Copyright 0 1997 by the Genetics Society of America
Dominant Mutations of Drosophila MAP Kinase Kinase and Their Activities in Drosophila and Yeast MAP Kinase Cascades Young-Mi Lim,*'t" Leo T~uda,*~l** Yoshihiro H. Inoue,"" Kenji Takashi Adachi-Yamada," Mami Hata,: Yoshimi Nishi,: Kunihiro Matsumotot and Yasuyoshi Nishida" *Labomto? ofDeuelopmenta1 Biology and tLaboratory of Cell Regulation, Division of Biological Science, Graduate School of Science, Nagoya University, Chikusa-ku, Nagoya 464-01, Japan and :Laboratory of Experimental Radiology, Aichi Cancer Center Research Institute, Chikusa-ku, Nagoya 464, Japan Manuscript received December 2, 1996 Accepted for publication February 4,1997 ABSTRACT Eight alleles of Dsorl encoding a Drosophila homologue of mitogen-activated protein ( M A P ) kinase kinase were obtained as dominant suppressors of the MAP kinase kinase kinase D-raJ These Dsorl alleles themselves showed no obvious phenotypic consequences nor any effect on the viability of the flies, although they were highly sensitive to upstream signals and strongly interacted with gain-of-function mutations of upstream factors. They suppressed mutations for receptor tyrosine kinases (RTKs); torso (tor), smenless (seu) and to a lesser extent Drosophila EGF receptm (DER). Furthermore, the Dsml alleles showed no significant interaction with gain-of-function mutations of DER. The observed difference in activity of the Dsorl alleles among the RTK pathways suggests Dsorl is one of the components of the pathway that regulates signal specificity. Expression of Dsorl in budding yeast demonstrated that Dsorl can activate yeast MAP kinase homologues if a proper activator of Dsorl is coexpressed. Nucleotide sequencing of the Dsorl mutant genes revealed that most of the mutations are associated with amino acid changes at highly conserved residues in the kinase domain. The results suggest that they function as suppressors due to increased reactivity to upstream factors.
A
and the budding yeast, Saccharomyces cereuisiae, contains cascade of protein kinases composed of mitogenat least three distinct MAPK cascades controlling matactivated protein kinase(MAPK), MAE'K kinase ing pheromone response, cell wall integrity, and re(MAPKK or MEK) and W K K kinase (MAPKKK or sponse to osmotic stress (Figure 4; DAVIS 1994;MAEDA MEKK) plays pivotal roles in the transduction of extracellular signals controlling cellular proliferation and et al. 1995). The MAPKKK components of the yeast differentiation (NEIMAN 1993; NISHIDAand GOTOH cascades comprise a family distinct from the Raf family. 1993). The chain of phosphorylation reactions is initiMEKK, a homologue of yeastMAPKKKs, has been idenated byRaf-1, a that is activated by a yet tifiedin mammals and has been shown to activate unproved mechanism after being recruited tothe MAPKK/MEK i n vitro (LANGE-CARTER et al. 1993). Their plasma membrane through binding of its amino termiMAF'K components can be classified into subfamilies nal CR1 region to GTP-Ras (VOJTEKet al. 1993; CHUANG according to the tripeptide motif at the phosphorylaet al. 1994; FABIANet al. 1994). Raf-1 then activates tion site in the activation lip; threonine-glutamate-tyroMAPKK by phosphorylating two adjacent serine/threosine in MPKl, FUSS and KSSl and threonine-glycinenine residues in the activation lip located between the tyrosine in HOG1 (DAVIS1994). Three subfamilies of kinase subdomain VI1 and VI11 (YANand TEMPLETON MAP& have been identified in mammals; MAPK/ERK, 1994; ZHENG and GUAN 1994a).MAPKK is a dual speJNK/SAPK and p38/MPK2 subfamilies, whose tripepcific kinase and in turn phosphorylates both threonine tide motives are threonine-glutamate-tyrosine, threoand tyrosine residues in the threonine-glutamate-tyronine-asparagine-tyrosine and threonine-glycine-tyrosine tripeptide motif in the activation lip ofMAPK sine, respectively (NISHIDAand GOTOH1993; DAVIS (CREWS and ERIKSON1992; KOSAKOet al. 1992; Rosso1994). MANDO et al. 1992). Drosophila contains a single rafgene, D-raJ that is at The cascade is highly conserved during evolution, least involved in the regulation of cellular proliferation, differentiation of muscle or peripheral nervous system Cmzsponding authw; Yasuyoshi Nishida, Laboratory of Develop in the thorax necessary for eclosion, and in transducmental Biology, Division of Biological Science, Nagoya University Graduate School of Science, Furosho, Chikusa-ku, Nagoya 46401 tion of diverse developmental signals from receptor tyrJapan. E-mail:
[email protected] osine kinases(RTKs) encoded by torso (tor), sevenless The first three authors made equal contributions to this work. (seu) and Drosophila EGF receptor (DER) ( PERRIMON et al. Present address: Department of Biological Chemistty, MacDonald 1985; NISHIDA et al. 1988; AMBROSIO et al. 1989; DICKSON Medical Research Laboratories, Howard Hughes Medical Institute, University of California, Los Angeles, CA 90095-1662. et al. 1992; HATA et al. 1994; BRANDand PERRIMON
M A P =
Genetics 146: 263-273 (May, 1997)
264
Y-M. Lim et al.
