DNA barcoding allows identification of European Fanniidae (Diptera ...

Forensic Science International 278 (2017) 106–114

Contents lists available at ScienceDirect

Forensic Science International journal homepage: www.elsevier.com/locate/forsciint

DNA barcoding allows identification of European Fanniidae (Diptera) of forensic interest  ski Andrzej Grzywacz* , Dominika Wyborska, Marcin Piwczyn  , Poland Chair of Ecology and Biogeography, Nicolaus Copernicus University, Torun

A R T I C L E I N F O

Article history: Received 19 March 2017 Received in revised form 19 June 2017 Accepted 20 June 2017 Available online 29 June 2017 Keywords: Fanniidae Forensic entomology DNA barcoding Mini-barcode Wolbachia

A B S T R A C T

In forensic entomology practice, species identification is a prerequisite for any further analysis of collected material. Although morphology-based taxonomy may be hindered by a range of factors, these are not obstacles for a molecular identification approach, so-called DNA barcoding. The Fanniidae are a dipteran family that is attracted to and breeds in decomposing animal carrion and dead human bodies. However, morphological identification of fanniids, both at adult and immature stages, is considered to be difficult, particularly for non-experts. We investigated the usefulness of molecular taxonomy methods as an alternative/supplement for morphology-based identification in European Fanniidae of forensic interest. The material used in this study was collected from various regions in Asia, Europe and North America. We sequenced a barcode region of the mitochondrial cytochrome c oxidase subunit I (COI) in 27 species. For 13 species, including some taxa breeding in dead bodies, this study describes COI sequences for the first time. Our analysis revealed that both mini-barcode and full-length COI barcode sequences give very high specimen identification success. Despite the large number of COI barcode sequences referring to Fanniidae in the BOLD and GenBank databases, previous identification of forensically relevant Fanniidae was hindered by uneven taxonomic sampling. The majority of available sequences refer to species that are not of medico-legal interest, and many species of forensic interest are unrepresented or represented only by a single sequence. Because of erroneous data that are present in depository databases, DNA barcoding must be used with caution and cannot be considered to be the sole alternative to other identification methods. Wolbachia infections in the examined material did not disrupt specimen identification. The obtained results will facilitate precise identification of European Fanniidae of forensic interest, badly preserved material with degraded DNA, as well as matching of unidentified females and immature stages to already described specimens. © 2017 Elsevier B.V. All rights reserved.

1. Introduction Various arthropods have a close association with animal and human bodies. The aim of forensic entomology is to study the association of insects with cadavers and their biology for subsequent application in forensic practice [1]. Particularly, the use of entomological evidence allows for an accurate estimation of the minimum post-mortem interval (PMI), which often coincides with the period of insect activity [2]. Thus, accurate species identification is a prerequisite for any further analysis of the collected material [2,3]. Recently, significant progress has been made in the field of

* Corresponding author at: Chair of Ecology and Biogeography, Faculty of Biology and Environmental Protection, Nicolaus Copernicus University, Lwowska 1, 87-100  , Poland. Torun E-mail address: [email protected] (A. Grzywacz). http://dx.doi.org/10.1016/j.forsciint.2017.06.023 0379-0738/© 2017 Elsevier B.V. All rights reserved.

identification of Diptera of medico-legal importance. High-quality and well-illustrated morphological keys facilitate identification of many forensically relevant species [4–7]. However, precise identification of some taxa is still hampered by various factors: timeconsuming rearing to the adult stage of some immature insects (eggs, larvae and pupae) [8]; high morphological similarity of closely related species [9]; occurrence of casual visitors that can be misidentified with regular elements of carrion fauna [10]. In case of any difficulties that hinder prompt and easy species determination, the contribution of experienced taxonomists to identify entomological material may often be required. This is also the case of the dipteran family Fanniidae. A long-standing belief that only a few species of Fanniidae are likely to constitute elements of the insect carrion community was challenged by recent studies [11–13]. In Europe, decomposing carrion and cadavers attract approximately 30 species of Fanniidae; this is in spite of the lower number of species that actually breed in these

A. Grzywacz et al. / Forensic Science International 278 (2017) 106–114

habitats [11,12]. Fanniidae can be found either in forest habitats or synanthropic conditions [14], at the early, moist stages of cadaver decomposition [15] or advanced stages when larvae of other flies have finished development [12]. Fanniidae are known for their ability to exploit buried remains [16,17] and those placed in indoor conditions [15,18]. In the latter case, their presence may indicate neglect of the living person because fanniids are prone to oviposit on bodies before death if they are contaminated with faeces and urine [19]. Fanniidae despite their usefulness for medico-legal purposes [11,12,18], cannot be fully exploited in forensic investigations due to the issues of species identification. Male fanniids are relatively easy to identify because of their chaetotaxy details, body colour and dusting pattern, various leg armature modifications and details of the genitalia, which for many species comprise robust, species-specific characters [14]. However, the great majority of specimens collected from carrion and cadavers are females [20]. Contrary to males, females of many closely related species can only be discriminated based on very few vague characters [14]. On the other hand, females of some carrionvisiting species are still unknown [14]. Also existing keys for larval identification are confusing and do not allow for prompt and easy identification [14,21]. Morphology-based taxonomy may be hindered by the aforementioned factors, yet these are not obstacles for a molecular identification approach [22]. DNA barcoding aims to provide taxonomic identification for examined specimens based on the fundamental assumption that each species has a unique barcode (a standardized, short DNA sequence), and this barcode indicates certain species [23]. The substantial advantage of a DNA-based identification approach is the possibility of identifying all life stages of a given species [24,25]. An essential condition of extensive application of DNA barcoding is a reference library of gene sequences obtained from correctly, morphologically, identified specimens [22,26]. This is a significant issue because mistakes in the initial stage of material identification will result in an erroneous assignment of gene sequence to species [26]. Up to 66% of insect species are expected to be infected with the intracellular symbiotic bacterium Wolbachia [27]. Wolbachia may disrupt the pattern of mitochondrial DNA (mtDNA) variation and impact identification accuracy by means of DNA barcoding [28]. Wolbachia may cause homogenization of mtDNA of different species (two species, one barcode) or increase intraspecific gene diversity (one species, two barcodes) [29]. Thus, screening of material for the presence of endosymbiotic bacteria should be considered a routine step in DNA barcoding studies. Originally about 650-bp long fragment of the 50 end of the mitochondrial cytochrome c oxidase subunit I (COI) was proposed as a universal marker for metazoan DNA barcoding [23]. In comparison to this fragment, which has a greater than 97% species specificity, the 100-bp long 50 end of the COI barcode region can already provide 90% success in metazoan identification [30]. So-called mini-barcodes can be used, for instance, in cases of old material identification, because shorter gene fragment amplification is not as much constrained by DNA degradation [30]. The usefulness of molecular taxonomy as a supplement/ substitute for a morphology-based identification approach has also been validated for forensically relevant arthropods [22]. The most widely examined for DNA barcoding purposes is the COI marker [31–35]. However, with some exceptions [36], validation of COI mini-barcodes is still not considered to be a standard element of data analysis. Because COI did not allow for the discrimination of some taxa of medico-legal interest, several other markers were recently investigated: cyt b [37], ITS2 [37,38], 16S [39], and EF1a [40]. Although significant progress has been observed in the application of DNA barcoding in the identification of dipterans of forensic interest, the majority of studies have mainly focused on

