Diversity of genotypes of hepatitis C virus in southern India

Journal of General Virology (1995), 76, 711-716. Printed #z Great Britain

711

Diversity of genotypes of hepatitis C virus in southern India T. V a l l i a m m a i , 1 S. P. T h y a g a r a j a n , 3 Arie J. Z u c k e r m a n 2 and T i m J. H a r r i s o n 1. 1 University Department o f Medicine and 2 Department of Medical Microbiology, Royal Free Hospital School o f Medicine, Rowland Hill Street, Hampstead, London N W 3 2PF, UK and a Dr A L M Postgraduate htstitute of Basic Medical Sciences, Taramani, Madras, India

A second generation assay for antibody to hepatitis C virus (anti-HCV) was used to screen 78 southern Indian individuals with a high risk of infection. RT-PCR targeted at the 5' end untranslated region (5'UTR) of the HCV genome was used to evaluate evidence of viraemia in 32 anti-HCV positive sera. The PCR products amplified from the 5'UTR of the HCV genome from 24 patients were sequenced, revealing the existence of two distinct groups of sequences: 21 corresponded to HCV type 1 while the other three sequences had 95 % to 99 % identity to HCV type 3. Two of these three isolates had

more than 90 % nucleotide identity in the NS5 region to established 3b sequences whereas the other had less than 74 % nucleotide identity to any of the published genotype 3 (3a, 3b, 3c, 3d, 3e and 3f) sequences. However, a search of the EMBL nucleotide database revealed 91% identity to the unpublished sequence of an isolate of HCV from Indonesia. We provide evidence that these two isolates may represent a novel subtype within genotype 3. Our data also suggest that HCV genotype 1 predominates over HCV genotype 3 in southern India.

Hepatitis C virus (HCV), the major cause of parenterally transmitted non-A, non-B hepatitis (Choo et al., 1990), is distributed worldwide. Infection is most common in those with risk factors of parenteral transmission such as recipients of blood and blood products, including haemophiliacs, renal transplant and dialysis patients, and intravenous drug abusers. Infection also may be transmitted perinatally from mothers with a high titre of circulating virus to their neonates (Ohto et al., 1994) and transmission may also be achieved sexually (Seeff & Alter, 1994). In many developed countries, the prevalence of infection outside the major risk groups may be as low as 2 to 3 per 1000 (Garson et al., 1992) but the virus seems to be distributed more widely elsewhere, such as in some regions of Japan (Kiyosawa et al., 1994) and Egypt (Kamel et al., 1992). HCV is related to flaviviruses and pestiviruses, with a positive sense, ssRNA genome of around 9.4 kb in length (Choo et al., 1990). The genome comprises an approximately 332 nucleotide 5' end untranslated region

(5'UTR) followed by a single continuous open reading frame, encoding a polypeptide of around 3010 residues, and a short 3' end untranslated region (Kato et al., 1990; Takamizawa et al., 1991). Different isolates of HCV show substantial variability in nucleotide sequence distributed throughout the genome (Okamoto et al., 1991, 1992). Regions encoding the putative envelope glycoproteins, E1 (gp35) and E2 (gp72) are the most variable (Weiner et al., 1991; Hijikata et al., 1991) whereas the 5'UTR is the most conserved (Han et al., 1991 ; Cha et al., 1991 ; Okamoto et al., 1990: Bukh et al., 1992a). Many workers investigating sequence variation among HCV isolates have proposed schemes of classification and nomenclatures (Enomoto et al., 1990; Houghton et al., 1991 ; Mori et al., 1992; Okamoto et al., 1992; Cha et al., 1992; Chan et al., 1992; Simmonds et al., 1993a, b). Recently, a proposal has been made for a unified system of nomenclature (Simmonds et al., 1994). The system proposed by Simmonds is logical because it recognizes that the most divergent isolates of HCV have sequence similarities of less than 72 % (classified as 'types') and within these groupings there may be only 75-86% sequence similarity between clusters of isolates (classified as 'subtypes'; Simmonds et al., 1994). It is unknown as to whether sequence variability affects clinical outcome, although there is some evidence that the response of persistently infected patients to treatment with interferon depends to an extent on the genotype of the virus (Kanai et al., 1992; Chemello et al.,

