Yehiam Salts 1, David Kenigsbuch 1, Ruth Wachs 1, Wilhelm Gruissem 2 and Rivka Barg 1. 1Department of Plant Genetics, Agricultural Research Organization, ...
Plant Molecular Biology 18: 407--409, 1992. © 1992 Kluwer Academic Publishers. Printed in Belgium.
407
Update section Sequence
DNA sequence of the tomato fruit expressed proline-rich protein gene TPRP-F1 reveals an intron within the 3 untranslated transcript Yehiam Salts
1, David
Kenigsbuch 1, Ruth Wachs
1, Wilhelm Gruissem 2 and
Rivka Barg 1
1Department of Plant Genetics, Agricultural Research Organization, The Volcani Center, Bet Dagan, Israel; 2Department of Plant Biology, University of California, Berkeley, CA 94720, USA Received 4 September 1991; accepted 12 September 1991
Recently we reported the sequence of a c D N A encoding a proline-rich protein that is preferentially expressed in young tomato fruit. This clone represents a single-copy gene (designated TPRPF1) in the tomato genome [5]. The cDNA clone was used as a probe to screen a tomato genomic library in 2Ch35 (supplied by R. Fischer) [4], and to isolate the homologous genomic clone G16. The 12 kb insert of G16 hybridizing to cDNA clones 1-36-1 and 1El [5] was subcloned into pBluescript (Stratagene) and the corresponding D N A region was sequenced using the dideoxy method [6]. Sequence analysis of the deduced open reading frame revealed the existence of proline-rich repeating amino acids motifs, e.g. PPIV (10 x ), P P S T (6 x ) and PTPP (5 x ) etc. These motifs resemble those found in extensins, a family of plant cell wall proteins characterized by their high hydroxyproline content, and have repeating structures [7, 9]. Similar to other proline-rich protein genes for which spatial and temporal regulation of expression has been reported [e.g. 2, 3, 8], the expression of TPRP-F1 is also organ- and temporally specific. Comparison of the c D N A sequence [5] with
the TPRP-F1 genomic D N A sequence, revealed the existence of a 327 bp intron (underlined in Fig. 1) within the 3' untranslated region of the transcript. Otherwise, both sequences are identical throughout their overlapping region. The sequence identity exists even though the genomic and the c D N A clones were isolated from different cultivars: the cDNA clones from cultivar Arava and G16 from cultivar V F N T Cherry. This is the third observation of an intron in this unusual location, in genes encoding proline-rich proteins; the other two are a carrot extensin [ 1, 7] and a maize H R G P gene [8]. The existence of an intron in the 3' untranslated region of the transcript, in these three different genes, in both monoand dicotyledonous plants, suggests that they may have evolved from a single ancestral gene. Whether this intron has any biological function can be tested experimentally.
Acknowledgement This work is supported by BSF grant 87-00397, and by grant 1.1626.89 from BARD, The United States-Israel Binational Agricultural Research & Development Fund.
The nucleotide sequence data reported will appear in the EMBL, GenBank and DDBJ Nucleotide Sequence Databases under the accession number X61395.
