Dopamine D1 Receptor Blockage Potentiates

Journal of Neuroendocrinology From Molecular to Translational Neurobiology Journal of Neuroendocrinology 23, 302–309 ª 2011 The Authors. Journal of Neuroendocrinology ª 2011 Blackwell Publishing Ltd

ORIGINAL ARTICLE

Dopamine D1 Receptor Blockage Potentiates AMPA-Stimulated Luteinising Hormone Release in the Goldfish J. T. Popesku*, J. A. Mennigen*, J. P. Chang and V. L. Trudeau* *Centre for Advanced Research in Environmental Genomics (CAREG), Department of Biology, University of Ottawa, Ottawa, Canada. Department of Biological Sciences, University of Alberta, Edmonton, Canada.

Journal of Neuroendocrinology

Correspondence to: V. L. Trudeau, Department of Biology, Room 160, Gendron Hall, University of Ottawa, 30 Marie Curie, Ottawa K1N 6N5, Canada (e-mail: [email protected]).

Previous microarray analyses of the goldfish hypothalamus led us to hypothesise that dopamine could potentially inhibit the excitatory effects of glutamate on luteinising hormone (LH). Postspawning female goldfish were pre-treated ()4.5 h) with either saline (C; control), SCH 23390 (S; D1-receptor antagonist) or sulpiride (L; D2-receptor antagonist), followed by an i.p. injection, at )0.5 h, of saline or the glutamate agonist AMPA (A, SA or LA). Blood, hypothalamus and telencephalon tissues were collected. Serum LH was not affected in the S, L, A, or LA groups relative to control as determined by radioimmunoassay. The SA group, however, showed a 289% (P < 0.0005) increase in serum LH compared to either treatment alone or control. Real-time reverse transcriptase-polymerase chain reaction identified the mRNAs for ionotropic (Gria2a, Gria4) glutamate receptor subunits, activin ba, isotocin, and cGnRH-II as being significantly affected by some of the treatments. The same experiment conducted with sexually-regressed female fish showed a very different LH profile, indicating that this mechanism is seasonallydependent. We also show that i.p. injection of 1 lg ⁄ g isotocin was able to increase LH levels by 167% in sexually regressed female fish relative to controls. Taken together, these results demonstrate that blockage of the D1 receptor primes post-spawning goldfish for AMPA-stimulated LH release, and provides further insights into the central regulation of reproduction. Key words: dopamine, AMPA, luteinising hormone, cGnRH-II, activin, isotocin, gene expression.

Dopamine (DA) is a potent inhibitor of luteinising hormone (LH) release in the goldfish (Carassius auratus), as well as in many other fish, amphibians, birds and mammals, including humans (1). The currently-known mechanisms of the inhibitory action of DA in the fish are multifold: (i) DA inhibits gondatophin-releasing hormone (GnRH) release from GnRH neurones through the D1 receptor (2); (ii) DA directly inhibits LH release from gonadotrophs in the anterior pituitary through the D2 receptor (3, 4); (iii) DA decreases the expression of GnRH receptor mRNA in the pituitary (5, 6); and (iv) DA inhibits the synthesis of GABA (7, 8), an important stimulator of LH release (9). Previous work in our laboratory suggested that glutamate may be involved in stimulating LH release and that DA may be inhibiting its effect. Trudeau et al. (10) showed that injection of 2.5 lg ⁄ g AMPA, but not other glutamate agonists, significantly increased circulating LH levels in sexually regressed male goldfish 30 min postinjection. AMPA exerts its effects through ionotropic glutamate receptors (Grias). In mammals, there are four Grias (Gria1–4),

doi: 10.1111/j.1365-2826.2011.02114.x

whereas zebrafish, owing to the fish-specific genome duplication (11), possess eight copies of the receptor (Gria1–4a and b) (12). In ovariectomised rats primed with oestrogen and progesterone to induce persistent oestrous, Gria expression was increased in GnRH neurones (13), and Garyfallou et al. (14) showed that Gria2 and Gria4 are expressed in immortalised hypothalamic GnRH neuronal cells (GT1-1, GT1-7 and Gn10). Our previous microarray analyses of the hypothalamus identified the mRNA for Gria2a subunit as being significantly (q < 5%) increased 5 h post-injection with the DA D1-receptor-specific agonist SKF 38393 in sexually mature female goldfish (15). With these observations, we hypothesised that DA may be having an inhibitory effect on the glutamate system in the neuroendocrine brain of the goldfish through the modulation of Gria receptor subunits. Given the known impacts and importance of DA on pituitary hormone release, we aimed to further understand the influence and central targets of DA action in this multifactorial neuroendocrine regulation system. To this end, we investigated the effect of

D1R blockage potentiates AMPA-stimulated LH release

pre-treatment with either a D1- or D2-specific antagonist followed by treatment with AMPA on LH release. Because of their known importance to neuroendocrine regulation of LH release, we concurrently determined whether such treatments affected AMPA receptor subunits, GnRH, activin and isotocin (IST) mRNAs in neuroendocrine brain of post-spawning ⁄ sexually-regressing goldfish.

