DNA barcoding for identification of the endangered ...

DOI 10.1515/hf-2013-0129 Holzforschung 2014; 68(4): 487–494

Lichao Jiao, Yafang Yin*, Yeming Cheng* and Xiaomei Jiang

DNA barcoding for identification of the endangered species Aquilaria sinensis: comparison of data from heated or aged wood samples Abstract: Aquilaria sinensis (Lour.) Gilg is an evergreen tree and produces agarwood used for incense and as a uniquely precious medicine. It is in danger of disappearing due to illegal logging and its identification and protection is crucial. However, it is difficult or impossible to distinguish A. sinensis from other species of the genus Aquilaria Lam. and its closely related genus Gyrinops Gaertn. based on wood anatomical characteristics. Probably, DNA barcoding technology might provide an improvement in species identification. In this study, wood samples were tested, which were submitted to high-temperature drying and were stored for a long period in a xylarium. The factors should be identified that hinder the efficiency of wood DNA extraction from this species. The results indicate that the DNA from the wood tissues could be successfully amplified, apart from some DNA regions from the heartwood of the dried samples and the xylarium samples. The DNA sequences from the wood tissues mostly matched with the sequences of A. sinensis deposited in the GenBank. Moreover, analyses of phylogenetic trees based on trnL-trnF and ITS1 regions indicated that the wood tissues in the tests clustered together with the A. sinensis species from the GenBank, with bootstrap values of 74% and 94%, respectively. Consequently, it is feasible to identify A. sinensis wood on a species level based on the DNA barcoding technology. Keywords: Aquilaria sinensis, DNA barcoding, phylogenetic analyses, wood anatomy, wood identification *Corresponding authors: Yafang Yin, Wood Anatomy and Utilization Department, Research Institute of Wood Industry, Chinese Academy of Forestry, No. 1 Dongxiaofu, Haidian District, Beijing 100091, P.R. China, e-mail: [email protected] and Yeming Cheng, The Geological Museum of China, Xisi, Xicheng District, Beijing 100034, P.R. China, e-mail: [email protected] Lichao Jiao and Xiaomei Jiang: Wood Anatomy and Utilization Department, Research Institute of Wood Industry, Chinese Academy of Forestry, No. 1 Dongxiaofu, Haidian District, Beijing 100091, P.R. China

Introduction Wood identification is essential in the context of timber trade, combating illegal logging, wood certification, and forensic know-how. The traditional wood identification on a species level based on anatomical features alone is not always possible (Höltken et al. 2011). The newly developed DNA barcoding technology might overcome these limitations and might provide effective information with high resolution. DNA barcoding is a genetic approach based on a short DNA sequence from a standard part of a genome. Differences in the nucleotide sequence in specifically targeted DNA regions are utile for species identification. Currently, the chloroplast genome regions, such as rbcL, matK, and psbA-trnH, and the nuclear ribosomal DNA internal transcribed spacer (ITS) have emerged as good candidates for plant DNA barcoding (Kress et al. 2005; Gonzalez et al. 2009). In recent years, the DNA barcoding of global plant species was in focus in the context of maintaining biodiversity. DNA barcodes are in the meanwhile established tools in the field of herbal medicinal materials, quality control, and forensic science (Li et al. 2011). The advantage of target DNA regions is that they differ among the species, but they are very similar among different individual trees within a certain species (Degen and Fladung 2007), that is, the interspecific differences are greater than intraspecific variations. DNA extraction from fresh leaves or buds is a matter of routine in molecular biology. However, DNA extraction from dried wood treated at high temperature, as well as wood stored for a long-term, is more problematic (Schlumbaum et al. 2008; Finkeldey et al. 2010; Jiao et al. 2012) as wood DNA becomes seriously degraded. As a matter of fact, the degeneration of DNA starts after the death of a cell, which results in the splitting of intact DNA into small fragments (Rachmayanti et al. 2009; Finkeldey et al. 2010). DNA extraction from dried and long-term stored wood is not yet fully explored (Dumolin-Lapègue