107

insects that are most commonly used in forensic investigations, such as blowflies [33,38] and flesh flies [36,39]. Very few studies have focused on other, but still important, groups [31,40]. To date, no comprehensive study has been undertaken to validate the usefulness of the DNA barcoding approach for taxonomic purposes of Fanniidae of medico-legal importance. Previous authors provided DNA sequences for a few species of forensic interest as an addition to studies of other forensically relevant dipteran families [32,41–43]. Although numerous COI barcode region sequences can be found in the BOLD and GenBank depository databases, the great majority refer to common woodland species of no forensic importance. The aim of this study was to assemble a reference library of the barcode region of COI for European Fanniidae of forensic interest. To validate application of molecular taxonomy methods we (1) studied intra- and interspecific gene diversity to test for the presence of a barcoding gap in newly obtained data and those retrieved from various depository databases, (2) studied specimen identification success for full-length and mini-barcode regions of COI for a few combinations of retrieved sequences, and (3) checked whether the obtained sequences form monophyletic clusters of species in phylogenetic analysis. Because maternally transmitted bacterial endosymbiotic parasites may affect the performance of DNA barcodes [28], we additionally screened all specimens used in this study for the presence of Wolbachia. 2. Material and methods 2.1. Sampling We sampled the European Fanniidae of forensic interest, both those considered useful for medico-legal purposes and casual carrion visitors, from various regions in Asia, Europe and North America (Table S1, Appendix). The first set included species that are regularly reported to visit and breed in carrion and human cadavers: Fannia aequilineata Ringdahl, Fannia canicularis (Linnaeus), Fannia coracina (Loew), Fannia latipalpis (Stein), Fannia leucosticta (Meigen), Fannia manicata (Meigen), Fannia monilis (Haliday), Fannia pusio (Wiedemann) and Fannia scalaris (Fabricius) [11,12,44,45]. The second set integrated species of potential forensic importance, less frequently reported: Euryomma peregrinum (Meigen), Fannia fuscula (Fallén), Fannia incisurata (Zetterstedt), and Piezura graminicola (Zetterstedt) [14]. We also sampled species considered casual visitors, which may be unpredictably attracted to decomposing tissues [46]: Fannia armata (Meigen), Fannia collini d’Assis-Fonseca, Fannia lepida (Wiedemann), Fannia lustrator (Harris), Fannia nigra Malloch, Fannia ornata (Meigen), Fannia parva (Stein), Fannia polychaeta (Stein), Fannia rondanii (Strobl), Fannia serena (Fallén), Fannia sociella (Zetterstedt), Fannia umbrosa (Stein), Fannia vesparia (Meade), and Piezura pardalina Rondani [13,20,47]. For the majority of species, we only used males to avoid any errors arising from female misidentification. Females were only used for species distinct via morphology from closely related species (e.g., F. ornata, F. lepida, F. leucosticta). Material was collected with an entomological net, various carrion baited traps or pitfall traps surrounding decomposing carrion. Both insects stored in 70–96% ethanol and pinned specimens were used in this study. Insects were identified by the first author according to Rozkošný et al. [14]. Voucher specimens have been deposited in the collection of the Chair of Ecology and Biogeography, Nicolaus Copernicus University. 2.2. DNA extraction, amplification and sequencing Total genomic DNA was isolated from thoracic muscles, detached legs or entire specimens using a DNeasy Blood & Tissue

108

A. Grzywacz et al. / Forensic Science International 278 (2017) 106–114

Kit (Qiagen, Valencia, CA, USA) following the manufacturer’s protocol. To obtain the COI barcode region, we used the primers COI-Fex-MP, COI-Rex-MP [48], TY-J-1460 and C1-N-2191 [49] (Table 1). In addition, we used the primers Uni-MinibarF1 and UniMinibarR1 [30] to amplify and sequence a 130-bp mini-barcode fragment (Table 1). We performed a standard 25-ml PCR for each sample using 1  PCR buffer, 0.2 mM dNTPs, 0.2 mM of each primer, 2 mM MgCl2, 1 U of Taq DNA polymerase (Thermo Scientific), and 1–2 ml of the DNA template. For some difficult samples, we also added 2.5% of DMSO, or, if the band was barely visible after electrophoresis, we carried out re-amplification. If the standard Taq-based PCR reaction did not work, we used high-fidelity Phusion polymerase (Thermo Scientific). The PCR cycles for Taq DNA polymerase and high fidelity Phusion polymerase were as follows: 94  C/98  C for 2 min/30 s, 30–36 cycles 94  C/98  C for 30 s/7 s, 50  C/60  C for 30 s/20 s, and 70  C/72  C for 45 s/15 s, followed by a final extension at 70  C/72  C for 10/5 min. The PCR products were electrophoresed in a 1% agarose gel, stained with ethidium bromide or GelRed (Biotium, Darmstadt, Germany) and photographed with a gel documentation system. For sequencing, we only used samples without obvious polymorphisms (multiple bands from a single PCR product). The PCR products were purified either by the addition of 0.1 volume of 3 M NaOAc, 0.1 volume of 125 mM EDTA and 2.5 volume of 95% EtOH or AMPure XP (Agencourt Bioscience Corporation). In the latter case, we used 1.8 ml of AMPure XP per 1.0 ml of PCR product. Purified products were re-suspended in water, and the DNA yield was measured using a NanoDrop Spectrophotometer (Thermo Scientific, Wilmington, DE, USA). Cycle sequencing reactions were carried out using the PCR product (5–20 ng/ml of template DNA) and fluorescent Big Dye terminators (Applied Biosystems, Foster City, CA, USA). The final products were resolved using an automated DNA sequencer at the Laboratory of Molecular Biology  , Poland). The sequences were assembled Techniques, UAM (Poznan and edited using SeqMan II ver. 4.0 (DNASTAR, Madison, WI, USA); both DNA strands were considered. All newly obtained sequences have been deposited in GenBank, KY511149–KY511238 (Table S1, Appendix). All examined specimens were screened for the presence of the endosymbiotic bacterium Wolbachia. For this purpose, we used the wsp 81 F and wsp 691 R primers [50] to amplify the sequence of a major surface protein gene of Wolbachia (Table 1). The PCR products were electrophoresed in an agarose gel, as previously described, and visually inspected for the presence of bands from products of approximately 600 bp in size. Samples with PCR products of distinct length were sequenced (data not shown) as previously described and checked against the GenBank database to confirm the presence of Wolbachia.

