. Hoare, J., Henkler, F., Dowling, J. J., Errington, W., Goldin, R. D., Fish, D., McGarvey, M. J. (2001) Subcellular localisation of the X protein in HBV infected hepatocytes. J. Med. Virol. 64, 419–426 12. Chen, H. S., Kaneko, S., Girones, R., Anderson, R. W., Hornbuckle, W. E., Tennant, B. C., Cote, P. J., Gerin, J. L., Purcell, R. H., Miller, R. H. (1993) The woodchuck hepatitis virus X gene is important for establishment of virus infection in woodchucks. J. Virol. 67, 1218– 1226 13. Zoulim, F., Saputelli, J., Seeger, C. (1994) Woodchuck hepatitis virus X protein is required for viral infection in vivo. J. Virol. 68, 2026–2030 14. Kim, C. M., Koike, K., Saito, I., Miyamura, T., Jay, G. (1991) HBx gene of hepatitis B virus induces liver cancer in transgenic mice. Nature 351, 317–320 15. Ueda, H., Ullrich, S. J., Gangemi, J. D., Kappel, C. A., Ngo, L., Feitelson, M. A., Jay, G. (1995) Functional inactivation but not structural mutation of p53 causes liver cancer. Nature Genet. 9, 41–47 16. Yu, D. Y., Moon, H. B., Son, J. K., Jeong, S., Yu, S. L., Yoon, H., Han, Y. M., Lee, C. S., Park, J. S., Lee, C. H., Hyun, B. H., Murakami, S., Lee, K. K. (1999) Incidence of hepatocellular carcinoma in transgenic mice expressing the hepatitis B virus X-protein. J. Hepatol. 31, 123–132 17. Yeh, C. T. (2000) Hepatitis B virus X protein: searching for a role in hepatocarcinogenesis. J. Gastroenterol. Hepatol. 15, 339–341 18. Caselmann, W. H. (1995) Transactivation of cellular gene expression by hepatitis B viral proteins: a possible molecular mechanism of hepatocarcinogenesis. J. Hepatol. 22, 34–37 19. Andrisani, O. M., Barnabas, S. (1999) The transcriptional function of the hepatitis B virus X protein and its role in hepatocarcinogenesis (Review). Int. J. Oncol. 15, 373–379 20. Forgues, M., Marrogi, A. J., Spillare, E. A., Wu, C. G., Yoshida, M., Wang, X. W. (2001) Interaction of the hepatitis b virus x protein with the Crm1-dependent nuclear export pathway. J. Biol. Chem. 276, 22797–22803 21. Wu, C. G., Hakvoort, T. B., Lamers, W. H., Chamuleau, R. A. (1996) Isolation of up- and down-regulated cDNAs associated with hepatocellular carcinoma by a subtractionenhanced display technique. Biochim. Biophys. Acta 1315, 169–175 22. Adams, M. D., Kelley, J. M., Gocayne, J. D., Dubnick, M., Polymeropoulos, M. H., Xiao, H., Merril, C. R., Wu, A., Olde, B., Moreno, R. F., . (1991) Complementary DNA sequencing: expressed sequence tags and human genome project. Science 252, 1651–1656

