DNA barcoding for identification of the endangered ...

DOI 10.1515/hf-2013-0129 Holzforschung 2013; aop

Lichao Jiao, Yafang Yin*, Yeming Cheng* and Xiaomei Jiang

DNA barcoding for identification of the endangered species Aquilaria sinensis: comparison of data from heated or aged wood samples Abstract: Aquilaria sinensis (Lour.) Gilg is an evergreen tree and produces agarwood used for incense and as a uniquely precious medicine. It is in danger of disappearing due to illegal logging and its identification and protection is crucial. However, it is difficult or impossible to distinguish A. sinensis from other species of the genus Aquilaria Lam. and its closely related genus Gyrinops Gaertn. based on wood anatomical characteristics. Probably, DNA barcoding technology might provide an improvement in species identification. In this study, wood samples were tested, which were submitted to high-temperature drying and were stored for a long period in a xylarium. The factors should be identified that hinder the efficiency of wood DNA extraction from this species. The results indicate that the DNA from the wood tissues could be successfully amplified, apart from some DNA regions from the heartwood of the dried samples and the xylarium samples. The DNA sequences from the wood tissues mostly matched with the sequences of A. sinensis deposited in the GenBank. Moreover, analyses of phylogenetic trees based on trnL-trnF and ITS1 regions indicated that the wood tissues in the tests clustered together with the A. sinensis species from the GenBank, with bootstrap values of 74% and 94%, respectively. Consequently, it is feasible to identify A. sinensis wood on a species level based on the DNA barcoding technology. Keywords: Aquilaria sinensis, DNA barcoding, phylogenetic analyses, wood anatomy, wood identification

*Corresponding authors: Yafang Yin, Wood Anatomy and Utilization Department, Research Institute of Wood Industry, Chinese Academy of Forestry, No. 1 Dongxiaofu, Haidian District, Beijing 100091, P.R. China, e-mail: [email protected] and Yeming Cheng, The Geological Museum of China, Xisi, Xicheng District, Beijing 100034, P.R. China, e-mail: [email protected] Lichao Jiao and Xiaomei Jiang: Wood Anatomy and Utilization Department, Research Institute of Wood Industry, Chinese Academy of Forestry, No. 1 Dongxiaofu, Haidian District, Beijing 100091, P.R. China

Introduction Wood identification is essential in the context of timber trade, combating illegal logging, wood certification, and forensic know-how. The traditional wood identification on a species level based on anatomical features alone is not always possible (Höltken et al. 2011). The newly developed DNA barcoding technology might overcome these limitations and might provide effective information with high resolution. DNA barcoding is a genetic approach based on a short DNA sequence from a standard part of a genome. Differences in the nucleotide sequence in specifically targeted DNA regions are utile for species identification. Currently, the chloroplast genome regions, such as rbcL, matK, and psbA-trnH, and the nuclear ribosomal DNA internal transcribed spacer (ITS) have emerged as good candidates for plant DNA barcoding (Kress et al. 2005; Gonzalez et al. 2009). In recent years, the DNA barcoding of global plant species was in focus in the context of maintaining biodiversity. DNA barcodes are in the meanwhile established tools in the field of herbal medicinal materials, quality control, and forensic science (Li et al. 2011). The advantage of target DNA regions is that they differ among the species, but they are very similar among different individual trees within a certain species (Degen and Fladung 2007), that is, the interspecific differences are greater than intraspecific variations. DNA extraction from fresh leaves or buds is a matter of routine in molecular biology. However, DNA extraction from dried wood treated at high temperature, as well as wood stored for a long-term, is more problematic (Schlumbaum et al. 2008; Finkeldey et al. 2010; Jiao et al. 2012) as wood DNA becomes seriously degraded. As a matter of fact, the degeneration of DNA starts after the death of a cell, which results in the splitting of intact DNA into small fragments (Rachmayanti et al. 2009; Finkeldey et al. 2010). DNA extraction from dried and long-term stored wood is not yet fully explored (Dumolin-Lapègue