graphical interface in Seaview 4.4.0 [52] and trimmed to a 658-bp long barcode fragment. The resulting matrix was checked for frame shifts or stop codons. For specimen identification success, we used uncorrected pairwise distance calculations [53] instead of the broadly accepted Kimura-2-parameter because the former is recommended for analysis of short barcoding sequences derived from closely related species [54]. We applied “best match” (BM), “best close match” (BCM) and “all species barcodes” (ASB) criteria to estimate the proportion of correctly identified specimens in SpeciesIdentifier v1.8 [55]. Under the BM criterion, a query sequence is assigned to the closest match, regardless of sequence similarity, and identification is considered to be correct when both sequences represent the same species. Identification is correct under the BCM criterion when the query and its closest match are conspecifics and the similarity between both sequences is below the calculated threshold. The threshold is obtained from frequency distribution of all intraspecific distances in a given dataset and represents a value below which 95% of intraspecific distances are found. Under the ASB criterion, identification is correct when the query sequence matches at least two conspecifics and the similarity to both sequences is below the threshold calculated for BCM. Identifications are always considered incorrect when the closest match does not correspond with the conspecific sequence and is ambiguous when multiple species give equally good best matches. In the case of the ASB criterion, identification is also determined to be ambiguous when only a single conspecific gives a match that is similar to the query below the calculated threshold. Under the BM and ASB criteria, queries without a match below the calculated threshold are considered to be unidentified. Species represented in the dataset by a single sequence are never correctly identified under the BM and BCM criteria or by two sequences under the ASB criterion. We calculated specimen identification success for five datasets: (1) 658-bp long newly obtained sequences, (2) 130bp long newly obtained sequences, (3) 658-bp long original as well as BOLD and GenBank retrieved sequences, (4) 658-bp long original as well as selected BOLD and GenBank retrieved sequences, and (5) 130-bp long original and selected BOLD and GenBank retrieved sequences. For all species, except those represented by a single sequence, the highest intraspecific distance for each individual was plotted against the distance to the nearest neighbour [56] to check for the presence of a barcode gap. For the graphical presentation of our data, we performed Neighbour Joining (NJ) phylogenetic analysis using the pairwise distance in MEGA7 [57] with 1000 bootstrap replications. 3. Results 3.1. Obtained sequences

2.3. Sequence alignment and data analysis We additionally retrieved publicly available COI sequences referring to Fanniidae from the BOLD and GenBank databases. DNA sequences were aligned using MUSCLE [51] through the Table 1 Primers used in study. Name

Sequence

Reference

COI-Fex-MP COI-Rex-MP TY-J-1460 C1-N-2191 Uni-MinibarF1 Uni-MinibarR1 wsp 81 F wsp 691 R

50 TGCCTAAACTTCAGCCATT 50 GGAGCTTAAATCCATTGCAC 50 TACAATTTATCGCCTAAACTTCAGCC 50 CCCGGTAAAATTAAAATATAAACTTC 50 TCCACTAATCACAARGATATTGGTAC 50 GAAAATCATAATGAAGGCATGAGC 50 TGGTCCAATAAGTGATGAAGAAAC 50 AAAAATTAAACGCTACTCCA

Grzywacz et al. [48] Grzywacz et al. [48] Bernasconi et al. [49] Bernasconi et al. [49] Meusnier et al. [30] Meusnier et al. [30] Braig et al. [50] Braig et al. [50]

We isolated genomic DNA for 90 specimens of Fanniidae representing 27 species (Table S1, Appendix). We successfully sequenced the full COI barcode region (658 bp) for 88 specimens. For two specimens, F. umbrosa and F. vesparia, we obtained shorter fragments that were 645-bp and 640-bp long, respectively. The universal primers Uni-MinibarF1 and Uni-MinibarR1 allowed for the successful amplification of a mini-barcode region in the examined species (data not shown). Additionally, we retrieved 2946 COI barcode sequences from the BOLD and GenBank databases. After initial checking, we removed unverified sequences and those referring to the family or genus level only (739 sequences). Subsequently, we excluded sequences referring to species not occurring in Europe and those not reported in the forensic entomology literature so that a total of 338 additional sequences representing 14 species were included in the analysis. Among those sequences, a great majority (276) referred to species

A. Grzywacz et al. / Forensic Science International 278 (2017) 106–114

randomly visiting carrion and cadavers: F. armata (97), F. fuscula (18), F. lustrator (30), F. ornata (10), F. serena (8), and F. sociella (113). Although we found a large number of sequences for cosmopolitan F. canicularis (52), other species of forensic interest were represented by single or very few sequences: F. aequilineata (1), F. incisurata (2), F. manicata (1), F. monilis (1), F. pusio (1), F. scalaris (3), and P. graminicola (1). For 13 species, we did not find any sequences in the depository databases. Hence, the present study is the first to provide COI barcode sequences for E. peregrinum, F. collini, F. coracina, F. latipalpis, F. lepida, F. leucosticta, F. nigra, F. parva, F. polychaeta, F. rondanii, F. umbrosa, F. vesparia and P. pardalina.

109

3.2. Identification success In newly obtained data, we observed the highest intraspecific distance in F. canicularis (2.43%), and in 16 species, we did not observe any intraspecific haplotype diversity. For several species (e.g., F. aequilineata, F. manicata, F. monilis, F. scalaris), specimens from different countries shared the same species-specific haplotype. The lowest interspecific distance was found between F. collini and F. nigra (3.95%), and the highest interspecific distance was found between F. collini and F. pusio (14.74%). For all newly obtained sequences, we found a distinct barcode gap, i.e., the intraspecific and interspecific distances did not overlap (Fig. 1A). Visual

Fig. 1. Distance to the furthest conspecific sequence (maximum intraspecific distance) plotted against the distance to the nearest nonconspecific (nearest neighbour distance). The solid line represents a 1:1 relationship at or below which the difference between the two is zero or negative, indicating no barcoding gap.