23. Velculescu, V. E., Zhang, L., Vogelstein, B., Kinzler, K. W. (1995) Serial analysis of gene expression. Science 270, 484–487 24. Shalon, D., Smith, S. J., Brown, P. O. (1996) A DNA microarray system for analyzing complex DNA samples using two-color fluorescent probe hybridization. Genome Res. 6, 639–645 25. Wu, C. G., Salvay, D. M., Forgues, M., Valerie, K., Farnsworth, J., Markin, R. S., Wang, X. W. (2001) Distinctive gene expression profiles associated with hepatitis B virus x protein. Oncogene 20, 3674–3682 26. Forgues, M., Marrogi, A. J., Spillare, E. A., Wu, C. G., Yoshida, M., Wang, X. W. (2001) Interaction of the hepatitis b virus x protein with the Crm1-dependent nuclear export pathway. J. Biol. Chem. 276, 22797–22803 27. Wu, C. G., Groenink, M., Bosma, A., Reitsma, P. H., van Deventer, S. J., Chamuleau, R. A. (1997) Rat ferritin-H: cDNA cloning, differential expression and localization during hepatocarcinogenesis. Carcinogenesis 18, 47–52 28. Velculescu, V. E., Madden, S. L., Zhang, L., Lash, A. E., Yu, J., Rago, C., Lal, A., Wang, C. J., Beaudry, G. A., Ciriello, K. M., Cook, B. P., Dufault, M. R., Ferguson, A. T., Gao, Y., He, T. C., Hermeking, H., Hiraldo, S. K., Hwang, P. M., Lopez, M. A., Luderer, H. F., Mathews, B., Petroziello, J. M., Polyak, K., Zawel, L., Kinzler, K. W., . (1999) Analysis of human transcriptomes. Nat. Genet. 23, 387–388 29. Zhou, W., Sokoll, L. J., Bruzek, D. J., Zhang, L., Velculescu, V. E., Goldin, S. B., Hruban, R. H., Kern, S. E., Hamilton, S. R., Chan, D. W., Vogelstein, B., Kinzler, K. W. (1998) Identifying markers for pancreatic cancer by gene expression analysis. Cancer Epidemiol. Biomarkers Prev. 7, 109–112 30. Hough, C. D., Sherman-Baust, C. A., Pizer, E. S., Montz, F. J., Im, D. D., Rosenshein, N. B., Cho, K. R., Riggins, G. J., Morin, P. J. (2000) Large-scale serial analysis of gene expression reveals genes differentially expressed in ovarian cancer. Cancer Res. 60, 6281– 6287 31. Yamashita, T., Hashimoto, S., Kaneko, S., Nagai, S., Toyoda, N., Suzuki, T., Kobayashi, K., Matsushima, K. (2000) Comprehensive gene expression profile of a normal human liver. Biochem. Biophys. Res. Commun. 269, 110–116 32. Heinrich, J. M., Bernheiden, M., Minigo, G., Yang, K. K., Schutt, C., Mannel, D. N., Jack, R. S. (2001) The Essential Role of Lipopolysaccharide-Binding Protein in Protection of Mice Against a Peritoneal Salmonella Infection Involves the Rapid Induction of an Inflammatory Response. J. Immunol. 167, 1624–1628 33. Shilatifard, A., Duan, D. R., Haque, D., Florence, C., Schubach, W. H., Conaway, J. W., Conaway, R. C. (1997) ELL2, a new member of an ELL family of RNA polymerase II elongation factors. Proc. Natl. Acad. Sci.USA 94, 3639–3643