303

Blood was allowed to coagulate at 4 C overnight. Serum was collected by centrifuging the blood at 5000 g at 4 C for 15 min and stored at )20 C until used for the radioimmunoassay (RIA). To examine the effect of IST on LH release, sexually regressed female fish (July; GSI < 1%; n = 15) were i.p. injected with 0.6% saline or 1 lg ⁄ g IST (Chem-Impex, Wood Dale, IL, USA) dissolved in 0.6% physiological saline. Blood was obtained 5 h post-injection and serum was collected as described above.

Materials and methods RIA

Animals Common goldfish (24.0 5.6 g) were purchased from a commercial supplier (Aleong’s International Inc., Mississauga, ON, Canada) and maintained at 18˚C under a natural simulated photoperiod on standard flaked goldfish food. Fish were kept in 70-l tanks (18 fish ⁄ tank). All procedures used were approved by the University of Ottawa Protocol Review Committee and followed standard Canadian Council on Animal Care guidelines on the use of animals in research. Goldfish were anaesthetised using 3-aminobenzoic acid ethylester (MS222; Aquatic Eco-Systems, Apopka, FL, USA) for all handling, injection and dissection procedures. Female goldfish with gonadal maturational conditions between the post-spawning ⁄ regressing (June) to sexually regressed stages (September) were used.

Experimental and sampling procedures The DA D1-specific antagonist SCH 23390, DA D2-specific antagonist sulpiride and the glutamate agonist AMPA were purchased from Tocris (Ballwin, MO, USA). AMPA was dissolved in 0.6% saline to give a dose of 2.5 lg ⁄ g body weight of fish. The antagonists were first dissolved in a minimal amount of dimethylsulphoxide (DMSO), and subsequently diluted with 0.6% saline. The final concentration of DMSO was 0.099%. Post-spawning ⁄ sexually regressing [June; gonadosomatic index (GSI) 3.0 0.4%; n = 14–18 fish per treatment group] or sexually regressed (September; GSI 2.0 0.1%; n = 14–18 fish per treatment group) female goldfish received i.p. injections at 5 ll ⁄ g body weight of either SCH 23390 or sulpiride to give a dose of 40 or 2 lg ⁄ g body weight of fish, respectively, or saline vehicle containing an equivalent amount of DMSO. After 4.5 h, fish received a second injection of either saline vehicle or 2.5 lg ⁄ g AMPA. Thirty minutes after the second injection, blood was sampled by puncture of the caudal vasculature via a 25-gauge needle attached to a 1-ml syringe. For the experiment conducted in June, telencephali [containing the hypophysiotrophic preoptic area (16)] and hypothalami were rapidly dissected and immediately frozen on dry ice.

The double antibody RIA protocol of Peter et al. (17) was used to analyse serum LH levels, with minor modifications described by Zhao et al. (18). For all LH RIAs, n = 14–16 (June), 15 (July) or 17–18 (September) per treatment group.

RNA extraction and cDNA synthesis Tissues were homogenised using stainless steel beads in an MM301 Mixer Mill (Retsch, Newton, PA, USA) at 20 Hz for 2 min. RNA was isolated using the RNeasy Mini kit (Qiagen, Mississauga, ON, USA) in accordance with manufacturer’s instructions, including on-column DNase I treatment. RNA quantity was evaluated using the NanoDrop ND-1000 spectrophotometer (Thermo Scientific, Waltham, MA, USA). RNA quality was determined using the Agilent 2100 BioAnalyzer (Agilent Technologies, Inc., Santa Clara, CA, USA) and RIN numbers were determined to be 8.1–9.4; above the minimum value considered as ‘perfect total RNA’ for further analysis (19). For realtime reverse transcriptase-polymerase chain reaction (RT-PCR), cDNA was prepared from 2 lg total RNA, to which was added 200 ng of random hexamer primers (Invitrogen, Carlsbad, CA, USA) with Superscript II RNase H) reverse transcriptase in acoordance with the manufacturer’s instructions. The ‘no reverse transcriptase’ (NoRT) reaction was included for each cDNA synthesis run where RNase ⁄ DNase-free water was added to the reaction instead of Superscript II.