2 L. Jiao et al.: DNA barcoding of A. sinensis

et al. 1999; Deguilloux et al. 2002; Asif and Cannon 2005; Yoshida et al. 2007; Abe et al. 2011). There is a need to optimize DNA extraction protocols from such materials and to develop methods for wood identification. The genus Aquilaria of the Thymelaeaceae family belongs to the perennial evergreen trees. It consists of approximately 15 species distributed mainly in China, Indonesia, India, Malaysia, and other countries in Southeast Asia. Aquilaria sinensis (Lour.) Gilg is considered to be a medicinal plant, and it is a unique precious resource for the production of “agarwood.” It can be widely found in southern China, for example, in the Provinces of Hainan, Guangdong, Fujian, and Yunnan. Agarwood is a mixture of xylem tissue and the resinous secretion of Aquilaria plants. In China, it is the source of valuable natural perfume and medicine. Because of the medicinal and economic value of agarwood, the illegal and excessive logging of Aquilaria is increasing; thus, its natural forest resources are endangered (Eurlings and Gravendeel 2005; Eurlings et al. 2010; Mohamed et al. 2012). A. sinensis is listed in the second-class category of the National List of Local Protected Flora, issued by the Chinese Government in 1999 (The State Council of the People’s Republic of China 1999). Consequently, all species of genera Aquilaria have been listed in Appendix II of the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES) since 2004 (http:// www.cites.org/eng/app/appendices). The protection and identification of A. sinensis is an important issue. There are only incomplete studies on identification of A. sinensis based on DNA barcoding. The available and identified material is usually dried and long-time stored. Thus, the aims of the present study were (1) to evaluate the feasibility of wood identification, based on DNA barcoding and phylogenetic analyses, and (2) to explore the influences of drying and the duration of storage on wood DNA extraction. The wood samples of A. sinensis were taken from fresh wood, postdrying process wood, and wood of xylarium specimens that were stored long time at ambient temperature.

degradation. Lumber is generally dried artificially before use, and this process was imitated. Fresh wood discs, each 10 mm in thickness, were (1) immediately freeze dried at -40°C or dried in an oven (2) for 3 days at 80°C or (3) for 10 days at 120°C. In addition, small pieces from a wood xylarium specimen of A. sinensis [specimen number: Chinese Academy of Forestry (CAF) W16931; origin: Guangdong Province, China; record date of collection in xylarium: 1974] were chosen from the Wood Xylarium Collection from the Chinese Research Institute of Wood Industry in the CAF. Before DNA extraction, the exposed surfaces of the wood samples were removed with a sterile scalpel. Wood samples [10 mm (L) × 10 mm (R) × 20 mm (T) from three different local regions] were taken from sapwood (sW) and hW. Slices with a thickness of approximately 7 μm were prepared from each block by means of a sliding microtome (TU-213, Japan). The materials were then rapidly ground to a fine powder by a mortar and pestle in liquid nitrogen. The powders were kept in a 2 ml microcentrifuge tube at -80°C in a cryogenic freezer until DNA had been extracted.

Light microscopy Samples were excised into small blocks [10 mm (L) × 10 mm (R) × 10 mm (T)] with a razor blade and then softened in water at 80°C for 5 h. Thereafter, transverse, radial, and tangential sections were cut into thicknesses of 15 μm on a sliding microtome and then observed under a light microscope (Olympus BX61, Japan) after being stained with 1% aqueous safranin.

DNA extraction All DNA isolations were carried out under sterile conditions. DNA from wood and leaves were extracted following the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) protocol according to Rachmayanti et al. (2006) with modifications. Before extraction, Buffer AP1 from a Qiagen kit was incubated first at 65°C. For DNA extraction, 1000 μl Buffer AP1, 8 μl RNase A, and 1% (w/v) polyvinylpyrolidone (PVP) were added to the 2 ml microcentrifuge tube, containing approximately 100 mg wood powder, and then were thoroughly mixed together. The mixture was incubated for more than 6–8 h, with occasional swirling of the tube to release as much DNA as possible. After cooling for 2 min, 280 μl Buffer AP2 was added; these were mixed well and incubated for 2 h at -20°C. Subsequent steps were carried out following the kit protocol. The total DNA was subsequently quantified by 1% agarose gel electrophoresis and NanoDrop 8000 Spectrophotometer (Thermo Scientific, Waltham, MA, USA).