110

A. Grzywacz et al. / Forensic Science International 278 (2017) 106–114

reconstruction of the obtained data by means of NJ method revealed that all of the original data formed highly supported monophyletic clusters (Fig. 2). We also found a high proportion of correctly identified specimens based on these data (Table 2). All sequences with at least one conspecific (96.67%) were correctly identified under the BM criterion, and incorrect identifications were restricted to sequences without any conspecific (3.33%). In the BCM criterion, we found 95.56% correct identifications, while 4.44% of specimens did not have a match closer than the calculated threshold (2.12%). They represented three specimens without conspecifics and a sequence referring to F. canicularis (KY511161), which had the closest, successful match equal to the calculated threshold of 2.12%. Under the ASB criterion, we found that 86.67% of sequences were correctly identified. Sequences classified in BCM as sequences without any match closer than the calculated threshold were similarly classified in ASB. Additionally, eight sequences (8.89%) were classified as ambiguous identifications, and these were sequences with only a single valid conspecific. When all of the data retrieved from BOLD and GenBank were used in the analysis (428 sequences in total), we did not observe a barcoding gap for some specimens, i.e., the maximum intraspecific distance was higher than the distance to the nearest interspecific neighbour (Fig. 1B). After a detailed examination of the entire dataset, we found ten puzzling sequences that affected the barcode gap and did not form monophyletic sequence clusters with other conspecifics. These puzzling sequences referred to F. canicularis (AJ879592, KC249708, KC249709, KC249710, KF751463), F. incisurata (KR385338, HM412427) and F. fuscula (SSKUA9378, SSKUA9387, KM649443) (Tree 1 in Fig. S1, Appendix). A comparison with other sequences deposited in the BOLD and GenBank databases revealed that three sequences referring to F. canicularis (KC249708, KC249709, KC249710) were highly similar to those of Musca domestica Linnaeus (98–99.6%). Two remaining sequences, those of AJ879592 and KF751463, differed from other conspecific sequences by up to 16 and 19%, respectively. The closest match in BOLD for sequence AJ879592 was Fannia atripes Stein (90.48% similarity), whereas for sequence KF751463, it was Fannia tibialis Malloch (92%). The sequence referring to F. incisurata (KR385338) clustered with F. coracina and was 100% similar to the F. coracina sequence deposited in the BOLD database as “Early Release”. A second puzzling F. incisurata sequence (HM412427) was similar to that of Fannia genualis (Stein) (98.93%). Fannia fuscula (SSKUA9378, SSKUA9387, KM649443) sequences formed a well-separated cluster, with F. vesparia as a sister clade. These ten ambiguous sequences significantly influenced the overlap between intra- and interspecific distances. When pruned from the analysis, we again observed a barcoding gap for all individuals (Fig. 1C) and monophyletic clusters of conspecifics (Tree 2 in Fig. S1, Appendix). These sequences also affected specimen identifications. Although BM and BCM provided a very high identification success with only five incorrect identifications (1.17%) in both criteria, the ASB criterion revealed 74 ambiguous (17.25%) and three incorrect (0.70%) identifications (Table 2). After pruning these puzzling sequences, all sequences were identified correctly, while incorrect or ambiguous identifications were mainly species represented by a single or two sequences. In the BM and BCM criteria, only two sequences (0.48%), without conspecifics, were not correctly identified. In the ASB criterion, we did not find any incorrect identifications and all sequences with at least two conspecifics were correctly identified (97.61%). 3.3. Mini-barcodes The analysis of shorter 130-bp long COI sequences, both for the originally obtained data and an enlarged dataset without puzzling sequences, revealed a similar very high sequence identification

success (Table 2). The specimen identification success did not differ significantly from the results obtained for the full-length barcode region. In the BM criterion, we found the same number of correct identifications, and in BCM criterion, only a single sequence less was correctly identified in both datasets. Comparison of the ASB criterion results revealed a difference in identification success of a single and six sequences in newly obtained data and those enriched for BOLD and GenBank sequences, respectively. 3.4. Occurrence of Wolbachia Among the specimens used in this study, we found 23 cases that contained Wolbachia. In total, 16 species were infected with endosymbionts (Fig. 2). A blast search of the sequenced PCR products confirmed amplification of the major surface protein of Wolbachia (data not shown). We did not find species represented only by infected specimens. The presence of Wolbachia neither affected the specimen identification success nor influenced the monophyly of conspecific sequences (Fig. 2). 4. Discussion Our study provides the most comprehensive reference library of COI barcode sequences for European Fanniidae of forensic interest. It is also the first attempt to investigate the usefulness of DNA barcoding for the identification of Fanniidae. Despite the large number of COI barcode sequences referring to Fanniidae in the BOLD and GenBank databases, the great majority of them are not useful for forensic entomologists as they refer to species of no medico-legal interest. Although we found some numbers of sequences referring to Fanniidae of forensic interest, we observed uneven taxonomic sampling, with many species unrepresented or represented only by a single sequence. This gap has been filled by this study, which provided a COI barcode for 27 species, of which 13 were sequenced for the first time. Among these, species known to develop in cadavers are present as follows: F. coracina, F. latipalpis and F. leucosticta. We provide herein sequences for both species widespread and common throughout Europe and those considered rare or restricted in their distribution to some parts of the continent. We used in this study fanniids less frequent (F. monilis) or absent in northern parts of the continent (F. latipalpis, F. leucosticta, F. pusio, E. peregrinum) and absent in southern parts (F. nigra) [14]. We are aware that this study does not provide COI barcode sequences for all European Fanniidae of forensic interest. We did not sample, for instance, two rare species, Fannia lineata (Stein) and Fannia conspecta Rudzinski et al. [14], which recently were reported from forensically oriented entomological experiments [20,58]. Nevertheless, the library provided herein will facilitate identification of the majority of the forensically relevant Fanniidae from different European regions and allow for their broader application in medico-legal purposes. Furthermore, the dataset can already prove its usefulness. Sonet et al. [32] investigated the utility of the BOLD and GenBank databases for the identification of dipterans collected from human bodies. Although most of the 16 collected species were identified successfully, three collected Fannia Robineau-Desvoidy species could not be identified to the species level. Our re-examination of sequences obtained by Sonet et al. [32] allowed identification of their specimens Fannia sp1 (KF919020), Fannia sp2 (KF919021) and Fannia sp3 (KF919022), as F. lustrator, F. manicata and F. nigra, respectively. We included in this study not only species of well-known forensic importance but also those that may potentially occur on or in the close vicinity of cadavers. This allowed us to identify F.