* Author for correspondence. Fax +44 I71 794 3472. e-mail [email protected] The nucleotide sequence data reported in this paper have been submittedto the EMBLdatabank and assignedthe accessionnumbers Z36518 (HPCMD1); Z36519 (HPCMD2); Z36520 (HPCMD3); Z36521 (HPCMD4); Z36522 (HPCMD5); Z36523 (HPCMD6); Z36524 (HPCMD7); Z36525 (HPCMN5); Z36526 (HPCMN6) and Z36527 (HPCMN7). 0001-2840 © 1995 SGM

712

Short communication

Table 1. H C V antibody and RNA in high risk groups #1 southern India

Diagnosis

Anti-HCV

RT-PCR

(second generation)

(antibody positives)

11/31 3/9 3/3 6/6 14/23 1/6 38/78

7/7 2/3 1/3 5/6 9/12 0/l 24/32

Renal transplant Haemodialysis Acute HCV in pregnancy* Post transfusion hepatitis* Chronic liver disease Asymptomatic HBV carriers Total

* Selected anti-HCV positive cases.

1994). The presence of diverse genotypes in a particular population may have implications for diagnostic testing and future vaccine development. Only two limited sequences have been reported from isolates from the Indian subcontinent (Bukh et al., 1992b). HCV isolates from neighbouring regions, namely Thailand (Mori et al., 1992) and Nepal (Tokita et al., 1994), have been classified as genotype 3. In this study, we amplified HCV

HPCMDI HPCMD2 HPCMD3 HPCMD4 HPCMD5 HPCMD6 HPCMD7




-259 CCATGGCGTT

-249 AGTATGAGTG

-239 TCGTGCAGCC

sequences from a variety of individuals from high risk groups in southern India and we report their classification according to the scheme of Simmonds et al. (1994). Serum samples were obtained from 78 southern Indian individuals, many with a diagnosis of non-A, non-B hepatitis. These included 23 patients with chronic liver diseases, 31 renal transplant recipients, nine undergoing haemodialysis, three with acutely raised HCV levels in pregnancy, six asymptomatic hepatitis B virus (HBV) carriers and six cases of post-transfusion hepatitis (Table 1). A second generation ELISA (Ortho Diagnostic Systems) was used to detect HCV induced antibody to recombinant antigens. Thirty-two anti-HCV positive samples were used for RT-PCR and sequence analysis. RNA was extracted from 100 lal of serum using the guanidinium isothiocyanate method and used for the first round of RT-PCR with external primers 5' ATACTCGAGGTGCACGGTCTACGAGACCT (Garson et al., 1990) and 5' CTGTGAGGAACTACTGTCTT (Okamoto et al., 1990). Ten tal reaction product were used for second round, nested PCR with internal -229 TCCAGGACCC

-219 CCCCTCCCGG

-209 GAGAGCCATA

. . . . . . . . . . . . . .

C

. . . . . . . . . . . . . . . . . . . . .

C

. . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . .

C

. . . . . . . . . . . . . . . . . . . . .

C

. . . . . . . . . . . . . . . . . . . . . . .

..............

C .........

-199 GTGGTCTGCG

-189 GAACCGGTGA

A ...........

-179 GTACACCGGA

C .......................

-169 ATTGCCAGGA

................................

C..

................................ ................................

C...G... C...S...

-139 TCAACCCGCT

-129 CAATGCCTGG

-119 AGATTTGGGC

.G. .T

-109 GTGCCCCCGC

-159 CGACCGGGTC

-149 CTTTCTTGGA

T ...................