Materials and methods

Statistical analysis

Plant materials

The one-way analysis of variance (SAS program 9.0) was carried out to evaluate quantitative DNA differences between the samples.

Fresh wood discs and fresh leaves were collected from one standing tree of A. sinensis [tree height 2.3 m, diameter at breast height 74.8 mm, average diameter of heartwood (hW) 57.7 mm, and oven-dry density 0.369 g cm-3] located in Guangzhou City, Guangdong Province, China. The leaves were dried instantly in situ over silica gel to avoid DNA

Primer design The standard barcodes, that is, chloroplast DNA regions (rbcL and matK) and one nuclear DNA region (ITS1), were chosen for polymerase

L. Jiao et al.: DNA barcoding of A. sinensis 3

chain reaction (PCR) amplification. In addition, the chloroplast trnLtrnF intergenic spacer that evolves rapidly in the Thymelaeaceae family was applied (Van der Bank et al. 2002). Consequently, four pairs of PCR primers were tested, respectively (Table 1).

times. In this study, only the trnL-trnF and ITS1 regions were chosen for phylogenetic analysis, because the sequence information about the rbcL and matK regions for the close species of A. sinensis from the GenBank was not sufficient enough to construct phylogenetic trees. Gyrinops, the close genus of Aquilaria in the Thymelaeaceae family, was chosen as the outgroup.

PCR amplification and sequencing The PCR mixture (50 μl) was the source, which contained of 25 μl TaKaRa Premix Ex Taq (containing 1.25 units Ex Taq DNA polymerase, 2 mM MgCl2, and 200 μM of each dNTP), 0.4 μM of each primer, and approximately 20 ng template DNA. Conditions: Veriti PCR (ABI, Foster City, CA, USA) for the initial denaturing step at 95°C for 5 min, 35 cycles at 95°C for 1 min, at an annealing temperature of 50°C for 50 s and at 72°C for 1 min. This was followed by a final extension step at 72°C for 10 min. The PCR products were detected afterwards on 1% agarose gels. The amplification products of leaves, which were analyzed by the same amplification protocol as the wood samples, served as a positive control. The PCR products were purified by means of the UNIQ-10 Spin Column DNA Gel Extraction Kit (Sangon, Shanghai, China) and sequenced in both directions on ABI PRISM 3730xl. When the amount of amplified products was too small for sequencing or the results of direct sequencing appeared as mixed peaks, TA cloning technology was applied. In this work, rbcL, matK, and ITS1 regions were directly sequenced, while the trnL-trnF region was sequenced after TA cloning. Three repeated reactions of PCR amplification controls and corresponding sequencings were carried out for each sample to prevent experimental errors, such as DNA polymerase errors during amplification, sequencing errors, or artifacts of DNA repair (Dumolin-Lapègue et al. 1999).

Sequence alignment and phylogenetic analyses Initial automated alignments of the sequences were obtained by Clustal X 1.81 followed by a manual adjustment with the BioEdit software. The sequences were phylogenetically analyzed by PAUP 4.0b10 for maximum parsimony (MP). Heuristic searches were conducted under the equal weighting criteria, by the algorithm Tree Bisection Reconnection branch-swapping with MULTREES. The analyses were repeated 1000 times with the random addition option. Gaps found in the alignment were treated as “missing.” The relative robustness of the MP analysis was assessed by bootstrapping the data set 1000

Results and discussion Wood anatomy Expectedly, the wood anatomical characters of fresh A. sinensis wood were totally identical with the wood xylarium specimen in terms of the indistinct growth rings, diffuse porous wood characteristic with island-type pattern (including phloem; Figure 1a and b), radial two to five multiple vessels (or clusters), simple perforation plates, mean tangential diameter of the vessels (85 ± 12 μm), absence of helical thickenings, alternating intervessel pits (Figure 1e and f), similar vessel-ray pits and intervessel pits (Figure 1c and d), the scarcity of parenchyma, and one to two cells wide and mostly uniseriate rays. The uniseriate rays were 10–13 mm in height and consisted from 1 to 18 (mostly 5–10) cells. Procumbent central cells were observed with one to two (mostly one) rows of square or upright marginal cells (Figure 1c and d). It should be mentioned again that the genus Aquilaria and its close genus Gyrinops have very similar anatomical features that are not suited for differentiation (Gasson 2011).

