ISSN 00268933, Molecular Biology, 2010, Vol. 44, No. 2, pp. 245–253. © Pleiades Publishing, Inc., 2010. Original Russian Text © O.V. Masalova, E.I. Lesnova, V.V. Grabovetskii, O.A. Smirnova, T.I. Ulanova, A.N. Burkov, A.V. Ivanov, A.D. Zaberezhnyi, R.I. Ataullakhanov, A.A. Kushch, 2010, published in Molekulyarnaya Biologiya, 2010, Vol. 44, No. 2, pp. 275–283.
CELL MOLECULAR BIOLOGY UDC 577.2;578.2
DNA Immunization with a Plasmid Carrying the Gene of Hepatitis C Virus Protein 5A (NS5A) Induces an Effective Cellular Immune Response O. V. Masalovaa, E. I. Lesnovaa, V. V. Grabovetskiia, O. A. Smirnovab, T. I. Ulanovac, A. N. Burkovc, A. V. Ivanovb, A. D. Zaberezhnyia, R. I. Ataullakhanovd,e, and A. A. Kushcha a
Ivanovsky Institute of Virology, Russian Academy of Medical Sciences, Moscow, 123098 Russia; email:
[email protected] b Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, Moscow, 119991 Russia c NPO Diagnostic systems Ltd, Nizhniy Novgorod, 603093 Russia d OOO Immapharma, Moscow, 123098 Russia e Institute of Immunology, Russian Federal MedicoBiological Agency, Moscow, 115478 Russia Received May 20, 2009 Accepted for publication July 21, 2009
Abstract—In spite of extensive research, no effective vaccine against hepatitis C virus (HCV) has been devel oped so far. DNA immunization is a potent technique of vaccine design strongly promoting the cellular arm of immune response. The genes encoding nonstructural HCV proteins (NS2–NS5B) are promising candi dates for vaccine development. NS5A is a protein involved in viral pathogenesis, in the induction of immune response, and probably in viral resistance to interferon treatment. The objective of this study was to construct a DNA vaccine encoding NS5A protein and evaluate its immunogenicity. A plasmid encoding a fullsize NS5A protein was produced using the pcDNA3.1 (+) vector for eukaryotic expression system. The expression of the NS5A gene was confirmed by immunoperoxidase staining of the transfected eukaryotic cells with anti NS5A monoclonal antibodies. Triple immunization of mice with the plasmid vaccine induced a pronounced cellular immune response against a broad spectrum of NS5A epitopes as assessed by Tcell proliferation and secretion of antiviral cytokines IFNγ and IL2. In Tcell stimulation in vitro experiments, NS5Aderived antigens were modeled by synthetic peptides, recombinant proteins of various genotypes, and phages carrying exposed NS5A peptides. A novel immunomodulator Immunomax showed high adjuvant activity in DNA immunization. The data obtained indicate that the suggested DNA construct has a strong potential in the development of the gene vaccines against hepatitis C. DOI: 10.1134/S0026893310020093 Key words: hepatitis C virus, nonstructural protein NS5A, transfection, DNA immunization, immune response
INTRODUCTION The techniques of DNA vaccination, in particular, against some viral infections, such as tickborne encephalitis virus, HIV, and hepatitis C virus (HCV), have lately become a subject of extensive research. In contrast to traditional vaccines based on attenuated live viruses and recombinant proteins and aimed at antibody production, DNAvaccines are able to acti vate primarily cellular immunity. Vaccination material contains bacterial plasmids carrying viral genes that are expressed and translated in the target cells. Pro teolytic degradation of these proteins produces pep tides, which, as a part of MHC class I complexes, acti Abbreviations: HCV—virus of hepatite C; CHC—chronic hepatite C; NS—non structural protein; GFP—green fluorescent protein; CTL— cytolytic TLymphocytes; ThT—helper lymphocytes; MHC—main component of histocompatibility; HLAantigenes— antigenes of human MHC; MCA—monoclonal antibodies; IPS— index of proliferation stimulation; OD—optical density.