CAACCTTTTGG (anti-sense primer 6 R nucleotide residues 2538-2517). These primerswere flanked by a BamHI recognition sequence at their 5' ends and PCR-amplified fragments were cloned into the BamHI site of pBluescript (Stratagene) after BamHI digestion. Ampli Taq DNA Polymerase PCR Kit stand how this signal specificity is achieved. (Takara Co. Ltd,Japan) was used for the PCR reactions. The nucleotide sequences of these cloned PCR fragments were In the course of studies of genes encoding factors determined by the chain termination method using the Taq acting downstream of D-raf, dominant suppressors of Dye Deoxy Terminator Cycle Sequencing Kit (ABI). D-raf were screened and 18 mutants were obtained. The nucleotide alterations found in DsorlSu4and D~orl,''~~ Analysis on one o f t h e m , S u l ,has led to the identificawere introduced into thenormal Dsorl cDNA by site-directed is f o r Downstream Suppressor oJfraj, tion of Dsorl (&r mutagenesis with appropriate mutagenic primers using the Transformer Site-directed Mutagenesis Kit (Clontech) acwhich encodes the Drosophila homologue of W K K cordingtotheprocedurerecommended by the manufx(TSUDAet al. 1993). The dominant allele, Dsorlsul, was turer. The normal and mutantDsorl cDNAs were cloned into f o u n d to interact not only with D-rufbut also with muta- the yeast high copy number expression vector, pNVl1S (YAtions for factors acting further upstream of D-raf in MAGUCHI et al. 1995). the Tor pathway. Genetic interactions ofthe dominant Yeast strains itnd culture: The S. cerevisiaestrains used were SY1491 (MATa ura? his3 leu2 trpl FUSl::HIS3 pep4A::ura? allele and the loss-of-function phenotypes of Dsorl recanl ste4A: :LEU2), SY1493 (MATa ura? his3 leu2 trpl Dsorl in cell proliferation and in vealed the roles of FUSl:: HIS3 pep4A :: ura3 canl ste7A :: URA3), sY1984 ( M A T a Tor-mediated signaling(TSUDAet al. 1993). Dsorl is also ura? his3 leu2 tvpl Fusl:: HIS3 pep4A:: ura3 canl stellA : : referred to as D-mek and temperature-sensitive mutants ura3), DL251 (A'lATa/MATa ura3/ura? leu2/leu2 his4/his4 revealed the involvement ofDsorl/D-mek i n the Sev and trpl/trplcanl/can.l bcklA:: URA3/bcklA:: URA?), 3233-1B ( M A T a ura3 leu2 his3 trpl mkklA : : LEU2 mkk2A : : HIS3), KANDER pathways as well (HSU and PERRIMON 1994). We 4CllU ( M A T a its3 leu2 trpl bck1A::LEUZ stellA::URA3) Dsorl alleles among the have identified seven additional (IRIE et al. 1993), and TM334 ( M A T a ura3 leu2 trpl his? lys2 remaining suppressors of D-raf that showed changes in pbs2A:: HIS3) (MAEDA et al. 1995). Yeast cultures were grown signal strength and specificity. Their molecular charac- in YEP (1% Bacto yeast extract/2% Bacto Peptone) suppleterization and a n analysis of their activities in Drosophmented with 2% glucose. SD medium [0.7% yeast nitrogenbase without amino acids (Difco)/2% glucose], suppleila and budding yeast were undertaken in an attempt mented with the appropriate nutrients,was employed for the to address the question of signal specificity in developselection of cells with plasmids. Yeast cells were transformed ment. by the lithium acetatemethod. General genetic manipulations
1994). It is not known how specific developmental responses are induced by the single shared pathway in response to the different RTKs. Further characterization of the pathway components is necessary to under-
MATERIALSAND
METHODS