34. Okuda, M., Horn, H. F., Tarapore, P., Tokuyama, Y., Smulian, A. G., Chan, P. K., Knudsen, E. S., Hofmann, I. A., Snyder, J. D., Bove, K. E., Fukasawa, K. (2000) Nucleophosmin/B23 is a target of CDK2/cyclin E in centrosome duplication. Cell 103, 127–140 35. Kawamata, H., Kawai, K., Kameyama, S., Johnson, M. D., Stetler-Stevenson, W. G., Oyasu, R. (1995) Over-expression of tissue inhibitor of matrix metalloproteinases (TIMP1 and TIMP2) suppresses extravasation of pulmonary metastasis of a rat bladder carcinoma. Int. J. Cancer 63, 680–687 36. Boon, K., Caron, H. N., van Asperen, R., Valentijn, L., Hermus, M. C., van Sluis, P., Roobeek, I., Weis, I., Voute, P. A., Schwab, M., Versteeg, R. (2001) N-myc enhances the expression of a large set of genes functioning in ribosome biogenesis and protein synthesis. EMBO J. 20, 1383–1393 37. Song, J., Ugai, H., Kanazawa, I., Sun, K., Yokoyama, K. K. (2001) Independent repression of a GC-rich housekeeping gene by Sp1 and MAZ involves the same cis-elements. J. Biol. Chem. 276, 19897–19904 38. Lai, W. S., Thompson, M. J., Taylor, G. A., Liu, Y., Blackshear, P. J. (1995) Promoter analysis of Zfp-36, the mitogen-inducible gene encoding the zinc finger protein tristetraprolin. J. Biol. Chem. 270, 25266–25272 39. Vernon, E., Meyer, G., Pickard, L., Dev, K., Molnar, E., Collingridge, G. L., Henley, J. M. (2001) GABA(B) receptors couple directly to the transcription factor ATF4. Mol. Cell Neurosci. 17, 637–645 40. Zhang, Z., Torii, N., Furusaka, A., Malayaman, N., Hu, Z., Liang, T. J. (2000) Structural and functional characterization of interaction between hepatitis B virus X protein and the proteasome complex. J. Biol. Chem. 275, 15157–15165 Received March 14, 2002; accepted June 6, 2002.

Table 1 Summary of SAGE analysis of genes deregulated by HBx _______________________________________________________________________ SAGE Tags ____________ Known Librarya total distinct Genes ESTs Novel No match ______________________________________________________________________ HBx 9815 1184 9099 (93%) 164 (2%) 468 (5%) 84 (1%) CMV 9686 1426 9051 (94%) 260 (3%) 234 (2%) 141 (1%) Total 19,501 1443 18,150 (93%) 424 (2%) 702 (4%) 225 (1%) _______________________________________________________________________ a

The libraries are HBx, a total SAGE tag count of primary hepatocytes infected with Ad-HBx; CMV, a total SAGE tag count of primary hepatocytes infected with control Ad-CMV; Novel, unknown sequences in Unigene and SAGE database; No match, no sequence match in all the public databases.