vate antiviral cytotoxic T lymphocytes (CTL) and induce immune reactions. In comparison to conven tional vaccination techniques, DNA immunization has certain advantages. DNA vaccines are safe, stable and easily reproducible. They make it possible to avoid the problems associated with introducing xenogenous protein, and considerably reduce the risk of adverse side effects related to the toxicity of ballast proteins or the virulence of the viruses used [1, 2]. The efforts to produce an efficient vaccine against hepatitis C have so far been unsuccessful. According to WHO estimates, hepatitis C is one of the three most significant and socially important human infectious diseases; it is a leading cause of chronic liver disease. Worldwide, approximately 170 million people are infected with HCV, and approximately 3 to 4 million are infected annually. The frequency of HCV infection taking a chronic course is as high as 85%. Its morbidity varies considerably from asymptomatic carriage to
245
246
MASALOVA et al.
Table 1. Primers used in plasmid construction No.
Primer
1
NS5AF
2
NS5AR
3
GFP1
4
GFP2
5
NS5A(GFP)F
Sequence AATAAAAGCTTCCACCATGGGCTCGTGGCTAAGAGATGTTTG HindIII TTGTTTCTAGATTAGCAGCAGACGACGTCCTCACCA XbaI AATAAAAGCTTGCCACCATGGTGAGCAAGGGCGAGGAGCTGT HindIII AATAAGGTACCTCCGGACTTGTACAGCTCGTCCATGCCGAGA KpnI AATAAGGTACCTCCGGCTCGTGGCTAAGAGATGT KpnI
severe forms of liver damage progressing to cirrhosis and primary liver cancer. The available treatment is effective in no more than 40% of patients with chronic hepatitis C and usually has serious adverse side effects [3]. Several candidate DNA vaccines containing the genes of HCV nucleocapsid and E1, E2, and NS3 pro teins are currently being tested on laboratory animals [4], and the first genetic vaccine CHRONVACC® based on the NS3/4Aencoding regions has entered stage I/IIa clinical trials [5]. Nonstructural proteins of the HCV replication complex (NS2–NS5B) are of critical importance for the HCVinduced cellular immune response. For instance, NS3, NS4, and NS5reactive CD4+ (helper) and CD8+ (cytotoxic) T lymphocytes were found in patients who spontaneously recovered from acute hep atitis C but not in patients with chronic hepatitis C [6– 10]. In addition, in contrast to extremely variable sur face proteins, nonstructural proteins contain highly conserved regions harboring a number of Tcell epitopes [11]. Therefore, genes encoding nonstruc tural proteins seem most prospective candidates for DNA vaccine development. The objective of this study was to produce a DNA construct expressing NS5A in eukaryotic cells and to investigate its immunogenicity. The nonstructural phosphoprotein NS5A is essentially involved in viral pathogenesis and in the induction of immune response, and performs some important functions in the virus life cycle [12–14]. This putative transcrip tional activator participates in various cellular regula tory processes. In addition to direct participation in viral replication, NS5A plays a key role at the early stages of the virus assembly [15, 16]. Supposedly, NS5A is also involved in modulating response to IFN treatment. For instance, HCV resistance to IFN cor relates with the number of NS5A mutations [14].