A. Grzywacz et al. / Forensic Science International 278 (2017) 106–114

111

Fig. 2. Neighbour joining phylogenetic analysis of newly obtained sequences of the COI barcoding region of European Fanniidae of forensic interest. Values above the branches indicate bootstrap support for sequence clusters. Names of species known to breed in carrion and human cadavers are bolded. Numbers and acronyms beside species names correspond with the voucher ID number and geographic origin of the specimen (CN, China; DE, Germany; ES, Spain; GB, Great Britain; HU, Hungary; RU, Russia; PL, Poland; PT, Portugal; US, United States of America). Specimens infected with Wolbachia are marked with W+.

112

A. Grzywacz et al. / Forensic Science International 278 (2017) 106–114

Table 2 Specimen identification success calculated in SpeciesIdentifier 1.8 for newly obtained sequences and sequences retrieved from BOLD and GenBank in five various combinations. Original data 658 bp

Original data 130 bp

Original, BOLD and GenBank data All sequences 658 bp

Selected sequences 658 bp

Selected sequences 130 bp

Species (with valid conspecifics): Sequences (with valid conspecific sequence):

27 (24) 90 (87)

27 (24) 90 (87)

27 (25) 428 (426)

27 (25) 418 (416)

27 (25) 418 (416)

Calculated threshold for Best Close Match Sequences with a closest match at 0%: Allospecific matches at 0%

2.12% 74 0

1.53% 82 0

13.35% 382 0

2.09% 377 0

1.92% 406 0

Best Match Correct identifications Ambiguous identifications Incorrect identifications

87 (96.67%) 0 3 (3.33%)

87 (96.67%) 1 (1.11%) 2 (2.22%)

423 (98.83%) 0 5 (1.17%)

416 (99.52%) 0 2 (0.48%)

416 (99.52%) 0 2 (0.48%)

Best Close Match Correct identifications Ambiguous identifications Incorrect identifications Sequences without any match closer than the calculated threshold

86 (95.56%) 0 0 4 (4.44%)

85 (94.44%) 0 0 5 (5.56%)

423 (98.83%) 0 5 (1.17%) 0

416 (99.52%) 0 0 2 (0.48%)

415 (99.28%) 0 0 3 (0.72%)

All Species Barcodes Correct identifications Ambiguous identifications Incorrect identifications Sequences without any match closer than the calculated threshold

78 (86.67%) 8 (8.89%) 0 4 (4.44%)

77 (85.55%) 8 (8.89%) 0 5 (5.56%)

351 (82.05%) 74 (17.25%) 3 (0.70%) 0

408 (97.61%) 8 (1.91%) 0 2 (0.48%)

402 (96.17%) 14 (3.35%) 0 2 (0.48%)

lustrator and F. nigra collected on human cadavers by Sonet et al. [32]. For newly obtained data, we observed well-separated, monophyletic clusters on a phylogenetic tree (Fig. 2). We found a distinct barcoding gap (Fig. 1A), and specimen identification success was very high (Table 2). We found incorrect identifications mostly in species that did not meet the criteria of the minimum number of conspecifics for BCM and ASB, respectively. A single specimen of F. canicularis (KY511161) was not correctly identified because the closest match was equal to, not lower than, the calculated threshold (2.12%). However, this distance was still lower than the proposed 3% minimum threshold for interspecific gene diversity in DNA barcoding [23]. When the threshold was set to 3%, only specimens without a sufficient number of conspecifics were not identified correctly (data not shown). However, when all of the BOLD and GenBank retrieved data were included in the analysis, we found some sequences, referring to F. canicularis, F. incisurata and F. fuscula, that failed to form monophyletic clusters (Tree 1 in Fig. S1, Appendix). In the enriched dataset, for some sequences, we observed the maximum intraspecific distance to be higher than the distance to the nearest neighbour (Fig. 1B). Although the overlap between the intra- and interspecific distances do not indicate the lack of the barcoding gap necessary for unambiguous sequence identification [26], subsequent analysis revealed that specimen identification success deteriorated from these puzzling sequences. Tree sequences referring to F. canicularis (KC249708, KC249709, KC249710) [42] were highly different from the remaining F. canicularis sequences (12.5–16%) and, according to a BLAST search, matched M. domestica. Misidentifications of specimens used in DNA barcoding studies can be a good source of errors in reference libraries, which afterwards may lead to erroneous specimen identification [26,36]. In the case of adult Fanniidae, misidentifications are possible not only due to human error and misinterpretation of morphological characters but also because of the lack of morphological descriptions of females of some species. For F. fuscula sequences (SSKUA9378, SSKUA9387,

KM649443), no information about the specimen gender was available, and in the case of F. incisurata (KR385338, HM412427), females were used. As these sequences were obtained from individuals collected in North America, misidentifications are possible, as Nearctic Fannia americana Malloch is almost indistinguishable from F. fuscula and females of Fannia annosa Chillcott and Fannia ciliatissima Chillcott, which are closely related to F. incisurata, are unknown [59]. Therefore, the exclusive use of Fanniidae females in DNA barcoding studies may be a source of misidentification. DNA barcoding, according to our results, is a valuable supplementary method for identification of European Fanniidae of medico-legal relevance. However, this approach cannot be considered to be an alternative to other identification methods. Because depository databases contain potentially erroneous data, they must be used with caution and in case of any ambiguity, specimen identification should not be limited solely to molecular methods. The confusing performance of puzzling sequences could also result from either incomplete lineage sorting, hybridization, introgression or even the effect of an endosymbiont [28,48]. Among the impressive range of effects on its hosts [60], one may find the influence of Wolbachia on insect population genetics. Infections of this bacterium were found to be widespread within the superfamily Muscoidea, including Anthomyiidae, Fanniidae, Muscidae and Scathophagidae [61], and this is congruent with our results. Although some studies have showed limited performance of mtDNA application in a molecular taxonomy approach due to the presence of Wolbachia [28,62], we did not observe its presence to coincide with failure of specimen identification in originally obtained sequences. However, we found low or even no COI barcode diversity in some species. Within originally obtained sequences, even specimens from distinct localities shared a single species-specific haplotype (F. aequilineata, F. manicata, F. monilis, F. scalaris). Low mtDNA intraspecific diversity in various insect species is often associated with the presence of endosymbiotic microbes [29]. The event of a population infection with Wolbachia