Real-time RT-PCR assays The Mx3005 Multiplex Quantitative PCR System (Stratagene, La Jolla, CA, USA) was used to amplify and detect the transcripts of interest. Primers were designed using Primer3 (http://frodo.wi.mit.edu) and initially tested using goldfish whole brain cDNA. Primers used in the present study are listed in Table 1. The resultant amplicons were sequenced to confirm speci-

Table 1. Primers for Real-Time Reverse Transcriptase-Polymerase Chain Reaction Used in the Present Study. Amplicon

Forward primer (5¢ fi 3¢)

Forward primer (5¢ fi 3¢)

Accession

L8 eF1a Activin baa Activin bba sGnRHa cGnRH-IIb Isotocinc Gria2a Gria2b Gria3b Gria4

AACTACGCCACAGTCATCTCC GATTGTTGCTGGTGGTGTTG TTTAAGGACATCGGGTGGAG GATGGAAAAGCGTGTGGAGT CTGGTCATACGGTTGGCTTC TACGATTCCTCAGAGGTTTCAG ATCTTGGCTACTGGCAGCTT CACTGAGGAGTTTGAGGATGG TGGTCAGTCGTTTCAGTCCA TGAGGAAATGGACAGGAGACA TGGACCGAAGACAGGAGAAG

CCAGCAACAACACCAACAAC GCAGGGTTGTAGCCGATTT TGATTGATGACGGTGGAATG CAGGAATGGACGGTGTGAG CATCAGCATCCACTTCATTCAC CATCCAGCACTATTGTCTTCAG GTATCTGCTGTGGTGAAGGT TTAGCCGTGTAGGAGGAGATG AACCACCAGACTCCTCCAAC CTGATGTTGGTAAAGCCCAGA TCCCAGGTTAGCGATGATGT

EU313780 AB056104 AF169032 AF004669 AB020242 U30386 AF322651 AM886310 DY231932 DY231931 U12018

Primers were based on the AURATUS EST project. Superscript letters indicate primers that have previously been published: a(9), b(48), c(38).

ª 2011 The Authors. Journal of Neuroendocrinology ª 2011 Blackwell Publishing Ltd, Journal of Neuroendocrinology, 23, 302–309

304

J. T. Popesku et al.

between D2 ⁄ AMPA, and saline control, AMPA, sulpiride and sulpiride + AMPA groups. Statistical analysis of the effect of IST on serum LH levels was assessed using a two-tailed Student’s t-test with P < 0.05 considered statistically significant.

ficity. Each real-time RT-PCR reaction contained the final concentrations: 2 ng of first-strand cDNA template, 1 · QPCR buffer, 3 mM MgCl2, 150– 300 nM each F & R primers, 0.25 · SYBR Green (Invitrogen), 200 lM dNTPs, 1.25 U HotStarTaq (Invitrogen), and 100 nM ROX reference dye, in a reaction volume of 25 ll. The thermal cycling parameters were an initial one cycle of Taq activation at 95 C for 10 min, followed by 40 cycles of 95 C for 30 s, 58–60 C for 45 s and 72 C for 30 s. After the reaction was complete, a dissociation curve was produced, starting from 55 C (+1 C ⁄ 30 s) to 95 C. Dilutions of cDNA (1 : 10 to 1 : 31 250) from all samples were used to construct a relative standard curve for each primer set, relating the initial template copy number to fluorescence and amplification cycle. For each PCR reaction, negative controls were also introduced, including a no-template control (NTC) where RNase-free water was added to the reaction instead of the template (cDNA) and NoRT as described above. The SYBR green assay for each target gene was optimised for primer concentration and annealing temperature to obtain, for the standard curve, an R2 > 0.99, amplification efficiency between 90% and 110% and a single sequence-specific peak in the dissociation curve. No amplification was observed in the NoRT or NTC controls, indicating no genomic or reagent contamination. The results for the telencephalon were normalised to ribosomal L8 mRNA and the results for the hypothalamus were normalised to elongation factor 1a (eF1a) mRNA because it was determined these mRNA levels did not change in these tissues for any of the given treatments. Data were analysed with MXPRO, version 4.01 (Stratagene). For all real-time RT-PCR reactions, n = 4–6 per treatment. Real-time RT-PCR was performed for the fish treated in June.