EXPERIMENTAL Plasmids. The eukaryotic vector used was pcDNA3.1(+) (Invitrogen, United States), where the transcription of the target gene is controlled by the CMV promoter. Selection of transfected clones is enabled by the neomycin resistance gene included in the plasmid. The gene encoding NS5A from HCV genotype 1b (strain NC1, Acc No. AJ238800) [17] was isolated by PCR. Plasmid pTM3420–9396 carrying the fragment of the HCV genome encoding the proteins NS3, NS4A, NS4B, NS5A, and NS5B (nucleotides 3420– 9369) was used as the template; the plasmid was cour teously provided by Dr. R. Bartenschlager (Heidel berg, Germany). The PCR product representing the NS5A gene was obtained with primers 1 and 2 (Table 1). After the pcDNA3.1(+) plasmid and the PCR product were purified from an agarose gel, they were digested with HindIII and XbaI restriction endo nucleases and ligated to obtain the plasmid pcDNA NS5A carrying the fullsize NS5A gene (nucleotides 5917–7256 of the common reading frame of HCV genotype 1b corresponding to amino acid residues 1973–2419 of the polyprotein). In addition to pcDNANS5A, using the same pcDNA3.1(+) vector, we constructed a plasmid expressing a chimerical protein, green fluorescent protein (GFP) fused with NS5A, which could be detected using fluorescence microscopy. The GFP gene was obtained by PCR with primers 3 and 4 using the plasmid pEGFPC2 (Clontech, United States) as a template (Table 1). After the pcDNA3.1(+) plasmid and the PCR product were purified from an agarose gel, they were digested with HindIII and KpnI restric tion endonucleases and ligated to obtain the plasmid pcDNAGFP. The NS5A gene carrying a KpnI recog nition site at the 5' end (NS5AKpnI) was produced by PCR amplification with primers 5 and 2 (Table 1). The plasmid pcDNAGFP and the purified NS5AKpnI PCR product were digested with endonucleases KpnI MOLECULAR BIOLOGY
Vol. 44
No. 2
2010
IMMUNOGENICITY OF A PLASMID ENCODING HCV PROTEIN NS5A
and XbaI and ligated together. The resulting plasmid pcDNAGFPNS5A carried a fullsize NS5A gene. The plasmids were additionally controlled by restriction analysis. The clones selected were sequenced using an Applied Biosystems 3130 Genetic Analyzer (United States) according to the manufac turers' instructions. The plasmid DNA was isolated from cultured E. coli cells (strain Top10) using a Wizard PureFection Plasmid DNA Purification System kit (Promega, United States). DNA concentration was measured using an Eppendorf spectrophotometer (Germany) at 260/280 nm. Eukaryotic cell transfection. The ability of the obtained constructs to express HCV proteins in mam malian cells was tested using African green monkey kidney (Vero) and human hepatocarcinoma (Huh7) cell lines. Vero cells were grown in Eagle’s medium (PANEKO, Russia) supplemented with 10% fetal calf serum (FCS, Hyclone, United States), 2 mM glutamine, and 50 μg/ml gentamicin; Huh7 cells were grown in DMEM (PANEKO, Russia) supple mented with 10% FCS and 2 mM glutamine. Cultures were grown in 5% CO2. A day before transfection, 5 × 104 cells were transferred to 24well cell culture plates (TPP, Switzerland, or Nunc, Denmark). Vero cells were transfected using Unifectin 56 (Unifect, Russia), and Huh7 cells, using lipo fectamine2000 (Invitrogen, United States) as sug gested by the manufacturers. Twenty four hours post transfection, cells were transferred into the wells of 24 well plates with cover slips in a 1 : 3 dilution and grown to subconfluent monolayer. Transformants were selected by supplementing the cultural medium with 800 μg/ml geneticin sulfate (G418) on the third day; the medium was exchanged every two days. To analyze GFP expression in the cells transfected with pcDNAGFPNS5A and