DNA extraction and PCR amplification Large quantities of DNA were extracted from fresh sW and leaves, while the amount of extracted DNA from fresh hW was so small that it could not be observed after electrophoresis in 1% agarose gels (not shown). The average quantities of DNA from fresh sW and hW were 8.01 and

Table 1 Primer pairs of DNA regions applied for the PCR amplification tests on A. sinensis. Primer

Sequence (5′-3′)

Fragment length (bp)

rbcL

CCGAGTAACTCCTCAACC GAAGTAGGGATTCGCAGA AAGCCTTTCGCTGCTGGTT ACGGACCCCTCCTGATTGA GGTTCAAGTCCCTCTATCCC TCTGCTCTACCAGCTGTGCT CGTAACAAGGTTTTCGTAGGTGAAC GCTACGTTCTTCATCGAT

309 470 471 ∼300

matK trnL-trnF ITS1

References This study This study Taberlet et al. 1991; Eurlings and Gravendeel 2005 Niu et al. 2010


Figure 1 Wood anatomical features of A. sinensis. (a, c, and e) Transverse, radial, and tangential sections of the fresh wood, respectively. (b, d, and f) Transverse, radial, and tangential sections of the wood xylarium specimen, respectively. Scale bars, 200 μm (a and b) and 100 μm (c–f). IP, included phloem; R, ray; V, vessel.

4.39 ng mg-1, respectively (Table 2). Tnah et al. (2011) also demonstrated that the efficacy of DNA extraction of the Neobalanocarpus heimii (King) P.S. Ashton sW was greater than that of the hW. The differences in the quantities of DNA extracted from the different radial positions can be explained by the fact that most of the parenchyma cells remain alive in the sW and that their DNA is gradually degraded during the process of cell death in the formation of hW. The chloroplast DNA regions (rbcL, matK, and trnL-trnF; Figure 2a–c) and the nuclear DNA region (ITS1;

Figure 2d) could also be amplified successfully, although the fresh hW yielded a very small quantity of DNA. This confirms that fresh wood is a good source of DNA for wood tissues. However, the DNA retrieved from dried sW or hW could not be observed in 1% agarose gel electrophoresis. Based on UV spectrophotometer measurements, the results indicate that there is a significant difference in the DNA amounts between fresh sW and sW dried at a high temperature. However, concerning the hW, there is no significant quantitative difference of DNA obtained


Table 2 Analysis of variance in the quantity of DNA (ng mg-1 wood) extracted from sW and hW obtained from different sources. Origin

sW hW

Fresh wood

8.01 A (0.80) 4.39 A (0.49)

Dried wood at Xylarium F-probability 80°C, 120°C, 3 days 10 days 4.67 B (0.64) 4.73 A (0.53)

4.44 B (0.66) 4.24 A (0.60)

2.02 C (0.25) 1.52 B (0.29)

< 0.0001 < 0.0001

Significant differences among the radial positions are denoted by different letters (P < 0.05). The mean values have been calculated from five DNA extractions of each wood sample, respectively. Data in parentheses are SD.

between fresh and high-temperature dried samples (Table 2). Furthermore, DNA region fragments isolated from hW, processed under a drying condition of 120°C for 10 days, could not be amplified (Figure 2a–d). Literature findings confirmed that it is more difficult to amplify DNA from the hW than from sW. Probably, nucleases cleave DNA into fragments during hW formation, following the process of wood cell death (Bamber 1976), which causes a serious decrease in the number of target DNA region fragments. Moreover, large amounts of extractives are in A. sinensis wood, especially in the hW. An example is the essential oil in the hW of Cunninghamia lanceolata (Lamb.) Hook. ( Jiao et al. 2012), which interferes with DNA extraction and inhibits PCR amplification. On the contrary, it is likely that a high temperature will cause wood cells to rupture quickly, concomitantly releasing nucleases and other cellular enzymes, which