408 i TGTCTATAAGAATGGGTGTGTTAAAGAGCTAGTGCCATAGTGTACCATTCTATTGGTAGCATTTGGCAAGAGTTATTCCC 81 TCTCTCCATACCAATGGAGAAGTTTAATCTTGCTAGAGTCTTATTGTTGCTTCTTCAACTTGGAACTTTGTTCATTGCCC
161/1 A T G CAT GTC CTT ATT G C A TGT CCT TAT TGT C C A TAT CCT CCT TCC A C C C C A A A A CAC C C A Met his val leu ile ala cys pro tyr cys pro tyr p r o pro ser t h r pro lys his pro 221/21 A A A TTG CCT CCT A A G G T G A A A C C A CCC TCT A C A C A A CCT C C A CAT G T G A A A C C A CCT TCT lys leu pro pro lys val lys pro pro set thr gln pro pro his val lys pro p r o ser 281/41 ACC CCT A A A C A C CCT A A A GAT CCT C C A CAT GTG AAG C C A CCT TCT A C C CCT A A A C A A C C A thr pro lys his pro lys asp pro pro his val lys pro pro set thr pro lys gln pro 341/61 C C A TAT GTG A A A C C A CCT ACT ACC CCT A A A CAC CCT C C A CAT GTT A A A C C A CCT TCC ACC pro tyr val lys pro pro thr thr pro lys his pro pro his val lys pro pro ser thr 401/81 CCT A A A CAC CCT A A A CAC CCC C C A C A A A A A C C A TGC CCT CCT C C A TCT CAT CAT GGT CCT pro lys his p r o lys his pro pro gln lys pro cys pro pro pro ser his his g l y pro 461/101 A A G C C A C C A A T T G T A A A A CCT C C A CAT G T A C C A A G A CCT CCT A T A G T G CAT CCT CCT CCC lys pro pro ile val lys pro pro his val pro arg pro pro ile val his pro p r o pro 521/121 ATT GTC TCT C C A CCT TCC A C A CCT A A A C C A C C A A A A A C A C C A C C A TTC ACT C C A A A A CCA ile val set pro pro ser thr pro lys p r o pro lys thr pro pro p h e thr pro lys pro 581/141 C C A T C A C C A A T A C C A CCT ATT GTT TCA CCC CCT ATT GTT TAT C C A C C A ATC ACT C C A A C A pro set pro ile pro pro ile val ser pro pro ile val tyr pro pro ile thr p r o thr 641/161 C C A CCT ATT G T C CAT C C A C C A GTC ACT C C A A A A C C A C C A TCA C C A A C A CCT CCT A T T GTT pro pro ile val his pro pro val thr pro lys pro pro ser pro t h r pro pro ile val 701/181 T C A CCC CCC ATT GTT TAT C C A CCA ATC ACT C C A A C A C C A CCT GTT G T G TCA CCT C C A ATC set pro pro ile val tyr pro pro ile thr pro thr pro pro val val ser pro p r o ile 761/201 ATT C C A A C A C C A CCT ATT G T C TCT CCA CCT TTT GTC C C C AAT CCT CCC G T G G T A A T A C C A ile pro thr pro pro ile val ser pro pro phe val p r o asn pro p r o val val ile pro 821/221 C C A CCC TAC G T G C C A AGT CCT CCG GTT GTT ACT CCA CCC A T A GTT C C A A C A CCC CCT A C A pro pro tyr val pro ser p r o pro val val thr pro pro ile val p r o thr pro pro thr 781/241 C C A TGC C C A C C A C C A C C A C C A C C A C C A G C A A T A A T A C C A TCA C C A C C A G C A C A A C C A ACT pro cys pro pro pro pro pro pro pro ala ile ile p r o ser pro pro ala gln p r o thr 841/261 TGC CCC ATT GAT GCT CTC A A G C T A GGT GCT TGT GTG GAC G T G T T A G G A G G A C T A A T C CAC cys pro ile asp ala leu lys leu gly ala cys val asp val leu g l y g l y leu ile his 901/281 ATT G G A A T C GGT G G A AGT GCT A A G C A A A C A TGT TGT C C A CTT C T A G G A G G A C T A G T A GAC ile gly ile g l y gly ser ala lys gln thr cys cys p r o leu leu g l y gly leu val asp 