pcDNAGFP, cover slips from the wells were washed with cold 0.1 M phos phate buffered saline, pH 7.4 (PBS), and cells were fixed with 3.7% paraformaldehyde solution in PBS for 15 min at –20°С. Then the slips were thrice washed with cold PBS, and the fluorescent cells were quanti fied using fluorescence microscopy at 520–560 nm. Cells transfected with pcDNANS5A and pcDNA3.1 were analyzed using indirect immunoper oxidase staining with antiNS5A monoclonal anti bodies (MAB) 2C9, 1C5, and 3F4, which were obtained and described previously [18]. Cells were fixed with cold methanol at –20°С, and endogenous peroxidase was blocked with 3% hydrogen peroxide for 20 min. Staining with MAB mixture was performed as described previously in [18]. Diaminobenzidine used as peroxidase substrate (Sigma, United States) produced brown staining. Nuclear staining was per formed with Karachi hematoxylin. The results of immunocytochemical staining were evaluated using MOLECULAR BIOLOGY
Vol. 44
No. 2
2010
247
light microscopy with an Opton microscope (Ger many). Animal immunization. Immunization experiments were performed on female DBA/2J (H2d) mice aged 6–8 weeks. Animals were obtained from the Kryukovo Laboratory Animal Breeding Center, Russian Aca demy of Medical Sciences. Mice were inoculated intra muscularly into the hind leg quadriceps with 100 μg per mouse of purified pcDNA–NS5A or pcDNA3.1 (neg ative control) plasmid DNA either in physiological saline with no adjuvant, or in combination with an immunomodulator Immunomax® (20 units = 6 μg). Different immunization schemes are described in Results. Recombinant proteins, synthetic peptides and phages that were used as antigens to stimulate Tcell response in vitro are listed in Table 2. Peptides were obtained by solid phase synthesis using the FMOC/BOC technique (But strategy) and purified by HPLC to the purity of 95–99%. The accuracy of amino acid sequences was verified by mass spectrom etry using a Bruker Daltonics Reflex III MALDITOF mass spectrometer (Bruker, Germany). The recombinant protein rNS5A (amino acids 2061–2302) was obtained using blood serum of hepa titis patients with high HCV RNA levels. Sequences encoding recombinant NS5A proteins of amino acids 2212–2313 of HCV genotypes 1b, 3b, and 4a (Gen Bank Acc. Nos. E07579, D17763, and Y11604, respectively) [17] were synthesized using oligonucle otide. The resulting gene fragments were amplified with primers carrying BamHI and EcoRI recognition sites and ligated into the pGEX4T vector inframe with the glutathioneStransferase gene. Genes encoding chimerical proteins were expressed in E. coli cells (strain JM109), and the proteins were purified by affinity chromatography on glutamatesepharose 4B (Pharmacia Biotech, Great Britain). Three phage clones exposing peptides that mimic the HCV NS5A antigen determinants (mimotopes) were selected from phage libraries using affinity selec tion with MAB to NS5A; they were sequenced and mapped previously [19]. AntiNS5A antibody activity in mouse serum was assayed by indirect solidphase ELISA in Nunc microplates (Denmark) with well sensibilization with 1 μg/ml of rNS5 2061_1b (Table 2). ELISA was per formed according to the standard protocol, with tet ramethylbenzidine as a substrate (Sigma, United States). Optical density was measured at 450 nm; refe rence wavelength was 620 nm. The serum titer was determined as the dilution with А450 twice as high as А450 of the negative control serum (serum of nonim munized mice in the same dilution). Antigenspecific Tcell reactions in vitro were assessed by activation of the DNA synthesis and by secretion of Tcell cytokines IFNγ, IL2, and TNFα. Spleen cells obtained from five animals in each test
248
MASALOVA et al.