Fly stocks and culture: Fly cultures and crosses were performed according to standard procedures 25" at unless otherwise noted. se8'; spcl Sod" was provided by U. BANERJEE, RaslP2"/TM3 byM.A. SIMON,E&'/CyO, EkB'/CyO, and phyl/ CyO, Raslv" by G. M. RUBIN,Sed" and D - r a y Y yby E. HAFEN, cntop'/Cy, top'J/C.y by T. SCHUPBACH,and c n $bZw7' b7u sp/ Cy0 byB-Z. SHII,O.For description of the genetic markers and balancers, see LINDSmY and ZIMM (1992). Molecular procedures: DNAs were extracted from hemizygous/homozygous mutant flies as described previously (NEHIDA et al. 1988). Using the mutant fly DNA as templates, the mutantDsorl genes were cloned as sets of six overlapping fragments byPCR with the following sense and anti-sense primer sets: GTTGCACACCGCACCGTCTG (sense primer 1N; the nucleotide residues 1-20 as described in TSUDA et al. 1993) and CGGTGTTATTGGAATGGGTGC (anti-sense primer 1 R nucleotide residues 588-566); CCGCCACAGTGGCGCCGAC (sense primer 2N; nucleotide residues 473-491) and CGAAACTGACTTTGTCATCCC (anti-sense primer 2 R nucleotide residues 901-881); TCCTTTCGTGTGACGCACAGG (sense primer 3N; nucleotide residues 791-812) and TCCGTGTCGCCCATGTCCAGACC (anti-sense primer 3R nucleotide residues 1240- 1218); GCTGGGGAAGCCCAAGACGAGC (sense primer 4N; nucleotide residues 11691190) and CTTGATCTCGCCGCTGCTATTGACG (antisense primer 4 R nucleotide residues 1718-1694); TCCACCGTGACGTGAAGCCGAGC (sense primer 5N; nucleotide residues 1662- 1685) and CTGTTTCTTCAGGCAGATGTCC (anti-sense primer 5 R nucleotide residues 2284-2263); and CCAGCTAGAGCACAAGATCTTCTCC (sense primer 6N; nucleotide residues 2219-2242) and CGCTTATGTATT-
were carried out as described (GUTHRIEand FINK1991). Otherprocedures: Transmission electron microscopy of ultra-thin sectioned adult compoundeyes embedded in Epon was performed according to standard procedures. Cuticular preparations of the embryos were made as described (WIESCHAUS and NUSSLEIN-VOLHARD 1986) and observed with dark-field optics.
RESULTS AND DISCUSSION
Dsorl mutations are highly sensitive to upstreamsignals: D-ray'" is a hypomorphic allele of D-ruf and its hemi- or homozygotes dieduring or soon after eclosion, showing a rough eye phenotype due mainly to loss of t h e i n n e r R7 and some outer photoreceptor cells (Fig-
ure 1, B a n d G). A m o n g t h e 18 mutant lines obtained in a screen for suppressors of D-raf'.'"" (TSUDAet ul. 1993), eight mapped to t h e Dsorl locus. All fully rescued the lethality a n d t h e e x t e r n a l eye morphology of Draf"""mutant flies (Figure 1C). However, detailed analysis of the rescued eye by electron microscopy revealed incomplete suppression of the eye defect by some alleles (Figure 1H; Table l, column 2). Single copies of these alleleshad a full effect in females homozygous for D-raf""" (data not shown), indicating their complete dominance over the normal allele. As t h e Dsorl mutations were induced on theX chromosome as D-raf""", the alleles were separated from D-rafC"" by meiotic recombination to examine their
Drosophila MAPKK Mlltations
?r. :3G$fq e;:,;,
@,;:TT.;:?.r
w
r . :J:-?~ :
;':I ,.0.:' _.. . ,9*, a , 7 ! .:.,- ;. ;;. . ' , ..+.. . . .. k.:;?:;.;, '* ;., /"'." , cs::',.. ... -!?, . ' 1
k.:,y,.;.;-
:
,'
.\
... cur.,.. i'y - .-. !
,
~
>y.-*Y ,
%.. .:: ?,.:y ' .,
- < , ..'i.:.
*..!sj#;.! '
!.:
,
' '
. I
'
'.
c
't
+'
7.:
"
--.* . T -.:* .,F . ' . Hf-?f..gt !:&--?. . , .: 1 .:. ??> .. t
"... ." ' :, : ~ p . ~ - q
+".* . . ..
,
C*G.?V.
..I
^,
~
('
.t
,
~'-;,;s,,,;;; ,:.::: ;;""
'
'
,
.*
..\'.
i:..