Table 2 The most abundant genes in human primary hepatocytes Abundance SAGE Tag Count (%)a Unigene Hs. Gene Description _________________________________________________________________________________ AAGCCCTTTG 260 2.73 173518 M-phase phosphoprotein homologue AAGCCCCTGG 92 0.96 21148 FLJ11114 fis, AAGCCCCCTG 85 0.89 279784 prolactin regulatory element binding protein AGAATAAGAG 74 0.78 119597 albumin GTGCGGAGGA 72 0.75 181062 serum amyloid A1 AAGCCCCCTT 68 0.71 184029 hypothetical protein DKFZp761A052 TTTAACGGCC 67 0.70 180532 glucose phosphate isomerase GAGCCCCTTG 67 0.70 111680 endosulfine alpha GGAAAAGTGG 65 0.68 75621 antitrypsin ATGTCCCCAT 51 0.53 236030 SWI/SNF-related regulator, subfamily c AAAGCCCCTT 46 0.48 151293 cDNA FLJ10664 fis, TACCATCAAT 36 0.38 169476 glyceraldehyde-3-phosphate dehydrogenase GCGGCGGCGG 34 0.36 6518 ganglioside expression factor 2 CTAAGACTTC 33 0.35 180532 glucose phosphate isomerase GGATTTGGCC 33 0.35 119500 karyopherin alpha 4 TGTACCTCAG 32 0.34 572 orosomucoid 1 AAAAAAAAAA 32 0.34 100001 solute carrier family 17, member 1 GAGGGAGTTT 27 0.28 76064 ribosomal protein L27a TGTGTTGAGA 26 0.27 181165 eukaryotic translation elongation factor 1 alpha CTGGGTTAAT 25 0.26 126701 ribosomal protein S19 CCCTGGGTTC 24 0.25 111334 ferritin, light polypeptide GCCGAGGAAG 23 0.24 288224 ribosomal protein S12 ACACAGCAAG 23 0.24 180532 glucose phosphate isomerase AGCACCTCCA 23 0.24 75309 eukaryotic translation elongation factor 2 GCAGCCATCC 22 0.23 4437 ribosomal protein L28 GTTGTGGTTA 22 0.23 75415 beta-2-microglobulin TTGGGGTTTC 21 0.22 62954 ferritin, heavy polypeptide 1 AGGAAAGCTG 21 0.22 76437 ribosomal protein L36 TTGGTCCTCT 20 0.21 108124 ribosomal protein L41 GGGCTGGGGT 20 0.21 183698 ribosomal protein L29 TAAGGAGCTG 19 0.20 77904 ribosomal protein S26 GTGCTGAATG 19 0.20 77385 myosin, light polypeptide 6, alkali GCTTTATTTG 19 0.20 180952 actin beta GACTCTTCAG 18 0.19 234726 serine (or cysteine) proteinase inhibitor ATGGCTGGTA 18 0.19 182426 ribosomal protein S2 CGCCGCCGGC 18 0.19 182825 ribosomal protein L35 GAACACATCC 18 0.19 75879 ribosomal protein L19 TGGTGTTGAG 17 0.18 275865 ribosomal protein S18 ACATCATCGA 16 0.17 182979 ribosomal protein L12 GTGAAACCCC 16 0.17 102178 syntaxin 16 GGGGAAATCG 16 0.17 76293 thymosin, beta 10 TGCACGTTTT 16 0.17 169793 ribosomal protein L32 TGCATCTGGT 16 0.17 75410 heat shock 70kD protein 5 TCAGATCTTT 16 0.17 75344 ribosomal protein S4, X-linked AAGACAGTGG 15 0.16 184109 ribosomal protein L37a ATAATTCTTT 15 0.16 288806 FLJ11778 fis AGCAGATCAG 15 0.16 119301 S100 calcium-binding protein A10 GAAGCAGGAC 14 0.15 180370 cofilin 1 GCATAATAGG 14 0.15 184108 ribosomal protein L21

CCAGAACAGA 14 0.15 111222 ribosomal protein L30 GGACCACTGA 14 0.15 119598 ribosomal protein L3 AGGCTACGGA 14 0.15 119122 ribosomal protein L13a AAGGTGGAGG 14 0.15 163593 ribosomal protein L18a CGCTGGTTCC 14 0.15 179943 ribosomal protein L11 TAGGTTGTCT 14 0.15 119252 translationally controlled 1 CAATAAATGT 14 0.15 179779 ribosomal protein L37 AAGGCCCCTG 14 0.15 3447 DKFZP564K1964 protein GGCTGGGGGC 13 0.14 75721 profilin1 CAAGCATCCC 13 0.14 153423 KIAA0493 protein CTGTTGGTGA 13 0.14 3463 ribosomal protein S23 CCGTCCAAGG 13 0.14 80617 ribosomal protein S16 AGGTCAGGAG 13 0.14 129331 FLJ11558 fis TTCAATAAAA 12 0.13 141269 FLJ21550 fis CCTGTAATCC 12 0.13 177415 ribosomal protein S30 AGCTCTCCCT 12 0.13 82202 ribosomal protein L17 GTGAAACCCT 12 0.13 100516 clone 23605 mRNA AAGGAGATGG 12 0.13 184014 ribosomal protein L31 TTGGTGAAGG 12 0.13 288031 sterol-C5-desaturase TTACCATATC 12 0.13 177461 ribosomal protein L39 AAAACATTCT 12 0.13 80562 gelsolin (amyloidosis, Finnish type) TCTGGTTTGT 12 0.13 76293 thymosin, beta 10 AAAGCCCTTG 12 0.13 151293 cDNA FLJ10664 fis GTGAAGGCAG 11 0.12 77039 ribosomal protein S3A AGGGCTTCCA 11 0.12 29797 ribosomal protein L10 CCTAGCTGGA 11 0.12 182937 peptidylprolyl isomerase A CGACCCCACG 11 0.12 169401 apolipoprotein E CTGGCCTCCC 11 0.12 73849 apolipoprotein C-III __________________________________________________________________________ a The relative frequency of a given tag was calculated by dividing the total count of 9538 tags.