Table 2. HCVspecific antigen fragments of NS5A used to induce cellular immune response in vitro Antigen Synthetic peptides
Recombinant proteins
Phages expressing NS5A mimotopes
Name p1987 p2140 p2151 p2163 p2225 p2252 p2269 p2295 rNS5 2061_1b rNS5 2212_1b rNS5 2212_3b rNS5 2212_4a ph 2d1 ph 1e5 ph 2e10
NS5A region (amino acids) 1987–1995 2140–2149 2151–2160 2163–2171 2225–2233 2252–2260 2269–2277 2295–2313 2061–2302 2212–2313 2212–2313 2212–2313 2264–2270 2223–2231 conformational, part of the 2223–2230 epitope
group were pooled, and cell suspensions were centri fuged in a onestep HistoPaque1077 density gradient (Sigma, United States) to isolate the mononuclear cells, which were washed twice with RPMI1640 and transferred to 96well cell culture plates (105 cells per well). Cells were grown in RPMI1640 supplemented with 20% FCS, 2 mM glutamine, 4.5 g/l glucose, 50 μg/ml gentamicin, and 0.2 units/ml insulin at 37°С in the 5% СО2 atmosphere. Cells were incubated with each of the antigens containing HCV NS5A sequences (Table 2). Synthetic peptides and phages were added to the final concentration of 5 μg/ml, and recombinant proteins were added to the final concentration of 0.5 μg/ml. Negative controls were, on the one hand, splenocytes of nonimmunized mice stimulated with the same antigens, on the other hand, nonstimulated splenocytes of immunized mice, as well as splenocytes stimulated with antigens from other regions of the HCV genome: the peptide of amino acids 108–127 (a fragment of the HCV nucleocapsid protein), the recombinant rNS4 protein, and phages carrying no peptide insert. Concanavalin Aactivated splenocyte cultures were used as a positive control (conA, 12.5 μg/ml). After 3.5 to 4 days, supernatant samples were collected to determine the cytokine concentra tions. Splenocyte proliferation was assessed by blast transformation test after 4–4.5 days. The results were presented as Stimulation Index (SI) calculated as the ratio of the average blast numbers observed in the pres ence and in the absence of stimulators. A positive result was registered at SI > 2. Cytokine concentrations in the supernatant of stimulated lymphocyte cultures were measured using commercial ELISA test systems for IFNγ, IL2 (Mabtech, Sweden), and TNFα (BioLegend, United
HCV genotype [17]
Epitope type [11]
1a, 1b 1a, 1b 1b 1a, 1b 1a, 1b 1b 1a, 1b 1b 1b 1b 3b 4a 1a, 1b 1a, 1b 1b
CTL CTL CTL CTL CTL CTL CTL B Th, CTL, B Th, CTL, B Th, CTL, B Th, CTL, B B, part of CTL [11, 19] B, CTL, part of Th [11, 19] B [19]
States) as suggested by the manufacturers. Cytokine concentrations were determined using standard sam ple calibration curves. The sensitivity threshold was 2 pg/ml for IFNγ, 4 pg/ml for IL2, and 2 pg/ml for TNFα. RESULTS Plasmid Characterization Restriction analysis of pcDNANS5A and pcDNAGFPNS5A showed that the fragments pro duced by digestion with HindIII/XbaI, HindIII/KpnI, and HindIII/KpnI/XbaI had the same size as the genes encoding NS5A (1344 bp) and GFP (717 bp). Plasmid sequencing confirmed that the cloned genes did not contain mutations and lay in the same reading frame. Eukaryotic Cell Transfection When Vero cells were treated with pcDNAGFP NS5A, transfected cells were detectable on the third day after introducing the plasmid. The highest num bers of brightly fluorescent cells (up to 1000 cells per specimen, transfection efficiency approximately 2%) were observed on days 5–7. In Huh7 cell cultures, transfected clones were detectable as soon as in 24 h; in 48 h, their quantity reached 50% (Fig. 1a, 1b) and, in 72 h, fluorescence intensity considerably decreased. Cells transfected with pcDNANS5A were regis tered by indirect immunoperoxidase staining with MAB to NS5A. NS5Aspecific staining was observed in the cytoplasm, with the perinuclear area stained more intensively (Fig. 1c). Cells transfected with pcDNA 3.1 vector showed no staining with MAB to MOLECULAR BIOLOGY
Vol. 44
No. 2
2010
IMMUNOGENICITY OF A PLASMID ENCODING HCV PROTEIN NS5A
(a)
(b)
(c)
(d)
249
Fig. 1. Visualization of GFP and HCV NS5A in transfected mammalian cells. (a) and (b) are Fluorescence of Huh7 cells 48 h post transfection with (a) pcDNAGFPNS5A and (b) pcDNAGFP, × 40. (c) and (d) are Immunoperoxidase staining of Vero cells with MAB to NS5A, 96 h post transfection with (c) pcDNANS5A and (d) pcDNA 3.1. Hematoxylin staining of nuclei, × 400. (c) is diffuse cytoplasmic distribution of NS5A; some of the stained cells are indicated with arrows and (d) is no specific staining visible.