T...A ............... T ................... -99 GAGACTGCTA

-89 GCCGAGTAGT

.T

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

.A

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

.TT ......................................................... A.T .............. C.. .A .................. A .................. A ...... T ......... C.. .A ...................... TCA ............. GT ............... C.. .A ...................... TCA ............. -79 GTTGGGTCGC

.......

-69 GAAAGGCCTT

C

-59 GTGGT

T .................

. . . . . . . . . .

° . . . . . . . . . . . . . .

.........................

Fig. 1. Seven sequencesof the 5'UTR of HCV isolates ~om 24 patients in southern India. The topmost sequence is that ~und in isolates from 17 individuals, other sequences are shown where di~rent from this re~rence sequence. Numbering acco~ing to Choo et al. (1991).

Short communication

primers 5' CACTCTCGAGCACCCTATCAGGCAGT (Garson et al., 1990) and 5' TTCACGCAGAAAGCGTCTAG (Okamoto et al., 1990). Positive and negative controls were included at the extraction step and in both rounds of amplification. For analysis of the NS5 region, RT-PCR was carried out using primers thought to be highly conserved amongst different isolates of HCV (5' TGGGGATCCCGTATGATACCCGCTGCTTTGA and 5' GGCGGAATTCCTGGTCATAGCCTCCGTGAA; Enomoto et al., 1990) and the second round with internal primers described by Chan et al. (1992; 5' CTCAACCGTCACTGAACAGGACAT and 5' CCACGACTAGATCATCTCCG). PCR products were purified by extraction from lowmelting-point agarose and one quarter of the eluate was used in a sequencing reaction with T7 DNA polymerase (Sequenase version 2.0, US Biochemical Corporation) with each internal primer. The template DNA was denatured by boiling for 3 min before annealing the primer and reactions were performed according to the manufacturer's instructions except for the addition of 10 % DMSO. Individual sequences were compared to the EMBL database using the BLAST alignment search program (Karlin & Altschul, 1990; Altschul et al., 1990). To determine the genotype from sequence data from the 5'UTR, restriction sites for the enzymes H a e I I I , R s a I and S c r F I were predicted using Staden-Plus software and interpreted according to the scheme of McOmish et al. (1993). Table 1 shows the results of testing 78 serum samples from individuals with a high risk of parenteral exposure to anti-HCV antibodies and HCV RNA. Six cases of post-transfusion hepatitis and three of hepatitis in pregnancy were known to be anti-HCV-positive. Of the remaining 69 samples, 29 proved to be antibody-positive. In 32 antibody-positive cases, sufficient serum remained for RT-PCR analysis (5'UTR). Twenty-four individuals (75 % of anti-HCV-positive cases tested) were positive for HCV RNA in serum. The nucleotide sequences of PCR products from 24 patients were determined by direct sequencing and are shown in Fig. 1. In 17 cases, the sequences were identical (HPCMD1) and are 100 % identical to several sequences in the EMBL database including those published for two Indian samples by Bukh et al. (1992b). Two further sequences were identical (HPCMD2) and are 100% identical to sequences from Taiwan, Peru and Sweden reported by Bukh et al. (1992b). A further sequence (HPCMD3) was 100% identical to an unpublished sequence in the database (accession number: D29818). The remaining four sequences (HPCMD4-7) were unique; none of them was found to be 100 % identical to sequences in the database. The subtypes of the seven sequences were determined

713

HaelII RsaI 102

b

I

2~ I

33

novel t

46

114

I

II

t i

9 I

I

2-" g

114

,

~ I

12

46

114

t

26 [

|

9 !

1 26 I

26 !

!

ScrFI 53 a

i

53

d

HPCMD1 HPCMD2 HPCMD3 HPCMD4 HPCMD5 HPCMD6 HPCMD7

14 !

/

1

48

II

14 I

/ tl

9 i

1

48

HaelII RsaI ScrFI b a b a b a b a g a g d novel a

32 i

94 I

94

41 I

i

Genotype 1 1 1 1 ? ? ?