Table 3 List of candidate genes up-regulated by HBx in human primary hepatocytes (greater than fivefold) __________________________________________________________________________ SAGE Tag HBx* CMV HBx/CMV Unigene Hs. Gene Description __________________________________________________________________________ TCCCTATTAA 385 7 55.0 343430 XIG1 (unknown) TCCTTATTAA 20 0 20.0 148589 XIG2 (EST) GAGACCACCG 14 0 14.0 896196 hepatitis B virus X protein gene CCTAGCAGAG 18 2 9.0 154078 lipopolysccharide-binding GCGACGAGGC 16 2 8.0 2017 ribosomal protein L38 ACCCTATTAA 8 0 8.0 173334 ELL-related RNA polymerase II TGCTTTGGGA 8 1 8.0 84344 CGI-135 protein ACCTCAGGAA 8 1 8.0 177516 high-density lipoprotein binding GGAAAAAAAA 8 1 8.0 162189 serine/threonine kinase with Dbl CAGGAGGAAA 7 0 7.8 114914 XIG3 (EST) CCCATCCGAA 14 2 7.0 91379 ribosomal protein L26 GCCCTATTAA 7 0 7.0 288573 XIG4 (FLJ 22170 fis) CGGTTACTGT 7 0 7.0 49767 NADH dehydrogenase Fe-S TTGGCCAGGC 7 1 7.0 1360 cytochrome P450 II TTTTTGTACA 7 1 7.0 78040 KDEL ER protein TCCTATTAAG 7 1 7.0 no match TTACGAGGAA 7 1 7.0 227949 SEC13-like 1 TCCCATTAAG 6 0 6.0 no match TGTGGATGCA 6 1 6.0 161002 absent in melanoma 1 GTGGCCGTGG 6 1 6.0 181243 activating transcription factor 4 CATTTCATAA 6 1 6.0 73851 ATP synthase CCCCAGTTGC 6 1 6.0 74451 calplain 4 GTCTCTTTGG 6 1 6.0 2083 cdc-like kinase 1 CTCCCTTGCC 6 1 6.0 181271 CGI-120 protein TGGTACACGT 6 1 6.0 279574 CGI-39 protein TAATTCTTCT 6 1 6.0 1708 chaperonin-containing TCP1 AGATGAGATG 6 1 6.0 285313 core promoter-binding protein ACAGTCTTGC 6 1 6.0 106242 CYP450, IVF, polypeptide 3 TGCTGTGCAT 6 1 6.0 147916 DEAD/H box polypeptide 3 GGCCAAAGGC 6 1 6.0 213701 XIG5 (EST) GTCTGAGCTC 6 1 6.0 66915 XIG6 (EST) CTGTTGATTG 6 1 6.0 249495 nuclear ribonucleoprotein A1 AAATAAAGAA 6 1 6.0 790 glutathione S-transferase 1 AAGTCATTCA 6 1 6.0 274416 NADH dehydrogenase 1 alpha TCATAGTTCA 6 1 6.0 no match AACGAGGAAT 6 1 6.0 5508 nonfunctional folate binding TGATCTGCCT 6 1 6.0 183105 nuclear autoantigen GCCAAGATGC 6 1 6.0 83135 p53-responsive gene 6 GCTAATAGTA 6 1 6.0 182937 peptidylprolyl isomerase A GAAATGATGA 6 1 6.0 288856 profoldin 5 GTGCTGGACC 6 1 6.0 179774 proteasome (PA28 beta) GTTTAAATCG 6 1 6.0 181309 proteasome subunit, alpha type, 2 CCCCCACCTA 6 1 6.0 77422 proteolipid protein 2 CGCCGGAACA 6 1 6.0 286 ribosomal protein L4 ACTACAGCCA 6 1 6.0 186961 ubiquitin-specific protease 25 TCCGCGAGAA 6 1 6.0 1665 zinc-finger protein GGGGGTCACC 10 2 5.0 80986 ATP synthase AGCAGGAGCA 10 2 5.0 158675 ribosomal protein L14 AGAACAAAAC 5 0 5.0 180909 peroxiredoxin 1 GTCCCTATTA 5 1 5.0 no match