A. Grzywacz et al. / Forensic Science International 278 (2017) 106–114

may be followed by the widespread distribution of the mtDNA haplotype associated with the initial infection. Other haplotypes will be lost from the population due to selective sweeps instead of demographic events [29]. Wolbachia can also cause mtDNA introgression between closely related species [28]. Despite the occurrence of Wolbachia in our material, we did not observe a confusing performance of the originally obtained sequences (Fig. 2). Thus, we eliminated the influence of the endosymbiont, at least in the originally obtained sequences. In forensic practice, in some cases, only parts of insects are found or the material for examination is badly preserved [36]. This is also the case of Fanniidae, which can be found on bodies discovered a long time after death [63] or at archaeological sites [64]. In such cases, insects, often devoid of species-specific morphological characters, can only be identified by means of molecular methods. However, both situations may result in a failure of amplification and sequencing of full-length DNA barcode marker. Our additional analysis of significantly shorter (130-bp long 50 end of the COI barcode region) sequences showed a very high specimen identification success (Table 2). The mini-barcode, in comparison with a full-length fragment, for both newly obtained and selected sequences retrieved from depository databases, gave only slightly less correct identifications. Subsequently, we found that the universal primers Uni-MinibarF1 and Uni-MinibarR1 [30], which were designed for amplification of mini-barcode region, performed well in European Fanniidae of forensic interest. This phenomenon will facilitate broad application of DNA barcoding methods in Fanniidae, for example, in badly preserved material, archival samples and insect fragments, all with degraded DNA. However, the minimum sequence length necessary for specimen identification varies between insect groups. Although according to our results in Fanniidae the usefulness of the short- and full-length fragments did not differ, the mini-barcode did not allow for the identification of many species of Sarcophaga Meigen [36]. In flesh flies, the mini-barcode gave an approximately 15.7–18.6% lower identification success under the BM and BCM criteria. In an evolutionary sense, the diverse genus Sarcophaga, compared with Fanniidae, is a younger group of insects [65] that underwent recent rapid radiation, which resulted in a lower genetic differentiation between species [66]. 5. Conclusions Our analysis revealed that molecular taxonomy may be successfully applied for taxonomical purposes in European Fanniidae of forensic interest. The low intra- and relatively high interspecific diversity of COI barcode region allowed us to correctly identify species visiting and colonising animal and human bodies. Application of shorter fragments of the COI gene, mini-barcodes, allowed for specimen identification with an identification success comparable to that of using the full-length barcode region. Wolbachia infections in examined material did not disrupt the specimen identification success. Provided herein is a reference dataset that has already proven its usefulness. We found that some sequences deposited in the BOLD and GenBank databases that refer to Fanniidae of forensic interest must be used with caution. We also determined previously unidentified specimens collected from human bodies. Because females and/or immature stages of some carrion visiting species are still unknown, it is possible that they could be misidentified as other species if available morphological keys were used for identification. Our results will allow for the matching of unidentified females and immature stages to already known males. This study is an invaluable contribution considering the scarcity of data about the European Fanniidae of forensic interest and it will facilitate their broader application for medicolegal purposes.

113

Acknowledgments We would like to express our appreciation to Dr. Chong Chin Heo (Universiti Teknologi MARA, Malaysia), Ms. Nina Feddern (University Hospital Goethe University Frankfurt, Germany), Dr. Szymon Matuszewski (Adam Mickiewicz University, Poland), Dr. Thomas Pape (University of Copenhagen, Denmark), Dr. Adrian C. Pont (Oxford University Museum of Natural History, UK) and Mr. Nikita Vikhrev (Zoological Museum of Moscow University, Russia) for the aid in obtaining material of some species. We would also  ski (University of Porto, Portugal) like to thank Dr. Zbyszek Boratyn for help during a field trip to Portugal. The present study received financial support from the Ministry of Science and Higher Education grant IUVENTUS PLUS (grant no. 0146/IP1/2015/73) and Faculty of Biology and Environmental Protection, Nicolaus Copernicus University (grant no. 2240-B) to the first author and National Science Centre, Poland (grant no. UMO-2015/17/B/NZ8/ 02453) to the third author. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j. forsciint.2017.06.023. References [1] S. Matuszewski, D. Bajerlein, S. Konwerski, K. Szpila, An initial study of insect succession and carrion decomposition in various forest habitats of Central Europe, Forensic Sci. Int. 180 (2008) 61–69. [2] J. Amendt, C.P. Campobasso, E. Gaudry, C. Reiter, H.N. LeBlanc, M.J.R. Hall, Best practice in forensic entomology-standards and guidelines, Int. J. Legal Med. 121 (2007) 90–104. [3] N.J. Gotelli, A taxonomic wish-list for community ecology, Philos. Trans. R. Soc. Lond. B. Biol. Sci. 359 (2004) 585–597. [4] K. Akbarzadeh, J.F. Wallman, H. Suláková, K. Szpila, Species identification of Middle Eastern blowflies (Diptera: Calliphoridae) of forensic importance, Parasitol. Res. 114 (2015) 1463–1472. [5] S. Rochefort, M. Giroux, J. Savage, T.A. Wheeler, Key to forensically important Piophilidae (Diptera) in the Nearctic region, Can. J. Arthropod. Identif. 27 (2015) 1–37. [6] A. Grzywacz, M.J.R. Hall, T. Pape, K. Szpila, Muscidae (Diptera) of forensic importance—an identification key to third instar larvae of the western Palaearctic region and a catalogue of the muscid carrion community, Int. J. Legal Med. 131 (2017) 855–866. [7] K. Szpila, R. Richet, T. Pape, Third instar larvae of flesh flies (Diptera: Sarcophagidae) of forensic importance—critical review of characters and key for European species, Parasitol. Res. 114 (2015) 2279–2289. [8] D. Martín-Vega, A. Baz, L.M. Díaz-Aranda, The immature stages of the necrophagous fly, Prochyliza nigrimana: comparison with Piophila casei and medicolegal considerations (Diptera: Piophilidae), Parasitol. Res. 111 (2012) 1127–1135. [9] K. Szpila, A. Ma˛dra, M. Jarmusz, S. Matuszewski, Flesh flies (Diptera: Sarcophagidae) colonising large carcasses in Central Europe, Parasitol. Res. 114 (2015) 2341–2348. [10] A. Grzywacz, J. Amendt, H. Fremdt, Seek, and ye shall find – the example of Neohydrotaea lundbecki (Michelsen) (Diptera: Muscidae), a rare muscid species or just ignored so far in forensic entomology? North. West. J. Zool. 12 (2016) 196–198. [11] S. Matuszewski, D. Bajerlein, S. Konwerski, K. Szpila, Insect succession and carrion decomposition in selected forests of Central Europe. Part 2: composition and residency patterns of carrion fauna, Forensic Sci. Int. 195 (2010) 42–51. [12] A. Ma˛dra, K. Fra˛tczak, A. Grzywacz, S. Matuszewski, Long-term study of pig carrion entomofauna, Forensic Sci. Int. 252 (2015) 1–10. [13] A. Fiedler, M. Halbach, B. Sinclair, M. Benecke, What is the edge of a forest? A diversity analysis of adult Diptera found on decomposing piglets inside and on the edge of a western German woodland inspired by a courtroom question, Entomol. Heute 20 (2008) 173–191. [14] R. Rozkošný, F. Gregor, A.C. Pont, The European Fanniidae (Diptera), Acta Sci. Nat. Brno. 31 (1997) 1–80. [15] K.G.V. Smith, A Manual of Forensic Entomology, British Museum (Natural History), London, and Cornell University Press, Ithaca, NY, 1986. [16] R. Mariani, R. García-Mancuso, G.L. Varela, A.M. Inda, Entomofauna of a buried body: study of the exhumation of a human cadaver in Buenos Aires Argentina, Forensic Sci. Int. 237 (2014) 19–26. [17] B. Bourel, G. Tournel, V. Hédouin, D. Gosset, Entomofauna of buried bodies in northern France, Int. J. Legal Med. 118 (2004) 215–220.