Bereitgestellt von | De Gruyter / TCS Angemeldet | 46.30.84.116 Heruntergeladen am | 07.05.14 12:45

488 L. Jiao et al.: DNA barcoding of A. sinensis et al. 1999; Deguilloux et al. 2002; Asif and Cannon 2005; Yoshida et al. 2007; Abe et al. 2011). There is a need to optimize DNA extraction protocols from such materials and to develop methods for wood identification. The genus Aquilaria of the Thymelaeaceae family belongs to the perennial evergreen trees. It consists of approximately 15 species distributed mainly in China, Indonesia, India, Malaysia, and other countries in Southeast Asia. Aquilaria sinensis (Lour.) Gilg is considered to be a medicinal plant, and it is a unique precious resource for the production of “agarwood.” It can be widely found in southern China, for example, in the Provinces of Hainan, Guangdong, Fujian, and Yunnan. Agarwood is a mixture of xylem tissue and the resinous secretion of Aquilaria plants. In China, it is the source of valuable natural perfume and medicine. Because of the medicinal and economic value of agarwood, the illegal and excessive logging of Aquilaria is increasing; thus, its natural forest resources are endangered (Eurlings and Gravendeel 2005; Eurlings et al. 2010; Mohamed et al. 2012). A. sinensis is listed in the second-class category of the National List of Local Protected Flora, issued by the Chinese Government in 1999 (The State Council of the People’s Republic of China 1999). Consequently, all species of genera Aquilaria have been listed in Appendix II of the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES) since 2004 (http:// www.cites.org/eng/app/appendices). The protection and identification of A. sinensis is an important issue. There are only incomplete studies on identification of A. sinensis based on DNA barcoding. The available and identified material is usually dried and long-time stored. Thus, the aims of the present study were (1) to evaluate the feasibility of wood identification, based on DNA barcoding and phylogenetic analyses, and (2) to explore the influences of drying and the duration of storage on wood DNA extraction. The wood samples of A. sinensis were taken from fresh wood, postdrying process wood, and wood of xylarium specimens that were stored long time at ambient temperature.

degradation. Lumber is generally dried artificially before use, and this process was imitated. Fresh wood discs, each 10 mm in thickness, were (1) immediately freeze dried at -40°C or dried in an oven (2) for 3 days at 80°C or (3) for 10 days at 120°C. In addition, small pieces from a wood xylarium specimen of A. sinensis [specimen number: Chinese Academy of Forestry (CAF) W16931; origin: Guangdong Province, China; record date of collection in xylarium: 1974] were chosen from the Wood Xylarium Collection from the Chinese Research Institute of Wood Industry in the CAF. Before DNA extraction, the exposed surfaces of the wood samples were removed with a sterile scalpel. Wood samples [10 mm (L) × 10 mm (R) × 20 mm (T) from three different local regions] were taken from sapwood (sW) and hW. Slices with a thickness of approximately 7 μm were prepared from each block by means of a sliding microtome (TU-213, Japan). The materials were then rapidly ground to a fine powder by a mortar and pestle in liquid nitrogen. The powders were kept in a 2 ml microcentrifuge tube at -80°C in a cryogenic freezer until DNA had been extracted.

Materials and methods

Statistical analysis

Plant materials

The one-way analysis of variance (SAS program 9.0) was carried out to evaluate quantitative DNA differences between the samples.

Fresh wood discs and fresh leaves were collected from one standing tree of A. sinensis [tree height 2.3 m, diameter at breast height 74.8 mm, average diameter of heartwood (hW) 57.7 mm, and oven-dry density 0.369 g cm-3] located in Guangzhou City, Guangdong Province, China. The leaves were dried instantly in situ over silica gel to avoid DNA

Light microscopy Samples were excised into small blocks [10 mm (L) × 10 mm (R) × 10 mm (T)] with a razor blade and then softened in water at 80°C for 5 h. Thereafter, transverse, radial, and tangential sections were cut into thicknesses of 15 μm on a sliding microtome and then observed under a light microscope (Olympus BX61, Japan) after being stained with 1% aqueous safranin.