TGACCTCAGC GTGTAATAAG GTGCGCTGAG TGACCGGCGA TCCCTATTAC GTGCGGAGGG TCCCTATTAG a

5 5 5 5 5 5 5

1 1 1 1 1 1 1

5.0 5.0 5.0 5.0 5.0 5.0 5.0

12594 75598 277477 23410 300591

XIG7 (ESTs) nuclear ribonucleoprotein A2/b1 MHC, class I, C mitochondrial translocase XIG8 (unknown) no match XIG9 (unknown)

The total tag counts in HBx or CMV. If tag count is zero, one is adjusted to obtain ratio of HBx/CMV.

Table 4 List of candidate genes down-regulated by HBx in human primary hepatocytes (greater than fivefold) ____________________________________________________________________________ SAGE Tag HBxa CMV CMV/HBx Unigene Hs. Gene Description ____________________________________________________________________________ AAGCCCTCTT 1 16 16.0 XSG1 (unknown) AAGCCCTTGG 1 13 13.0 249488 XSG2 (EST; not in SAGE bank) AAGCCCACTG 0 12 12.0 no match AAGGCCCCTT 0 10 10.0 no match GCCCGGGGTG 2 16 8.0 unknown ATGCCCCTTG 2 15 7.5 no match AAACCCCCTT 0 7 7.0 12592 XSG3 (unknown) AAGGCCCCTG 2 14 7.0 3447 XSG4 (DKFZP564K1964 protein) AGGCCCTTTG 2 13 6.5 183704 XSG5 (unknown) CGTTTAATGT 0 6 6.0 11637 XSG6 (EST) CTGCTAGGAA 0 6 6.0 4147 translocating chain-associating AAGCCCCATT 0 6 6.0 XSG7 (unknown) TATATTGATT 1 6 6.0 77054 nucleophosmin 1 TCTGTTGTTC 1 6 6.0 289770 XSG8 (EST) TAGATGTGAT 1 6 6.0 131740 XSG9 (FLJ22562 fis) TTTGTAGATG 1 6 6.0 3069 heat shock 70-kD protein 9B TTTTTAAAAA 1 6 6.0 27931 XSG10 (FLJ10607 fis) TTCTTCTTTG 1 6 6.0 34497 XSG11 (FLJ22116 fis) GGATGGCAAT 1 6 6.0 181357 laminin receptor 1 GTGGTTTGGC 1 6 6.0 183373 Src-homologuey 3 domain AAAGCCCTTG 2 12 6.0 151293 XSG12 (FLJ10664 fis) AAGGAAATGG 0 5 5.0 256309 BAP31/BAP29 AAAGAGAAAA 0 5 5.0 124895 XSG13 (EST) AAGGGCCTTG 0 5 5.0 59085 XSG14 (EST) AATTTCTATT 0 5 5.0 5322 guanine nucleotide binding AATGCCCCTT 0 5 5.0 no match ATGGCTGGAT 0 5 5.0 no match ATTATGGAAG 0 5 5.0 5181 proliferation-associated 2G4 AATGACTGAA 0 5 5.0 93659 disulfide isomerase related AATCCCTTTG 0 5 5.0 XSG15 (unknown) ACCCCCTTTG 0 5 5.0 XSG16 (unknown) AGGCCCGGGG 0 5 5.0 29882 XSG17 (unknown) AGGCCCTTGA 0 5 5.0 XSG18 (unknown) CTTAATCCTG 1 5 5.0 234433 amino acid transporter 2 GGGGGTGGAT 1 5 5.0 288554 XSG19 (FLJ13079 fis) GCAAAACCCC 1 5 5.0 129013 XSG20 (FLJ14309 fis) GGAGGGATCA 1 5 5.0 6196 integrin-linked kinase GCCCTCGGCC 1 5 5.0 17883 protein phosphatase 1G GAGTGGGGGC 1 5 5.0 14089 quiescent cell proline dipeptidase GAAATACAGT 1 5 5.0 284272 RB-associated KRAB repressor GAGAGTGTCT 1 5 5.0 5831 TIMP 1 GCGGCGGCGA 1 5 5.0 3727 unr-interacting protein GCCTGGGACT 2 10 5.0 98057 XSG21 (EST) AAACCCCTTT 2 10 5.0 232380 XSG22 (EST) GGAAAAGGGG 2 10 5.0 75432 IMP dehydrogenase 2 ACTGGGTCTA 2 10 5.0 275163 NM23B ___________________________________________________________________________ a