typically cause random DNA degradation into small fragments (McCabe et al. 1997; Reape et al. 2008). Furthermore, heating accelerates hydrolytic depurination, which will result in strand breaks (Lindahl and Nyberg 1972; Lindahl 1990; Staats et al. 2011), which is accompanied by the spontaneous cleavage of the phosphodiester backbone via β-elimination. The amplified DNA regions could not even be observed after the drying treatment, especially in the hW. Concerning the 39-year-old wood xylarium specimens, the quantity of extracted DNA was so small that it could not be detected by 1% agarose gel electrophoresis. However, PCR amplification was successful, except for the nuclear DNA fragment (ITS1) from hW (Figure 2d). Obviously, the DNA amplification is more difficult from hW than from sW. Additionally, chloroplast DNA regions were easier to amplify successfully when compared with nuclear DNA. Kress et al. (2005) and Tsumura et al. (2011) also found that chloroplast DNA markers are well suited for the taxonomic identification of plant species. Therefore, this approach is most often chosen for plant classification studies, especially for plant materials with degraded DNA. Moreover, nontarget DNA fragments were amplified from the sW and hW of wood xylarium (Figure 2d), which showed that the contamination came from fungi Lasiodiplodia Ellis & Everh. following a comparative analysis with a BLAST search from the National Center for Biotechnology Information (NCBI). Several authors reported that fungal contamination may interfere with PCR amplification of the nuclear DNA region (ITS) (Rogers and Kaya 2006; China Plant BOL Group et al. 2011). Wood tissues

Figure 2 PCR amplification products generated using chloroplast DNA (a–c) and nuclear DNA (d) regions isolated from the different radial positions in fresh, dried, and xylarium specimen A. sinensis wood. (a) rbcL (arrow); (b) matK (arrow); (c) trnL-trnF (arrow); and (d) ITS1 (arrow), a nontarget DNA region from fungi contamination (arrowhead). (1) Fresh sW; (2) fresh hW; (3) sW dried at 80°C for 3 days; (4) hW dried at 80°C for 3 days; (5) sW dried at 120°C for 10 days; (6) hW dried at 120°C for 10 days; (7) sW of xylarium specimen; (8) hW of xylarium specimen; and (9) leaves.


may be easily contaminated by microbes or fungi. This is especially true for wood stored in a xylarium and this has to be considered during PCR amplification for the nuclear ITS region.

Sequence alignment The rbcL, matK, trnL-trnF, and ITS1 sequences from fresh wood, dried wood, wood xylarium, and leaves of A. sinensis were completely identical if considering all four DNA regions. When the BLAST search in the NCBI nucleotide database was done, the DNA sequences obtained mostly matched the sequences of A. sinensis deposited in the GenBank, showing a 98–100% match with the chloroplast DNA regions and a 99–100% match with the nuclear DNA ITS1 region (Table 3). Nucleotide mutations of trnL-trnF and ITS1 regions among selected wood tissues in the work and sequences of genus Aquilaria and genus Gyrinops deposited in the GenBank are presented in Tables S1 and S2. The forms of gene mutation included substitution (transition and transversion) and indel (insertion and deletion). Tables S3 and S4 demonstrate the number of different nucleotide sites of trnL-trnF and ITS1 regions among wood tissues and sequences of the genus Aquilaria and Gyrinops deposited in GenBank. For the trnL-trnF region (415 bp), 8–14 bp (1.93–3.37%) of nucleotide mutation differences were found in interspecific differences, while 2–7 bp of mutations were detected in intraspecific variations (Table S3). For ITS1 (266 bp), 8–20 bp (3.01–7.52%) of mutations could be found in interspecific differences, but < 3 bp of mutations could be detected in intraspecific variations (Table S4). The results indicate that interspecific differences are greater than intraspecific variations. Consequently, a species identification of wood tissues, based on DNA barcoding technology, was feasible and reliable. Additionally, compared with the chloroplast DNA region (trnL-trnF), nuclear DNA region (ITS) could be much more

preferable for classifying the species of wood identification, which showed a little more variation among the different species. The presented results could be explained by the fact that nuclear DNA has higher rates of base substitution and evolves more rapidly than chloroplast DNA. Tsumura et al. (2011) obtained very similar result, wherein nuclear genes carried most of the important genetic information and had higher mutation rates when compared with chloroplast markers. Likewise, the China Plant BOL Group recommended that the ITS region should be incorporated into the core plant barcode for seed plants, because it shows the highest discriminatory power among the four candidate markers (rbcL, matK, psbA-trnH, and ITS) (China Plant BOL Group et al. 2011).