961/301 TTG GAT G C A G C C ATT TGT CTT TGC A C A A C T ATT A G A CTC A A G CTC T T A A A C A T A A A C ATC leu asp ala ala ile cys leu cys thr thr ile arg leu lys leu leu asn ile asn ile 1021/321 ATT CTT CCC A T T GCT C T A C A G GTT CTT ATT GAT GAT TGT GGC A A G TAT C C A CCC A A A GAC ile leu pro ile ala leu g l n val leu ile asp asp cys gly lys tyr pro pro lys asp 1121/341 TTC A A G TGT CCT TCA ACC T A A A T C A A G G T T T C C A C T T T T T C T C A C T T T C A A T T A T T A C T C A C T C C T A C T C A A T phe lys cys pro ser thr OCH 1093 TTATGTGGTA•AGTTGA•ATTTCAAGTATTAC••43CCAATTTT•TTAGcT•GGAATTTTTTTAAAT•TCTTTAAATATTTT
409 1173 GATTTATA•TA•TTATTA•GTA•TTTT•ATAAGTATAAATTT•ATTT•ATATATGAATT•A•G•TcAAAAATTTAAAGTT 1253 TATTTAACCAATGCCACATAACTTAGAACATACAAAT~TCTTTTT~ATCAAGATTTQGCAATTCGT~T~CAATAATCTTT 1333 A~cAAGTAATATGTATAccAACATTATGTAATATGATGCAGCATATTAAACAGGACATTTGACTGATAcTGccGCATT~T 1413 CATAGTTGAAGGCACAATAAATGTGTGAAAGTTCAATTTCCATTTTATCATGC/~AATAAATTGAGAAAACAAAGGA~A 1493 TATTAATTAAGcTTTAATTTGGCGTGTTTAATTAGCTTTTGATTAATGTAcTGAATGTTGTATTTACATTATTGTTTTAG 1573 GGAAATAcTAATGGTATTTAGTATAGTGGAGTATGAATGCTGATTTGATTGTATGAAcACGAATGAATGAGGAAAGAATc 1653 ~I-36-I ACCTAATTTATCACGTGTTAATCT
~i E1 Fig. 1. Nucleotide and deduced amino acid sequence of TPRP-F 1 gene. The intron is underlined and the 3' ends of cDNA clones 1-36-1 and 1El [5] are indicated by arrows. The pBluescript plasmids were sequenced from both ends with T3 and T7 primers and the internal regions were sequenced with synthetic oligomers.
References 1. Chen J, Varner JE: An extracellular matrix protein in plants: Characterization of a genomic clone for carrot extensin. EMBO J 4:2145-2151 (1985). 2. Hong JC, Nagao RT, Key JL: Developmentally regulated expression of soybean proline-rich cell wall protein genes. Plant Cell 1:937-943 (1989). 3. Hong JC, Nagao RT, Key JL: Characterization of a proline-rich cell wall gene family of soybean: A comparative analysis. J Biol Chem 265:2470-2475 (1990). 4. Quertermous T: Production ofgenomic DNA and cDNA libraries. In: Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K (eds) Current Protocols in Molecular Biology, pp. 5.7.1-5.7.4. John Wiley, New York (1987). 5. Salts Y, Wachs R, Gruissem W, Barg R: Sequence coding
6.
7.
8.
9.
for a novel proline-rich protein preferentially expressed in young tomato fruit. Plant Mol Biol 17:14%150 (1991). Sanger F, Nicklen S, Coulson AR: DNA sequencing with chain-termination inhibitors. Proc Natl Acad Sci USA 74:5463-5467 (1977). Showalter AM, Varner JE: Plant hydroxyproline-rich glycoproteins. In: Marcus A (ed) The Biochemistry of Plants, vol. 15, pp. 485-520. Academic Press, San Diego (1989). Stiefel V, Ruis-Avila L, Raz R, Vatles MP, Gomez J, Pages M, Martinez-Izquierdo JA, Ludevid MD, Langdale JA, Nelson T, Puigdomenech P: Expression of a maize cell wall hydroxyproline-rich glycoprotein gene in early leaf and root vascular differentiation. Plant Cell 2: 785793 (1990). Varner JE, Lin L-S: Plant cell wall architecture. Cell 56: 231-239 (1989).