Fig. 2. HaeIII/RsaI and ScrFI cleavage patterns predicted for the 5 ' U T R sequences, H P C M D 1 - 7 , and their interpretation according to M c O m i s h et al. (1993).

by identity with sequences of known subtype and according to the predicted restriction enzyme cleavage pattern (McOmish et al., 1993; Simmonds et al., 1994). Sequences HPCMD1 to HPCMD4 gave predicted cleavage patterns 'b" using H a e I I I - R s a I and ' a ' using S c r F I (Fig. 2). This is consistent with classification as genotype 1 (McOmish et al., 1993). In these type 1 sequences, the base at nucleotide position - 9 9 is G, consistent with subtype lb rather than la (Stuyver et al., 1993). This conclusion is supported by the close identity with type lb sequences in the database. The three remaining sequences (HPCMD5 to HPCMD7) gave patterns which cannot be classified using the scheme proposed by McOmish et al. (1993): H P C M D 5 H a e I I I - R s a I pattern g, S c r F I pattern a, H P C M D 6 H a e I I I - R s a I pattern g, S c r F I pattern d and HPCMD7 -ScrFI pattern a but the cleavage predicted for H a e I I I - R s a I would yield a novel pattern (Fig. 2). Sequences HPCMD6 and HPCMD7 closely resemble the sequence HPCENCR (K. Chayama and others, unpublished) which has been classified as type 3b (Tokita et al., 1994). In order to investigate whether these three isolates might represent novel subtypes of HCV, we sought to determine the sequence of part of the NS5 region. Analysis of the NS5 region, which shows greater

714

Short communication 60

HPCMN5

CAGGGTAGAA

HPCMN6 HPCMN7

.... ACG..G .... ACG..G

GAGTCCATCT

ATCAGGCCTG

...GAG..A. ...GAG..A.

.C..ATG .C..ATG

TGACCTCAAG

......... .........

GACGAGGCTA

TG,, TG..

GGAGGGTGAT

CCA..G..CC CCA..A..TC

...A..CA.. ...A..CA.. 120

HPCMN5 HPCMN6 HPCMN7

AACTTCACTC ACGGAACGGC C.GCG.C ..... A..G ..... C.GCG.T ..... A..G .....

TTTACTGTGG G,.CATT.. G..TGTC..

TGGTCCCATG G .......... G ..........

TTTAACAGCA AC ........ AT ........

AGGGACAACA A..A.TC.. A..G.TC..


CTGCGGTTAC G ..... C..T G ..... C..T

CGCCGCTGCC ........... ...........

GTGCTAGTGG C,,C,,C., C,.C,.C..

GGTACTACCC C..CT.G..T C..CT.G..T

ACCAGCTTCG ........ C, ........ T.

GAAATACAAT .C..C..G.. .C..T..A..


TACTTGCTAC A..C..T... A..C..T...

CTCAAAGCAA A .... G..C. A .... G..C.

AGGCAGCCAC AC ....... CT .......

CAAAGCCGCC ..GG ..... G ..GG ..... G

GGGATTCAAG ..TC.CA..A ..TC.CA..A

ATCCATCATT .C ..... C.. .C ..... C..


249 TCTTGTCTG C ........ C ........

180

240 G G

Fig. 3. Sequences of the NS5 region from three selected isolates (HPCMD5/HPCMN5, HPCMD6/HPCMN6, HPCMD7/HPCMN7). Nucleotide position 1 is equivalent to position 7959 according to Cboo et al. (1991).