Table 3 Maximum match among sequences obtained from wood tissues of A. sinensis and sequences of A. sinensis deposited in the GenBank. DNA region rbcL matK trnL-trnF ITS1

Max match 100% 100% 98–99% 99–100%

Accession number GQ436619; GQ436620; HQ415056 HQ415244 EU652672-EU652680; GU736358 FJ980392; EF645833; EF645834; EF645836; GQ891956

Figure 3 A 50% majority-rule consensus tree obtained by the MP method based on the trnL-trnF region (a) and the ITS1 region (b). The branches indicate the percentage of bootstrap values estimated from 1000 bootstrap replicates. A, Aquilaria; G, Gyrinops.


Phylogenetic analyses For the trnL-trnF region, the final alignment had a total length of 415 sites. Of these, 21 (5.1%) were variable characters and 14 (3.4%) were parsimony-informative characters. MP analysis resulted in 537 of the most parsimonious trees [length (L) = 22, consistency index (CI) = 0.955, and retention index (RI) = 0.985]. The strict consensus tree is shown in Figure 3a, with bootstrap supports indicated at the nodes. The topology of the bootstrap 50% majorityrule consensus tree of the MP analysis showed that the sequences of the trnL-trnF region, obtained from fresh wood, dried wood, wood xylarium, and leaves, clustered together with the sequences of the trnL-trnF region of A. sinensis from the GenBank, which was supported by the bootstrap value of 74% (Figure 3a). The total aligned length for the ITS1 region was 266 characters, of which 29 (10.9%) were variable characters and 12 (4.5%) were parsimony informative. Parsimony analysis of the ITS1 region data resulted in two MP trees (L = 33, CI = 0.970, and RI = 0.962). The topology of the bootstrap 50% majority-rule consensus tree of the MP analysis showed that the sequences of the ITS1 region from fresh wood, dried wood, wood xylarium, and leaves clustered together in a polytomy with the sequences of the ITS1 region of A. sinensis deposited in the GenBank, while the support for the branches was 94% (Figure 3b). It was reported that bootstrap proportions of > 70% usually correspond to a probability of > 95% that the corresponding clade is real under conditions of equal rates of change, symmetric phylogenies, and internodal change of < 20% of the characters (Hillis and Bull 1993). In this study, the bootstrap support values of 74% and 94% are indicative for a reliable clustering analysis.

Conclusion DNA can be extracted by means of a modified Qiagen kit protocol from “problem” wood materials, that is, dried wood and a xylarium specimen stored for 39 years, and that PCR amplifications can also be successfully achieved. However, DNA regions from the hW that were dried at 120°C for 10 days or the hW of xylarium wood could not be amplified. Furthermore, with the aid of genetic loci differences

and phylogenetic analysis, it is possible to differentiate A. sinensis from other species of the Aquilaria genus, which are closely related to genus Gyrinops. These results provide the potential for further applications in combating illegal logging. However, more research is needed for improvement of DNA extraction from wood, especially from hW that has been dried and stored for a long period. DNA barcoding technology is an effective, feasible, and promising tool for wood identification, timber trade control, identification of wood provenance, and forensic work.

Supporting information –

–

–

–

Table S1 Nucleotide mutations in the trnL-trnF region among wood tissues of A. sinensis in the study and GenBank sequences of the genus Aquilaria and Gyrinops. Table S2 Nucleotide mutations in the ITS1 region among wood tissues of A. sinensis in the study and GenBank sequences of the genus Aquilaria and Gyrinops. Table S3 The number of nucleotide mutations in the trnL-trnF region among wood tissues of A. sinensis in the study and GenBank sequences of the genus Aquilaria and Gyrinops. Table S4 The number of nucleotide mutations in the ITS1 region among wood tissues of A. sinensis in the study and GenBank sequences of the genus Aquilaria and Gyrinops.