NS5A (Fig. 1d). Transfected cells were not morpho logically different from control ones. Immunogenicity of the DNA Vaccine Immunogenicity of the DNA vaccine was assessed by evaluating the humoral and cellular immune response in mice inoculated with the recombinant DNA construct. Humoral immune response to DNA vaccination. Mice were inoculated with pcDNANS5A DNA Immunomax mixture thrice with a month’s interval. The immune response was evaluated at nine points of time: weekly after the first and the second immunizations and a week after the third immuniza tion. In 1–3 weeks after the first and the second immunization, antiNS5A antibodies could not be detected. The highest response was observed 4 weeks after the second immunization and 1 week after the third immunization. However, even at these points of time, the humoral response was not very pronounced with the antibody titer of 1 : 112. In control mice immunized with the pcDNA3.1 vector, the titer of antiNS5A antibodies was the same as in nonimmu nized animals (1 : 10). MOLECULAR BIOLOGY
Vol. 44
No. 2
2010
Cellular immune response to DNA vaccination. First, the adjuvant activity of Immunomax in DNA immunization was tested. After inoculating mice with pcDNANS5A alone or in combination with Immu nomax, we evaluated cellular immune response by in vitro lymphocyte proliferation in response to NS5A specific antigens (Table 2). When animals were immunized with plasmid DNA only, in 1 week, cellular immune response was observed to three of five antigens used (Fig. 2). The use of Immunomax increased the lymphoblast levels induced by different antigens from 1.7 to 3.4fold. On average, SI increased 2.2fold, and the response was positive (SI > 2) for all antigens studied. These results demonstrated Immunomax efficiency; therefore, it was used in all further experiments assessing Tcell immune response. In vitro lymphocyte proliferation test showed that cellular immune response gradually increased with each subsequent immunization. Average SI peaked 1 week after the third immunization. The highest SI values (16–20) were observed after stimulation with phages carrying NS5A epitopes 2264–2270 and 2223–2300 (Table 3). Stimulation with synthetic pep tides mimicking the Tcell (CTL) NS5A epitopes (amino acids 2140–2149, 2151–2160, 2163–2171,
250
MASALOVA et al.
DISCUSSION
12 10
SI
8 6 4 2 0 rNS5 ph 1e5 ph 2e10 p2163 rNS5 2061_1b 2212_3b antigens DNA with no adjuvant DNA with Immunomax Fig. 2. Adjuvant activity of Immunomax in a single DNA immunization. Xaxis are antigens used to stimu late lymphocyte proliferation in vitro. Y axis is stimula tion index (SI).
2225–2233, and 2252–2260), as well as with recombi nant proteins including NS5A amino acids 2061– 2302 and 2212–2313 resulted in lower SI of 2.3–5. We analyzed the cytokine content in the superna tants of stimulated splenocyte cultures, obtained from mice inoculated twice or thrice with the DNA vaccine, and did not observe cytokine secretion 1 week after the second immunization (results not shown). One week after the third immunization, stimulation with NS5A antigens caused lymphocytes to actively produce IL2 and IFNγ, and somewhat lower levels of TNFα (Table 3). Recombinant proteins of different HCV genotypes induced the highest secretion levels of IFNγ (21–127 pg/ml) and IL2 (18–41 pg/ml); HCVspe cific phages induced 14–112 pg/ml secretion of IFNγ and 24 pg/ml of IL2. The peptide 2163–2171 stimu lated considerably IFNγ secretion (74 pg/ml). TNFα production levels induced by phages and one of the peptides were lower (4–12 pg/ml). Concanavalin A, a nonspecific stimulator used as a positive control, caused IFNγ secretion similarly to NS5Aspecific antigens (235 pg/ml). IL2 secretion levels induced by conA (436 pg/ml) were an order of magnitude higher than those induced by HCV anti gens. In contrast, conA did not stimulate TNFα pro duction (Table 3). The control animals were immunized with pcDNA3.1 vector. SI values and the levels of cytokine secretion in response to NS5A antigens as well as to HCV nucleocapsid and NS4 proteins were below the sensitivity threshold of the detection systems used and did not differ from those of nonstimulated lympho cytes. ConA stimulated IFNγ and IL2 secretion to the levels of 28 and 98 pg/ml, and did not induce TNFα production.