Table 2. Pairwise comparisons of 14 partial nucleotide sequences of the NS5 region of isolates of HCV genotype 3* 3a

T1 T7 Eb3 T9 T10 NE137 MN6 MN7 NE048

3b

3c

3d

3e

3f

T1

T7

Eb3

T9

TI0

NE137

MN6

MN7

NE048

NE274

NE145

NE125

Td-3

MN5

100

94.4 100

94-5 91.8 100

78.8 79.4 78.3

79,7 80,3

77-5 79-0 77-9

78.0 80.0 79.2

77.0 78.0 77.9

83.5 83.5 82.4

83.2 83.2 82.4

81.1 81.1 80.1

80.2 79.6 77.4

72.7 72.4 72.9

73.0 71.4 71.6

91-6 904 100

93.0 93.0 90.3 100

95"0 94"0 939 95-5 100

81.4 81.7 84.9 79.1 79.1 100

78.4 78.7 84.4 76.3 75-9 87-2

77.5 77.8 82.2 74.6 75.1 85.4

82.6 83.2 85.4 80.3 80.3 85.7

71.3 71.3 71.0 72.6 70.2 73.8

71.8 71.8 69.8 71.4 70.6 73.8

84"9

85-2

73"8

73-0

83.4

69.2

68.6

100

78,8 98"5 100

NE274 NE145 NEI25 Td-3 MN5

100

100

100

71-0 100

72-6 91.0 100

* Numbers represent percentage nucleotide identity. TI, T7, T9, T10 (Mori et al., 1992); Eb3 (Chan et al., 1992); NE137, NE048, NE274, NE145, NE125 (Tokita et al., 1994); MN6, MN7, MN5 (HPCMN5-7, this paper); Td-3 (unpublished Indonesian isolate, accession number: D26387).

sequence diversity than the 5'UTR, has proved useful for genotype analysis (Mori et al., 1992; Okamoto et al., 1993; Simmonds et al., 1993a). We amplified the NS5 region of HCV from the sera which yielded the sequences HPCMD5 to HPCMD7. Fig. 3 shows the sequences of the three PCR products as determined directly on each strand using the internal primers, designated HPCMN5 to HPCMN7, respectively. A pairwise comparison of these three sequences with representatives of genotypes 3a and 3b and provisional genotypes 3c to 3f is shown in Table 2. The isolates yielding sequences HPCMD6/

HPCMN6 and HPCMD7/HPCMN7 clearly may be classified as subtype 3b with greater than 90 % nucleotide identity in this region of NS5 to established 3b sequences. The isolate yielding sequences HPCMD5/HPCMN5, which was derived from a case of post-transfusion hepatitis, has less than 74 % nucleotide identity to any of the genotype 3 sequences, including from provisional genotypes 3c to 3f. However, a search of the nucleotide database revealed 91% identity to the unpublished sequence of an isolate of HCV from Indonesia (HPCNS5P5). We believe that these two previously

Short communication

unclassified sequences should be considered as a novel subtype within genotype 3 according to the criteria of Simmonds et al. (1994). Identity to other type 3 sequences in the order of 69-73 % justifies inclusion in the genotype and lack of identity above 75 % to the established and proposed subtypes justifies designation as a novel subtype. Seventeen isolates of HCV in this study, including all seven renal transplant and both haemodialysis patients who were PCR-positive, had an identical 5'UTR sequence (HPCMD1). We cannot rule out the possibility of a common source for some of these cases. However, sera from seven of nine PCR-positive patients with chronic liver disease also contained virus with this sequence. Analysis of the five viraemic patients with posttransfusion hepatitis produced sequences HPCMD1 5, consistent with this diversity of sequences being present in the blood donor population. Sequences HPCMD6/ HPCMN6 and HPCMD7/HPCMN7 were derived from the other two patients with chronic liver disease. We conclude that HCV genotype 1 is widespread in this region of southern India along with, and perhaps predominating over, HCV genotype 3. Emerging evidence that infections caused by genotype 1 may be less amenable to treatment with interferon than those caused by genotype 3 (Chemello et al., 1994), and that there is possibly greater pathogenicity of genotype 1 isolates, bode ill for those infected in this region where healthcare is limited. This study was supported by the Overseas Department Administration through the Indc~UK Viral Hepatitis Project, Phase IIl.