Acknowledgments: This work was supported financially by a project of the Chinese State Forestry Administration (No. 201304508). We would like to express our gratitude for the help on collecting samples provided by Dr. Liangchen Yuan at the Chinese CITES Management Authority, the State Forestry Administration, and for the assistance with sample preparation done by Mrs. Mingkun Xu and Dr. Xingxia Ma at the Research Institute of Wood Industry, the Chinese Academy of Forestry. We also acknowledge the assistance of language editing by Kevin Austin of BizTech English AB (http://www.biztech.se).

Received July 11, 2013; accepted October 14, 2013; previously published online xx

References Abe, H., Watanabe, U., Yoshida, K., Kuroda, K., Zhang, C. (2011) Changes in organelle and DNA quality, quantity,

and distribution in the wood of Cryptomeria japonica over long-term storage. IAWA J. 32:263–272.

8 L. Jiao et al.: DNA barcoding of A. sinensis Asif, M.J., Cannon, C.H. (2005) DNA extraction from processed wood: a case study for the identification of an endangered timber species (Gonostylus bancanus). Plant Mol. Biol. Rep. 23:185–192. Bamber, R.K. (1976) Heartwood, its function and formation. Wood Sci. Technol. 10:1–8. China Plant BOL Group, Li, D., Gao, L., Li, H., Wang, H., Ge, X., Liu, J., Chen, Z., Zhou, S., Chen, S., Yang, J., Fu, C., Zeng, C., Yan, H., Zhu, Y., Sun, Y., Chen, S., Zhao, L., Wang, K., Yang, T., Duan, G. (2011) Comparative analysis of a large dataset indicates that internal transcribed spacer (ITS) should be incorporated into the core barcode for seed plants. Proc. Natl. Acad. Sci. 108:19641–19646. Degen, B., Fladung, M. (2007) Use of DNA-markers for tracing illegal logging. In: Proceedings of the International Workshop “Fingerprinting Methods for the Identification of Timber Origins,” Bonn, Germany. pp. 6–14. Deguilloux, M.F., Pemonge, M.H., Petit, R.J. (2002) Novel perspectives in wood certification and forensics: dry wood as a source of DNA. Proc. R. Soc. Lond. B269: 1039–1046. Dumolin-Lapègue, S., Pemonge, M.H., Gielly, L., Taberlet, P., Petit, R.J. (1999) Amplification of oak DNA from ancient and modern wood. Mol. Ecol. 8:2137–2140. Eurlings, M.C.M., Gravendeel, B. (2005) TrnL-trnF sequence data imply paraphyly of Aquilaria and Gyrinops (Thymelaeaceae) and provide new perspectives for agarwood identification. Pl. Syst. Evol. 254:1–12. Eurlings, M., Heuveling van Beek, H., Gravendeel, B. (2010) Polymorphic microsatellites for forensic identification of agarwood (Aquilaria crassna). Forensic Sci. Int. 197:30–34. Finkeldey, R., Leinemann, L., Gailing, O. (2010) Molecular genetic tools to infer the origin of forest plants and wood. Appl. Microbiol. Biotechnol. 85:1251–1258. Gasson, P. (2011) How precise can wood identification be? Wood anatomy’s role in support of the legal timber trade, especially CITES. IAWA J. 32:137–154. Gonzalez, M.A.. Baraloto, C., Engel, J., Mori, S.A., Pétronelli, P., Riéra, B., Roger, A., Thébaud, C., Chave, J. (2009) Identification of Amazonian trees with DNA barcodes. PLoS One 4:e7483. Hillis, D.M., Bull, J.J. (1993) An empirical test of bootstrapping as a method for assessing confidence in phylogenetic analysis. Syst. Biol. 42:182–192. Höltken, A.M., Schröder, H., Wischnewski, N., Degen, B., Magel, E., Fladung, M. (2011) Development of DNA-based methods to identify CITES-protected timber species: a case study in the Meliaceae family. Holzforschung 66:97–104. Jiao, L., Yin, Y., Xiao, F., Sun, Q., Song, K., Jiang, X. (2012) Comparative analysis of two DNA extraction protocols from fresh and dried wood of Cunninghamia lanceolata (Taxodiaceae). IAWA J. 33:441–456. Kress, W.J., Wurdack, K.J., Zimmer, E.A., Weigt, L.A., Janzen, D.H. (2005) Use of DNA barcodes to identify flowering plants. Proc. Natl. Acad. Sci. USA 102:8369–8374. Li, M., Cao, H., But, P.P.H., Shaw, P.C. (2011) Identification of herbal medicinal materials using DNA barcodes. J. Syst. Evol. 49:271–283.