The total tag counts in HBx or CMV. If tag count is zero, one is adjusted to obtain ratio of CMV/HBx.

Table 5 List of three clustered genes deregulated by HBx in human primary hepatocytes ______________________________________________________________________________ SAGE Tag HBxa CMV HBx/CMV Unigene Hs. Gene Description ______________________________________________________________________________ Ribosomal proteins GCGACGAGGC CCCATCCGAA CGCCGGAACA AGCAGGAGCA CCCGTCCGGA CCCCAGCCAG ACTCCAAAAA TTGGCAGCCC CTAAAGCTTC AGCTCTCCCC TTGGTCCTTT CCAGTGGCCC ATGGCGATCT TTCTTGTGGC ACTACAAATA GGAGTGGACA TCGCCGCGAC GTTCCCTGGC GACGACACGA TTGGTCCTCT CCTGTAATCC ACATCATCGA GCCTGTATGA GCTTTTAAGG TAATAAAGGT GGCCGCGTTC AAGAAGATAG GTGTTAACCA GGCTGGTCTC GTGTTGCACA AAGCCCTTGC CTGCTATACG AAGACAGTGC CAATAAATGG GCAGACTCAG

16 14 6 10 16 8 8 8 4 4 7 6 6 6 6 6 3 16 18 44 26 34 20 12 8 8 8 8 4 4 4 4 4 4 4

Transcription factors TCCGCGAGAA ACAGTGGGGA CCACAGGAGA TAGCCATCAA TACAGAGGGA TACCCCACCC GTGGCCGTGG CAAGCATTTT ACTTTTTCAA

6 4 4 3 3 4 6 4 4

2 2 1 2 4 2 2 2 1 1 2 2 2 2 2 2 1 6 9 20 12 16 10 6 4 4 4 4 2 2 2 2 2 2 2

8.0 7.0 6.0 5.0 4.0 4.0 4.0 4.0 4.0 4.0 3.5 3.0 3.0 3.0 3.0 3.0 3.0 2.7 2.3 2.2 2.17 2.13 2.0 2.0 2.0 2.0 2.0 2.0 2.0 2.0 2.0 2.0 2.0 2.0 2.0