References ALTSCHUL,S. F., GISH,W., MILLER,W., MYERS,E. W. & LIPMAN,D. J. (1990). Basic local alignment search tool. Journal of Molecular Biology 215, 403~410. BUKH, J., PURCELL, R. H. & MILLER, R. H. (1992a). Importance of primer selection for the detection of hepatitis C virus RNA with the polymerase chain reaction assay. Proceedings of the National Academy of Sciences, USA 89, 187-191. BUKn, J., PURCELL,R. H. & MILLER, R. H. (1992b). Sequence analysis of the 5' noncoding region of hepatitic C virus. Proceedings of the National Academy of Sciences, USA 89, 4942~,946. CHA, T. A., KOLBERG,J., IRVINE,B., STEMPIEN,M., BEALL,E., YANO, M., CHOO, Q. L., HOUGHTON,M., Kuo, G., HAN, J. H. & URDEA, M. S. (1991). Use of a signature nuc[eotide sequence of hepatitis C virus for detection of viral RNA in human serum and plasma. Journal of Clinical Microbiology 29, 2528-2534. CHA, T. A., BEALL,E., IRVINE,B., KOLBERG,J., CHIEN,D., Kuo, G. & URDEA,M. S. (1992). At least 5 related, but distinct, hepatitis C viral genotypes exist. Proceedings of the National Academy of Sciences, USA 89, 7144-7148. CHAN, S.-W., MCOMISH,F., HOLMES,E. C., DOW, B., PEUTHERER,J. F., FOLLETT, E., YAP, P. L. & SIMMONDS,P. (1992). Analysis of a new hepatitis C virus type and its phylogenetic relationship to existing variants. Journal of General Virology 73, 1131 1141. CHEMELLO,L., ALBERTI,A., ROSE, K. & SIMMONDS,P. (1994). Hepatitis C serotype and response to interferon therapy. New England Journal of Medicine 330, 143.