DNA extraction All DNA isolations were carried out under sterile conditions. DNA from wood and leaves were extracted following the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) protocol according to Rachmay anti et al. (2006) with modifications. Before extraction, Buffer AP1 from a Qiagen kit was incubated first at 65°C. For DNA extraction, 1000 μl Buffer AP1, 8 μl RNase A, and 1% (w/v) polyvinylpyrolidone (PVP) were added to the 2 ml microcentrifuge tube, containing approximately 100 mg wood powder, and then were thoroughly mixed together. The mixture was incubated for more than 6–8 h, with occasional swirling of the tube to release as much DNA as possible. After cooling for 2 min, 280 μl Buffer AP2 was added; these were mixed well and incubated for 2 h at -20°C. Subsequent steps were carried out following the kit protocol. The total DNA was subsequently quantified by 1% agarose gel electrophoresis and NanoDrop 8000 Spectrophotometer (Thermo Scientific, Waltham, MA, USA).

Primer design The standard barcodes, that is, chloroplast DNA regions (rbcL and matK) and one nuclear DNA region (ITS1), were chosen for polymerase


L. Jiao et al.: DNA barcoding of A. sinensis 489 chain reaction (PCR) amplification. In addition, the chloroplast trnLtrnF intergenic spacer that evolves rapidly in the Thymelaeaceae family was applied (Van der Bank et al. 2002). Consequently, four pairs of PCR primers were tested, respectively (Table 1).

times. In this study, only the trnL-trnF and ITS1 regions were chosen for phylogenetic analysis, because the sequence information about the rbcL and matK regions for the close species of A. sinensis from the GenBank was not sufficient enough to construct phylogenetic trees. Gyrinops, the close genus of Aquilaria in the Thymelaeaceae family, was chosen as the outgroup.

PCR amplification and sequencing The PCR mixture (50 μl) was the source, which contained of 25 μl TaKaRa Premix Ex Taq (containing 1.25 units Ex Taq DNA polymerase, 2 mM MgCl2, and 200 μM of each dNTP), 0.4 μM of each primer, and approximately 20 ng template DNA. Conditions: Veriti PCR (ABI, Foster City, CA, USA) for the initial denaturing step at 95°C for 5 min, 35 cycles at 95°C for 1 min, at an annealing temperature of 50°C for 50 s and at 72°C for 1 min. This was followed by a final extension step at 72°C for 10 min. The PCR products were detected afterwards on 1% agarose gels. The amplification products of leaves, which were analyzed by the same amplification protocol as the wood samples, served as a positive control. The PCR products were purified by means of the UNIQ-10 Spin Column DNA Gel Extraction Kit (Sangon, Shanghai, China) and sequenced in both directions on ABI PRISM 3730xl. When the amount of amplified products was too small for sequencing or the results of direct sequencing appeared as mixed peaks, TA cloning technology was applied. In this work, rbcL, matK, and ITS1 regions were directly sequenced, while the trnL-trnF region was sequenced after TA cloning. Three repeated reactions of PCR amplification controls and corresponding sequencings were carried out for each sample to prevent experimental errors, such as DNA polymerase errors during amplification, sequencing errors, or artifacts of DNA repair (Dumolin-Lapègue et al. 1999).