2017 91379 286 158675 180842 252259 133230 76064 75538 82202 108124 180920 180450 182740 157850 75458 184109 177415 153177 108124 177415 182979 180450 8102 151604 5174 184776 74267 73742 165590 76230 180946 184109 179779 184776

ribosomal protein L38 ribosomal protein L26 ribosomal protein L4 ribosomal protein L14 ribosomal protein L13 ribosomal protein S3 ribosomal protein S15 ribosomal protein L27a ribosomal protein S7 ribosomal protein L17 ribosomal protein L41 ribosomal protein S9 ribosomal protein S24 ribosomal protein S11 ribosomal protein L9 ribosomal protein L18 ribosomal protein L37a ribosomal protein S30 ribosomal protein S28 ribosomal protein L41 ribosomal protein S30 ribosomal protein L12 ribosomal protein S24 ribosomal protein S20 ribosomal protein S8 ribosomal protein S17 ribosomal protein L23a ribosomal protein L15 ribosomal protein, large P0 ribosomal protein S13 ribosomal protein S10 ribosomal protein L5 ribosomal protein L37a ribosomal protein L37 ribosomal protein L23a

1 1 1 1 1 1 1 1 1

6.0 4.0 4.0 3.0 3.0 4.0 6.0 4.0 4.0

1665 75839 75471 2110 3776 7647 181243 13063 169921

zinc finger, homologueous to zfp-36 zinc finger, CMPX1 zinc-finger protein 146 zinc-finger protein 9 zinc-finger protein 216 zinc finger, Myc-associated ATF 4 transcription factor CA150 general transcription factor II

Ubiquitin-proteasomes ACTACAGCCA 6 1 6.0 186961 ubiquitin-specific protease 25 AATGAATAAA 4 1 4.0 118797 ubiquitin-conjugating enzyme E2D CAGATCTTTG 4 1 4.0 119502 ubiquitin A-52 residue GTAAAAAAAA 4 2 2.0 183842 ubiquitin B GTTTAAATCG 6 1 6.0 181309 proteasome subunit, alpha type, 2 GTGCTGGACC 6 1 6.0 179774 proteasome activator subunit 2 AAGGAATCGG 4 1 4.0 89545 proteasome subunit, beta type, 4 TCCTCCCTCC 3 1 1 3.0 390 proteasome subunit, beta type, 2 GAGCGGGATG 4 2 2.0 77060 proteasome subunit, beta type, 6 ______________________________________________________________________________ a

The total tag counts in HBx or CMV. If tag count is zero, one is adjusted to obtain ratio of HBx/CMV.

Fig. 1

Figure 1. A) Northern blot (right panel) and Western blot (left panel) analysis of expression of HBx in normal primary human hepatocytes infected with a replication defective adenoviral vector encoding an HBx cDNA under the control of the cytomegalovirus later promoter (HBx) and control adenovirus (CMV). After a 2-day infection, cell lysates were prepared and analyzed by Western blot with anti-HBx monoclonal antibodies recognizing a single 17-kDa band, and mRNAs were detected with HBx cDNA probe as 0.6 kb molecular mass. B) Serial analysis of gene expression (SAGE) profile of the differentially expressed tags in human primary hepatocytes expressing HBx vs. control. The x-axis indicates the induction fold positioned in left panel (gray bars) and repression fold in right panel (left-hatched bars). The y-axis indicates the number and percentage of unique transcripts differentially expressed.

Fig. 2

Figure 2. Megarray analysis (A) of 41 genes identified by SAGE. The intensity ratios of each dot were determined by Phosphorimager quantification from two arrays hybridized with probes derived from hepatocytes expressing HBx (HBX) vs. control (CMV) and were standardized by that of GAPDH. A1: negative control. B) The correlation of the intensity ratio detected on Megarray vs. SAGE analysis of 41 genes differentially expressed from HBx-expressing cells in comparison with controls (r = 0.8, P < 0.005).

Fig. 3

Figure 3. Semiquantitative analysis of three representative ribosomal proteins (RPL26, RPL14, and RPL4) in primary hepatocytes infected with adenovirus containing mutant HBx-NES (muHBx), wild-type HBx (wtHBx), and control (CMV), respectively, compared with 18S ribosomal RNA.

Fig. 4

Figure 4. A model for transcriptional effects of HBx on primary human hepatocytes.