114

A. Grzywacz et al. / Forensic Science International 278 (2017) 106–114

[18] M. Benecke, E. Josephi, R. Zweihoff, Neglect of the elderly: forensic entomology cases and considerations, Forensic Sci. Int. 146S (2004) S195–S199. [19] M. Benecke, R. Lessig, Child neglect and forensic entomology, Forensic Sci. Int. 120 (2001) 155–159. [20] A. Grzywacz, C.P. e Castro, New records of Fannia Robineau-Desvoidy (Diptera: Fanniidae) collected on pig carrion in Portugal with additional data on the distribution of F. conspecta Rudzinski, Entomol. Fennica 23 (2012) 169–176. [21] L. Lyneborg, Taxonomy of European Fannia larvae (Diptera, Fanniidae), Stuttgarter Beiträge Zur Naturkd. Aus Dem Staatl. Museum Für Naturkd, Stuttgart 215 (1970) 1–28. [22] J.D. Wells, J.R. Stevens, Application of DNA-based methods in forensic entomology, Annu. Rev. Entomol. 53 (2008) 103–120. [23] P.D.N. Hebert, A. Cywinska, S.L. Ball, J.R. DeWaard, Biological identifications through DNA barcodes, Proc. Biol. Sci. 270 (2003) 313–321. [24] J. Amendt, C.S. Richards, C.P. Campobasso, R. Zehner, M.J.R. Hall, Forensic entomology: applications and limitations, Forensic Sci. Med. Pathol. 7 (2011) 379–392. [25] K.A. Meiklejohn, J.F. Wallman, M. Dowton, DNA barcoding identifies all immature life stages of a forensically important flesh fly (Diptera: Sarcophagidae), J. Forensic Sci. 58 (2013) 184–187. [26] R.A. Collins, R.H. Cruickshank, The seven deadly sins of DNA barcoding, Mol. Ecol. Resour. 13 (2013) 969–975. [27] K. Hilgenboecker, P. Hammerstein, P. Schlattmann, A. Telschow, J.H. Werren, How many species are infected with Wolbachia? A statistical analysis of current data, FEMS Microbiol. Lett. 281 (2008) 215–220. [28] T.L. Whitworth, R.D. Dawson, H. Magalon, E. Baudry, DNA barcoding cannot reliably identify species of the blowfly genus Protocalliphora (Diptera: Calliphoridae), Proc. Biol. Soc. 274 (2007) 1731–1739. [29] G.D.D. Hurst, F.M. Jiggins, Problems with mitochondrial DNA as a marker in population, phylogeographic and phylogenetic studies: the effects of inherited symbionts, Proc. Biol. Soc. 272 (2005) 1525–1534. [30] I. Meusnier, G.A.C. Singer, J. Landry, D.A. Hickey, P.D.N. Hebert, M. Hajibabaei, A universal DNA mini-barcode for biodiversity analysis, BMC Genom. 9 (2008) 1–4. [31] P. Boehme, J. Amendt, R.H.L. Disney, R. Zehner, Molecular identification of carrion-breeding scuttle flies (Diptera: Phoridae) using COI barcodes, Int. J. Legal Med. 124 (2010) 577–581. [32] G. Sonet, K. Jordaens, Y. Braet, L. Bourguignon, E. Dupont, T. Backeljau, M. De Meyer, S. Desmyter, Utility of GenBank and the Barcode of Life Data Systems (BOLD) for the identification of forensically important Diptera from Belgium and France, Zookeys 365 (2013) 307–328. [33] B.K. Zajac, N. Sontigun, A. Wannasan, M.A. Verhoff, K. Sukontason, J. Amendt, R. Zehner, Application of DNA barcoding for identifying forensically relevant Diptera from northern Thailand, Parasitol. Res. 115 (2016) 2307–2320. [34] K. Jordaens, G. Sonet, Y. Braet, M. De Meyer, T. Backeljau, F. Goovaerts, L. Bourguignon, S. Desmyter, DNA barcoding and the differentiation between North American and West European Phormia regina (Diptera, Calliphoridae Chrysomyinae), Zookeys 365 (2013) 149–174. [35] Y. Guo, L. Zha, W. Yan, P. Li, J. Cai, L. Wu, Identification of forensically important sarcophagid flies (Diptera: Sarcophagidae) in China based on COI and period gene, Int. J. Legal Med. 128 (2014) 221–228. [36] K. Jordaens, G. Sonet, R. Richet, E. Dupont, Y. Braet, S. Desmyter, Identification of forensically important Sarcophaga species (Diptera: Sarcophagidae) using the mitochondrial COI gene, Int. J. Legal Med. 127 (2013) 491–504. [37] E.A. Rolo, A.R. Oliveira, C.G. Dourado, A. Farinha, M.T. Rebelo, D. Dias, Identification of sarcosaprophagous Diptera species through DNA barcoding in wildlife forensics, Forensic Sci. Int. 228 (2013) 160–164. [38] M. GilArriortua, M.I. Salona Bordas, S. Koehnemann, H. Pfeiffer, M.M. de Pancorbo, Molecular differentiation of Central European blowfly species (Diptera, Calliphoridae) using mitochondrial and nuclear genetic markers, Forensic Sci. Int. 242 (2014) 274–282. [39] Y. Guo, J. Cai, Y. Chang, X. Li, Q. Liu, X. Wang, X. Wang, M. Zhong, J. Wen, J. Wang, Identification of forensically important sarcophagid flies (Diptera: Sarcophagidae) in China, based on COI and 16S rDNA gene sequences, J. Forensic Sci. 56 (2011) 1534–1540. [40] B.K. Zajac, D. Martin-Vega, N. Feddern, H. Fremdt, C.P. e Castro, K. Szpila, F. Reckel, S. Schutt, M.A. Verhoff, J. Amendt, R. Zehner, Molecular identification and phylogenetic analysis of the forensically important family Piophilidae (Diptera) from different European locations, Forensic Sci. Int. 259 (2016) 77–84. [41] A. Farinha, C.G. Dourado, N. Centeio, A.R. Oliveira, D. Dias, M.T. Rebelo, Small bait traps as accurate predictors of dipteran early colonizers in forensic studies, J. Insect Sci. 14 (2014) 1–17.