Sequence alignment and phylogenetic analyses Initial automated alignments of the sequences were obtained by Clustal X 1.81 followed by a manual adjustment with the BioEdit software. The sequences were phylogenetically analyzed by PAUP 4.0b10 for maximum parsimony (MP). Heuristic searches were conducted under the equal weighting criteria, by the algorithm Tree Bisection Reconnection branch-swapping with MULTREES. The analyses were repeated 1000 times with the random addition option. Gaps found in the alignment were treated as “missing.” The relative robustness of the MP analysis was assessed by bootstrapping the data set 1000

Results and discussion Wood anatomy Expectedly, the wood anatomical characters of fresh A. sinensis wood were totally identical with the wood xylarium specimen in terms of the indistinct growth rings, diffuse porous wood characteristic with island-type pattern (including phloem; Figure 1a and b), radial two to five multiple vessels (or clusters), simple perforation plates, mean tangential diameter of the vessels (85 ± 12 μm), absence of helical thickenings, alternating intervessel pits (Figure 1e and f), similar vessel-ray pits and intervessel pits (Figure 1c and d), the scarcity of parenchyma, and one to two cells wide and mostly uniseriate rays. The uniseriate rays were 10–13 mm in height and consisted from 1 to 18 (mostly 5–10) cells. Procumbent central cells were observed with one to two (mostly one) rows of square or upright marginal cells (Figure 1c and d). It should be mentioned again that the genus Aquilaria and its close genus Gyrinops have very similar anatomical features that are not suited for differentiation (Gasson 2011).

DNA extraction and PCR amplification Large quantities of DNA were extracted from fresh sW and leaves, while the amount of extracted DNA from fresh hW was so small that it could not be observed after electrophoresis in 1% agarose gels (not shown). The average quantities of DNA from fresh sW and hW were 8.01 and

Table 1 Primer pairs of DNA regions applied for the PCR amplification tests on A. sinensis. Primer

Sequence (5′-3′)

Fragment length (bp)

rbcL

CCGAGTAACTCCTCAACC GAAGTAGGGATTCGCAGA AAGCCTTTCGCTGCTGGTT ACGGACCCCTCCTGATTGA GGTTCAAGTCCCTCTATCCC TCTGCTCTACCAGCTGTGCT CGTAACAAGGTTTTCGTAGGTGAAC GCTACGTTCTTCATCGAT

309 470 471 ∼300

matK trnL-trnF ITS1

References This study This study Taberlet et al. 1991; Eurlings and Gravendeel 2005 Niu et al. 2010


490 L. Jiao et al.: DNA barcoding of A. sinensis

Figure 1 Wood anatomical features of A. sinensis. (a, c, and e) Transverse, radial, and tangential sections of the fresh wood, respectively. (b, d, and f) Transverse, radial, and tangential sections of the wood xylarium specimen, respectively. Scale bars, 200 μm (a and b) and 100 μm (c–f). IP, included phloem; R, ray; V, vessel.

4.39 ng mg-1, respectively (Table 2). Tnah et al. (2011) also demonstrated that the efficacy of DNA extraction of the Neobalanocarpus heimii (King) P.S. Ashton sW was greater than that of the hW. The differences in the quantities of DNA extracted from the different radial positions can be explained by the fact that most of the parenchyma cells remain alive in the sW and that their DNA is gradually degraded during the process of cell death in the formation of hW. The chloroplast DNA regions (rbcL, matK, and trnL-trnF; Figure 2a–c) and the nuclear DNA region (ITS1;

Figure 2d) could also be amplified successfully, although the fresh hW yielded a very small quantity of DNA. This confirms that fresh wood is a good source of DNA for wood tissues. However, the DNA retrieved from dried sW or hW could not be observed in 1% agarose gel electrophoresis. Based on UV spectrophotometer measurements, the results indicate that there is a significant difference in the DNA amounts between fresh sW and sW dried at a high temperature. However, concerning the hW, there is no significant quantitative difference of DNA obtained


L. Jiao et al.: DNA barcoding of A. sinensis 491

Table 2 Analysis of variance in the quantity of DNA (ng mg-1 wood) extracted from sW and hW obtained from different sources. Origin

sW hW

Fresh wood

8.01 A (0.80) 4.39 A (0.49)

Dried wood at Xylarium F-probability 80°C, 120°C, 3 days 10 days 4.67 B (0.64) 4.73 A (0.53)

4.44 B (0.66) 4.24 A (0.60)

2.02 C (0.25) 1.52 B (0.29)