.._
. ._ _ ..
'
'
1
'
;
..-ae;
.I
.,
5
~~
>
;'
.
.-
'...
,
.,
*I.
.*j , ., ,., , .:.:..-;. :* ,,-, .!, i % ' , f' $"rosophil;l MAPKK Mlttalions
267
1 0 1 . ~ t l ; I ~ ( w I a /l N 0 1 - /\‘gotic. . / / / I ;tc.ti\.it\. ; ~ n dsuppression o f the defects a ( h t o n - S (norlnal) fh;llc. I n ctnlxTos laid 1: /ot”.” females the structures posterior t o the scvcwth ; I l x l o m i n a l scgmcnt ( A i , indicatrd with arrowhcarls) and t h c hc;~drcgions arc missing (B). lhlxyos laid b y s t ? Ilsorl’“”/Rit~,sc;/ m ’ ’ ’ t ((:) and ,st/ I).sorl’”’/l~it~,sc; /or/’.’’ (1)) lcm;dcs.Thr posterior dt.fkt was G w i a b l v suppressed t>y t I 1 r dominant 1l,snr/ mutations I ~ t11c I anterior tlcfccc \\‘as n o t arlbctccl ~ > ym y o f t11cm.,///?’” (E) ant^ stt 1)sor1”1’; //)-I1.’.’ (F) c 1 1 1 1 ~ ylaitl ) s ;UKI ; I I I O W ~ I t o tlcve~opa t 2.50., / / P i r (G) ;ultl .w ~ ) . s / , r ~ ” “ ; , / / t ~( ~ Hl)” ei ’m l x y s IaicI ancl a ~ o w c dt o t~cveiopat 280. h t c r i o r is t o the t o p . The vitelline mclnlxxno w a s rcnlovctl liom thcs rmblTos s h o w n in X-D.
FI(;I’KI.:2.-’1’11(, c . u t i c . d ; w
~ I I I C I I I S01 c1111)t~os tlcli.c.ti\.c.
by the tlomin;unt I h r l Inutations. (A) An c ~ n l r y olaid b y
tlevclopment. A temperature-sensitive allele of Ilk’R, ./i/in/ /in/. / ) d / 2 i 1 ’ i “ ( ,/l/)””i~’), affects the clevelopment of embryonic cuticle and central ne~-voussystem, in addition to head involution and germhand retraction at25” (Figure ‘LE). Ahout 90% of the homozygous embryos failed t o untlcrgo head involution. I n contrast to this, only about halfofthe mutant cmbqos failed when both parents were homo- o r hemizygous for one of the two strong alleles, I ) . ~ ~ ) ~ Io~r ~IlsorI.’“” “‘ (other alleles are not yet tested) (Figure 2F). ,/I/)””’” is nearly n u l l frtnctional at 28” and affects c m b l y l i c tlevclopment severely, exhibiting the faint little lyall phenotype with poor cuticular formation (Figure X ) . Maternal expression o f the Ilsorl alleles allowed formation o f some wntral denticlc belts in several per cent of embryos (Figure 2H). The observed activity of the IlsorI alleles i n embryonic development could he due t o the large amount of maternal I h r I mRNA i n the ooplasm ( T S ~ WP/AN / . 1993). T h e IlsorI alleles showed strong activity in the Tor and Sev pathways while their activity in the DER pathway was less obvious and was seen only i n the embryo i n
which a large amount of mutant IlsorI products were provided by its maternal expression. The results indicate that DER requires a higher level of Ilsorl activity than Sev and Tor. Fwthermore, nosignificant interaction was observed between IY/)and the dominant Dsorl alleles, and this is in contrast to the strong interaction o f E / / ) with gain-of-function mutations of Sos and rl, wvhose products act upstream and downstream of Dsorl, respectively. The results suggest that the DER pathway activates Dsorl less efficiently than the Sev and Tor pathways o r that activation o f RI by Dsorl is less efficient i n the DER pathway than in the others. Thedifferential activity o f I h r I may he explained by the involvement o f a Factor o r factors that reduce(s) required levels of Ilsorl activity i n the Sev and Tor signalingpathways hut n o t in the DER pathnvay. Onecandidateforsuch a fnctor is STE5, which tethers multiple protein kinases i n the MAPK cascade required for mating in budding yeast (C1m P/ d . 1994). RWPKK/MEK-cnhancing factor (MEF) purified from rabbit skeletal muscle is another canditlate. In the presenceo f MEF, molar equiva-
268
Y-bl. I.im
('1 ctl.
F I ( ; ~ ' R I 3.--