[42] S.M. Aly, Reliability of long vs short COI markers in identification of forensically important flies, Croat. Med. J. 55 (2014) 19–26. [43] Y.L. Jones, S.M. Peters, C. Weland, N.V. Ivanova, H.F. Yancy, Potential use of DNA barcodes in regulatory science: identification of the U.S. Food and Drug Administration’s Dirty 22 contributors to the spread of foodborne pathogens, J. Food Prot. 76 (2013) 144–149. [44] Y. Velásquez, A. Martínez-Sánchez, S. Rojo, First record of Fannia leucosticta (Meigen) (Diptera: Fanniidae) breeding in human corpses, Forensic Sci. Int. 229 (2013) 13–15. [45] L.S. Faria, M.L. Paseto, F.T. Franco, V.C. Perdigão, G. Capel, J. Mendes, Insects breeding in pig carrion in two environments of a rural area of the state of Minas Gerais, Brazil, Neotrop. Entomol. 42 (2013) 216–222. [46] S. Matuszewski, D. Bajerlein, S. Konwerski, K. Szpila, Insect succession and carrion decomposition in selected forests of Central Europe. Part 3: Succession of carrion fauna, Forensic Sci. Int. 207 (2011) 150–163. [47] C. Hwang, B.D. Turner, Spatial and temporal variability of necrophagous Diptera from urban to rural areas, Med. Vet. Entomol. 19 (2005) 379–391.  ski, To be or not to be a valid genus: the [48] A. Grzywacz, J.F. Wallman, M. Piwczyn systematic position of Ophyra R.-D. (Diptera: Muscidae) revised, Syst. Entomol. (2017), doi:http://dx.doi.org/10.1111/syen.12240 in press. [49] M.V. Bernasconi, C. Valsangiacomo, J.C. Piffaretti, P.I. Ward, Phylogenetic relationships among Muscoidea (Diptera: Calyptratae) based on mitochondrial DNA sequences, Insect Mol. Biol. 9 (2000) 67–74. [50] H.R. Braig, W. Zhou, S.L. Dobson, S.L. O’Neill, Cloning and characterization of a gene encoding the major surface protein of the bacterial endosymbiont Wolbachia pipientis, J. Bacteriol. 180 (1998) 2373–2378. [51] R.C. Edgar, MUSCLE: multiple sequence alignment with high accuracy and high throughput, Nucleic Acids Res. 32 (2004) 1792–1797. [52] M. Gouy, S. Guindon, O. Gascuel, SeaView version 4: a multiplatform graphical user interface for sequence alignment and phylogenetic tree building, Mol. Biol. Evol. 27 (2010) 221–224. [53] R.A. Collins, L.M. Boykin, R.H. Cruickshank, K.F. Armstrong, Barcoding’s next top model: an evaluation of nucleotide substitution models for specimen identification, Methods Ecol. Evol. 3 (2012) 457–465. [54] A. Srivathsan, R. Meier, On the inappropriate use of Kimura-2-parameter (K2P) divergences in the DNA-barcoding literature, Cladistics 28 (2012) 190–194. [55] R. Meier, K. Shiyang, G. Vaidya, P.K.L. Ng, DNA barcoding and taxonomy in Diptera: a tale of high intraspecific variability and low identification success, Syst. Biol. 55 (2006) 715–728. [56] E.A. Robinson, G.A. Blagoev, P.D.N. Hebert, S.J. Adamowicz, Prospects for using DNA barcoding to identify spiders in species-rich genera, Zookeys 16 (2009) 27–46. [57] S. Kumar, G. Stecher, K. Tamura, MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets, Mol. Biol. Evol. 33 (2016) 1870–1874. [58] A. Baz, C. Botías, D. Martín-Vega, B. Cifrián, L.M. Díaz-Aranda, Preliminary data on carrion insects in urban (indoor and outdoor) and periurban environments in central Spain, Forensic Sci. Int. 248 (2015) 41–47. [59] J.G. Chillcott, A revision of the Nearctic species of Fanniinae (Diptera: Muscidae), Can. Entomol. Suppl. (1960) 1–295. [60] S. Charlat, G.D.D. Hurst, H. Merçot, Evolutionary consequences of Wolbachia infections, Trends Genet. 19 (2003) 217–223. [61] O.Y. Martin, A. Gubler, C. Wimmer, C. Germann, M.V. Bernasconi, Infection with Wolbachia and Spiroplasma in the Scathophagidae and other Muscoidea, Infect. Genet. Evol. 12 (2012) 315–323. [62] S. Klopfstein, C. Kropf, H. Baur, Wolbachia endosymbionts distort DNA barcoding in the parasitoid wasp genus Diplazon (Hymenoptera: Ichneumonidae), Zool. J. Linn. Soc. 177 (2016) 541–557. [63] S. Bortolini, C.P. Campobasso, F. Introna, S. Vanin, Molecular identification of 20 years old samples collected from a crime scene, 11th Meet. Eur. Assoc. Forensic Entomol. (2014) 64. [64] H. Kenward, Invertebrates in Archaeology in the North of England, English Heritage, York, 2009. [65] B.M. Wiegmann, M.D. Trautwein, I.S. Winkler, N.B. Barr, J.-W. Kim, C. Lambkin, M.A. Bertone, B.K. Cassel, K.M. Bayless, A.M. Heimberg, B.M. Wheeler, K.J. Peterson, T. Pape, B.J. Sinclair, J.H. Skevington, V. Blagoderov, J. Caravas, S.N. Kutty, U. Schmidt-Ott, G.E. Kampmeier, F.C. Thompson, D.A. Grimaldi, A.T. Beckenbach, G.W. Courtney, M. Friedrich, R. Meier, D.K. Yeates, Episodic radiations in the fly tree of life, Proc. Natl. Acad. Sci. U. S. A. 108 (2011) 5690–5695.  ski, K. Szpila, A. Grzywacz, T. Pape, A large-scale molecular [66] M. Piwczyn phylogeny of flesh flies (Diptera: Sarcophagidae), Syst. Entomol. 39 (2014) 783–799.