715

CHOO, Q. L., WEINER,A. J., OVERBY,L. R., Kuo, G., HOUGHTON,M. & BRADLEY,O. W. (1990). Hepatitis C virus the major causative agent of viral non-A, non-B hepatitis. British Medical Bulletin 46, 423~,41. CHOO,Q. L., RICHMAN,K. H., HAN, J. H., BERGER,K., LEE, C., DONG, C., GALLEGOS,C., COLT,D., MEDINASELBY,A., BARR,P. J., WEINER, A. J., BRADLEY,D. W., Kuo, G. & HOUGHTON,M. (1991). Genetic organization and diversity of the hepatitis-C virus. Proceedings of the National Academy of Sciences, USA 88, 2451-9455. ENOMOTO, N., TAKADA,A., NAKAO, T. & DATE, T. (1990). There are two major types of hepatitic C virus in Japan. Biochemical & Biophysical Research Communications 170, 1021-1025. GARSON, J. A., RING, C., TUKE, P. & TEDDER, R. S. (1990). Enhanced detection by PCR of hepatitis C virus RNA. Lancet 336, 878 879. GARSON,J. A., CLEWLEY,J. P., SIMMONDS,P., ZHANG,L. Q., MORI, J., RING, C., FOLLETT,E. A. C., Dow, B. C., MARTIN,S. & GUNSON,H. (1992). Hepatitis C viraemia in United Kingdom blood donors- a multicentre study. Vox Sanguinis 62, 218 223. HAN, J. H., SHYAMALA,V., RICHMAN,K. H., BRAUER,M. J., IRVINE,B., URDEA, M.S., TEKAMPOLSON, P., KUO, G., Cnoo, Q.L. HOUGHTON, M. (1991). Characterization of the terminal regions of hepatitis C viral RNA identification of conserved sequences in the 5" untranslated region and poly(A) tails at the 3' end. Proceedings of the National Academy of Sciences, USA 88, 1711 1715. HHIKATA,M., KATO,N., OOTSUYAMA,Y., NAKAGAWA,M., OHKOSHI, S. 8L SHIMOTOHNO,K. (1991). Hypervariable regions in the putative glycoprotein of hepatitis C virus. Biochemical &Biophysical Research Communications 175, 220-228. HOUGHTON,M., WEINER,A., HAN, J., KUO, G. & CHOO, Q. L. (1991). Molecular biology cf the hepatitis C viruses- implications for diagnosis, development and control of viral disease. Hepatology 14, 381-388. KAMEL, M. A., GHAFFAR,Y. A., WASEF, M. A., WRIGHT, M.. CI,.ARK, L. C. & MILLER, F. D. (1992). High HCV prevalence in Egyptian blood donors. Lancet 340, 427. KANAi, K., KAKO, M. & OKAMOTO, H. (1992). HCV genotypes in chronic hepatitis C and response to interferon. Lancet 339, 1543. KARLIN, S. & AkTSCHUL, S.F. (1990). Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes. Proceedings of the National Academy of Sciences, USA 87, 2264-2268. KATO, N., HIJIKATA,M., OOTSUYAMA,Y., NAKAGAWA,M., OHKOSHI, S., SUGIMURA,T. & SHIMOTOHNO,K. (1990). Molecular cloning of the human hepatitis C virus genome from Japanese patients with non-A, non-B hepatitis. Proceedings of the National Aeadeno, of Sciences, USA 87, 9524-9528. KIYOSAWA,K., TANAKA,E., SODEYAMA,T., YOSHIZAWA,K., YABU,K., FURUTA, K., IMAI, H., NAKANO, Y., USUDA, S., UEMURA, K., FURUTA,S., WATANABE,Y., WATANABE,J., FUKUDA,Y., TAKAYAMA, T., URUSHIBARA,A., MATSUMOTO,A., MORI, H., KOBAYASHI,M., SUZUKI, T., YAMADA,S., SEKI, T., SHIMIZU, S., NAKAMURA,M., SONE, H., HARA,K., ICHIJO,T., OHIKE,Y., GIBO, Y., NAKATSUJI,Y., YODA, H., TSUCHIYA,K., HAYATA,T., IMAI,~(. & HARA, N. (1994). Transmission of hepatitis C in an isolated area in Japan: communityacquired infection. Gastroenterology 106, 1596-1602. MCOMISH, F., CHAN, S. W., Dow, B. C., GILLON, J., FRAME,W. D., CRAWFORD, R.J., YAP, P.L., FOLLETT,E. A. C. & SIMMONDS,P. (1993). Detection of three types of hepatitis C virus in blood donors investigation of type-specific differences in serologic reactivity and rate of alanine aminotransferase abnormalities. Transfusion 33, 7-13. MORI, S., KATO,N., YAGYU,A., TANAKA,T., IKEDA,Y., PETCHCLAI,B., CHIEWSILP,P., KURIMURA,T. ~e;SHIMOTOHNO,K. (1992). A new type of hepatitis C virus in patients in Thailand. Biochemical &Biophysical Research Communications 183, 334-342. ONTO, H., TERAZAWA,S., SASAKI,N., HINO, K., ISHIWATA,C., KAKO, M., UJIIE, N., ENDO, C., MATSUI, A., OKAMOTO,H., MISHIRO, S., KOJIMA, M., AIKAWA,T., SHIMODA,K., SAKAMOTO,M., AKAHANE, Y., YOSHIZAWA,H., TANAKA,T., TOKITA,H. 8¢ TSUDA,F. (1994). Transmission of hepatitis C virus from mothers to infants. New England Journal of Medicine 330. 744-750. OKAMOTO,H., OKADA,S., SUGIYAMA,Y., YOTSUMOTO,S., TANAKA,T., YOSHIZAWA,H., TSUDA, F., MIYAKAWA,Y. & MAYUMI,M. (1990). -