Lindahl, T. (1990) Repair of intrinsic DNA lesions. Mutat. Res. 238:305–311. Lindahl, T., Nyberg, B. (1972) Rate of depurination of native deoxyribonucleic acid. Biochemistry 11:3610–3618. McCabe, P.F., Levine, A., Meijer, P.J., Tapon, N.A., Pennell, R.I. (1997) A programmed cell death pathway activated in carrot cells cultured at low cell density. Plant J. 12:267–280. Mohamed, R., Tan, H.Y., Siah, C.H. (2012) A real-time PCR method for the detection of trnL-trnF sequence in agarwood and products from Aquilaria (Thymelaeaceae). Conserv. Genet. Resour. 4:803–806. Niu, X., Ji, K., Lu, G. (2010) Preliminary studies on identification of Aquilaria sinensis (L.) Gilg by the PCR product of rDNA ITS sequencing (in Chinese). Guangdong Agric. Sci. 37: 167–169. Rachmayanti, Y., Leinemann, L., Gailing, O., Finkeldey, R. (2006) Extraction, amplification and characterization of wood DNA from Dipterocarpaceae. Plant Mol. Biol. Rep. 24:45–55. Rachmayanti, Y., Leinemann, L., Gailing, O., Finkeldey, R. (2009) DNA from processed and unprocessed wood: factors influencing the isolation success. Forensic Sci. Int. Genet. 3:185–192. Reape, T.J., Molony, E.M., McCabe, P.F. (2008) Programmed cell death in plants: distinguishing between different modes. J. Exp. Bot. 59:435–444. Rogers, S.O., Kaya, Z. (2006) DNA from ancient cedar wood from King Midas’ tomb, Turkey, and Al-Aksa Mosque, Israel. Silvae Genet. 55:54–62. Schlumbaum, A., Tensen, M., Jaenicke-Despres, V. (2008) Ancient plant DNA in archaeobotany. Veget. Hist. Archaeobot. 17:23–244. Staats, M., Cuenca, A., Richardson, J.E., Vrielink-van Ginkel, R., Petersen, G., Seberg, O., Bakker, F.T. (2011) DNA damage in plant herbarium tissue. PLoS One 6:e28448. Taberlet, P., Gielly, L., Patou, G., Bouvet, J. (1991) Universal primers for amplification of three noncoding regions of chloroplast DNA. Plant Mol. Biol. 17:1105–1109. The State Council of the People’s Republic of China (1999) The first part directory of national protected flora on emphasis. Tnah, L.H., Lee, S.L., Ng, K.K.S., Bhassu, S., Othman, R.Y. (2011) DNA extraction from dry wood of Neobalanocarpus heimii (Dipterocarpaceae) for forensic DNA profiling and timber tracking. Wood Sci. Technol. 46:813–825. Tsumura, Y., Kado, T., Yoshida, K., Abe, H., Ohtani, M., Taguchi, Y., Fukue, Y., Tani, N., Ueno, S., Yoshimura, K., Kamiya, K., Harada, K., Takeuchi, Y., Diway, B., Finkeldey, R., Na’iem, M., Indrioko, S., Ng, K.K.S., Muhammad, N., Lee, S.L. (2011) Molecular database for classifying Shorea species (Dipterocarpaceae) and techniques for checking the legitimacy of timber and wood products. J. Plant. Res. 124:35–48. Van der Bank, M., Fay, M.F., Chase, M.W. (2002) Molecular phylogenetics of Thymelaeaceae with particular reference to African and Australian genera. Taxon 51:329–339. Yoshida, K., Kagawa, A., Nishiguchi, M. (2007) Extraction and detection of DNA from wood for species identification. In: Proceedings of the International Symposium on Development of Improved Methods to Identify Shorea Species Wood and Its Origin. Forestry and Forest Products Research Institute, Ibaraki, Japan. pp. 27–34.