Thus, we have constructed a recombinant DNA vaccine carrying the fullsize gene of the HCV protein NS5A, and a plasmid carrying a gene encoding NS5A fused with the GFP (GFPNS5A). Transfection experiments with eukaryotic cell lines Vero and Huh7 served to confirm the ability of the suggested construct to express NS5A in mammalian cells. Human hepato carcinoma cells were considerably more permissive to transfection than green monkey kidney cells. Specific MAB staining of NS5A in the cytoplasm of transfected cells of both lines confirmed HCV gene expression in mammalian cells. Cytoplasmic localization of NS5A was previously described in other studies [20, 21]. One of our major objectives was to check whether the above construct is able to cause immune response in mice. The humoral response was rather weak: at dif ferent points of time after several immunizations, the serum antibody titer assayed by ELISA with recombi nant NS5A was approximately 1 : 100. The humoral response was not investigated in previous studies con cerning immunogenicity of NS5Aencoding DNA vaccines [22, 23]. On the other hand, in mice immu nized with DNA constructs carrying the genes of other HCV proteins (nucleocapsid, NS5B), a weak B cell response could be detected, although antibody titers were not higher than 1 : 100 [24, 25]. Cellular response to NS5A DNA was, in contrast, observed as soon as after the first vaccination. To increase the efficiency of DNAvaccination, we used Immunomax, a novel plant peptidoglycan that was shown to considerably increase the immunogenicity of protein antigens [19, 26]. Immunomax has immuno modulating properties and can activate NK cells, den dritic cells, monocytes, and macrophages [26]. For the first time, Immunomax was shown to efficiently stim ulate Tcell response to DNA inoculation. This is an important result, since the immunogenicity of DNA itself is low, and DNA vaccination involves different types of adjuvants, such as cytokines, cytokine genes, or liposomes [24, 27, 28]. The results of previous studies showed that, after immunization of mice with NS5Aencoding DNA vaccines, in vitro lymphocyte stimulation with an NS5Aderived recombinant protein [23] or peptide [22] induces cellular immune response, that is, lympho cyte proliferation, IFNγ and IL5 [23] production, and specific cytotoxic activity of CD8+ cells [22, 23]. For the first time, to evaluate cellular immune response more comprehensively, we used a broad assortment of antigens. Interestingly, among different antigens used to stimulate splenocytes of immunized animals in vitro, synthetic peptides showed the lowest activity (Table 3). The peptides were selected based on the human CTL epitope database [11], since there are hardly any direct data on the specificity of Tcell NS5A epitopes for different mouse haplotypes. It is possible that some of the peptides used are not pre MOLECULAR BIOLOGY
Vol. 44
No. 2
2010
IMMUNOGENICITY OF A PLASMID ENCODING HCV PROTEIN NS5A
251
Table 3. Cellular immune response in mice after triple immunization with pcDNANS5A Lymphocyte proliferation*
Antigen Peptides
Recombinant pro teins
Phages
p1987 p2140 p2151 p2163 p2225 p2252 p2269 p2295 rNS5 2061_1b rNS5 2212_1b rNS5 2212_3b rNS5 2212_4a ph 2d1 ph 1e5 ph 2e10
Concanavalin A
1.5 2.3 2.5 2.9 2.3 2.4 1.2 1.5 2.3 3.1 2.9 4.6 15.8 20.0 16.5 38.5
Cytokine secretion** IFNγ