716

Short communication

The Y-terminal sequence of the hepatitis C virus genome. Japanese Journal of E-¢perimental Medicine 60, 167-177. OKAMOTO, H., OKADA, S., SUGIYAMA,Y., KURAI, K., hZUKA, H., MACHIDA, A., MIYAKAWA,Y. & MAYUMI, M. (1991). Nucleotide sequence of the genomic RNA of hepatitis C virus isolated from a human carrier: comparison with reported isolates for conserved and divergent regions. Journal of General Virology 72, 2697-2704. OKAMOTO,H., KURAI, K., OKADA, S. I., YAMAMOTO,K., LIZUKA,H., TANAKA, T., FUKUDA, S., TSUDA, F. & MISHW,O, S. (1992). Fulllength sequence of a hepatitis C virus genome having poor homology to reported isolates - comparative study of four distinct genotypes. Virology 188, 331-341. OKAMOTO,H., TOKITA,H., SAKAMOTO,M., HORIKITA,M., KOJIMA,M., IIZUI¢A, H. & MISHmO, S. (1993). Characterization of the genomic sequence of type-v (or 3a) hepatitis C virus isolates and PCR primers for specific detection. Journal of General Virology 74, 2385-2390. SEEVF, L.B. & ALTER, H.J. (1994). Spousal transmission of the hepatitis C virus. Annals of h~ternal Medicine 120, 807-809. SIMMONDS,P., HOLMZS,E. C., CHA, T.-A., CHAN,S.-W., MCOMISH,F., IRVINE, B., BEALL, E., YAP, P. L., KOLBERG, J. & URDEA, M. S. (1993 a). Classification of hepatitis C virus into six major genotypes and a series of subtypes by phylogenetic analysis of the NS-5 region. Journal oJ"General Virology 74, 2391-2399. SIMMONDS, P,, MCOMISH, F., YAP, P.L., CHAN, S.-W., LIN, C. K., DUSHEIKO, G., SAEED, A. A, & HOLMES, E. C. (1993b). Sequence variability in the 5' non-coding region of hepatitis C virus:

identification of a new virus type and restrictions on sequence diversity. Journal of General Virology 74, 661~668. SIMMONDS,P., SMITH,D. B,, McOMlsH, F,, YAP, P. L., KOLBERG,J., UV,DEA, M. S. & HOLMES, E. C. (1994). Identification of genotypes of hepatitis C virus by sequence comparisons in the core, E1 and NS-5 regions. Journal of General Virology 75, 1053-1061. STUYVER,L., ROSSAU,R., WYSEUR,A., DUHAMEL,M., VANDERBORGHT, B., VAN HEUWRSWYN, H. & MA~RTENS, G. (1993). Typing of hepatitis C virus isolates and characterization of new subtypes using a line probe assay. Journal of General Virology 74, 1093 1102. TAKAMIZAWA,A., MORI, C., FUKE, I., MANABE, S., MURAKAMI,S., FUJITA, J., ONISHI, E., ANDOH, T., YOSHIDA, I. & OKAYAMA,H. (1991). Structure and organization of the hepatitis C virus genome isolated from human carriers. Journal of Virology 65, 1105-1113. TOKITA,H., SHRESTHA,S. M., OKAMOTO,H., SAKAMOTO,M., HORIKITA, M., hZUKA, H., SHRESTHA,S., MIYAKAWA,Y. & MAYUMI,M. (1994). Hepatitis C virus variants from Nepal with novel genotypes and their classification into the third major group. Journal of General Virology 75, 931-936. WEINER,A. J., BRAUER,M. J., ROSENBLATT,J., RICHMAN,K. H., TUNG, J., CRAWFORD~ K., BONINO, F., SARACCO, G., Cnoo, Q.L., HOUGHTON, M. & HAN, J. H. (1991). Variable and hypervariable domains are found in the regions of HCV corresponding to the flavivirus envelope and NS1 proteins and the pestivirus envelope glycoproteins. Virology 180, 842-848.

(Received 17 August 1994; Accepted 3 October 1994)