Results Serum hormone levels Serum LH levels of fish injected with saline, AMPA, SCH 23390 with and without AMPA, or sulpiride with or without AMPA, are presented in Fig. 1. In June, neither D1-specific or D2-specific antagonists alone, nor AMPA alone, had any effect on circulating LH levels relative to saline-injected controls. Pre-treatment with the DA D1-specific receptor antagonist, SCH 23390, followed by AMPA induced a significant increase (289%; P < 0.0005) in circulating LH, compared to either treatment alone. In a different year, but still in June, we repeated the injections of saline vehicle, SCH 23390, AMPA or SCH 23390 + AMPA to confirm the reproducibility of the treatments. We observed an increase (175%; P = 0.002) in circulating LH levels in the SCH 23390 + AMPA group compared to the vehicle control. To determine potential seasonal differences between sexually mature and sexually inactive fish, the experiment was repeated in September, when goldfish are fully sexually regressed. By contrast to fish treated in June, all of the treatments, alone or in combination, significantly increased serum LH levels (P £ 0.003; Fig. 1). Both SCH 23390 and sulpiride increased circulating LH levels by 210% and 213%, respectively, relative to controls. Furthermore, the injection of AMPA alone increased serum LH levels by 415% relative to saline-injected controls. The combined treatments of SCH 23390 or sulpiride with AMPA increased serum LH levels by 332% and 349%, respectively, relative to control fish. There were no statistical differences between any of the treated groups relative to each other.

Statistical analysis All statistics for real-time RT-PCR and RIA were performed using SYSTAT, version 12 (Systat Software Inc., Chicago, IL, USA). Data were assessed using the Kolmogorov–Smirnov test for normality and Levene’s test of homogeneity of variance. In cases where the data were not normally distributed, the data were log-transformed, which resulted in normality. A two-way ANOVA was performed with P < 0.05 considered statistically significant, followed by Tukey’s honestly significant difference pairwise comparisons if the data were homoscedastic, or Dunnett’s T3 pairwise comparisons in cases where the data were heteroscedastic. More specifically, we compared saline control, AMPA, SCH 23390 and SCH + AMPA because these treatments are all related to one another. Specific pairwise comparisons were also performed

40

Jun Sep

Serum (LH) (ng/ml)

b 30

a,b

20 a

a

a

a

B

10

B A

B

B B

co Sa

lin

e

+ e

iri d lp

nt ro l SC AM H PA SC 23 39 H 23 0 (D 39 1) 0 + AM Su PA lp iri Su d lp e iri de (D2 ) + AM PA

PA AM

(D

2)

PA

de iri

Su lp

Su

+

39 0 23

H SC

AM

(D

1)

PA 23

39 0

AM H SC

Sa

lin e

co n

tro

l

0

Fig. 1. Serum LH levels (mean SEM; n = 14–18) determined by radioimmunoassay following dopamine antagonists alone or combined with AMPA at two different times of the year. Values that are not significantly different from one another are identified by the same letter. ª 2011 The Authors. Journal of Neuroendocrinology ª 2011 Blackwell Publishing Ltd, Journal of Neuroendocrinology, 23, 302–309


Because we were testing the hypothesis that DA is inhibiting the glutamate system, we investigated the expression of different AMPA receptor subunits (Grias) by real-time RT-PCR. Steady-state mRNA levels of the Gria2a subunit in the hypothalamus were decreased 1.8fold (P = 0.028) in response to AMPA, although this response was blocked when fish were pre-treated with SCH 23390; however, neither SCH 23390, nor sulpiride alone had any effect (Fig. 2A). As determined by two-way ANOVA, an interaction (P = 0.006) was observed between DA antagonist and AMPA for Gria4 mRNA levels in the hypothalamus (Fig. 2B). Steady-state mRNA levels for Gria4 were decreased 1.9-fold (P = 0.02) in the hypothalamus of fish pre-treated with SCH 23390 relative to control fish. In fish treated with AMPA alone, Gria4 steady-state mRNA levels increased 1.4-fold, which was only marginally statistically significant (P = 0.055). However, in fish pre-treated with SCH 23390 and subsequently injected with AMPA, the relative mRNA abundance of Gria4 was unchanged relative to control fish. Sulpiride alone or in combination with AMPA had no effect on Gria4 mRNA levels in the hypothalamus. In the telencephalon, Gria2a and Gria4 mRNA levels were not statistically affected by any of the treatments compared to saline controls (see Supporting information, Fig. S1). Relative mRNA abundance of the Gria2b and Gria3b receptor subunits were not statistically affected by any of the treatments in either hypothalamus or telencephalon (data not shown). Both cGnRH-II and sGnRH are major stimulators of LH release in goldfish (20); therefore, we also investigated their expression in the brain. There were no effects of the various treatments on the hypothalamic GnRH mRNAs (P > 0.05, data not shown). In the telencephalon (Fig. 3), cGnRH-II mRNA levels were unaffected by SCH 23390, sulpiride or AMPA alone, as well as a sulpiride + AMPA combination, relative to controls. However, in fish pre-treated with SCH 23390 and subsequently challenged with AMPA, an increase

Relative expression/ housekeeping gene

2.0

Gria2a Gria4

A

1.5 a

a,b

1.0

a

a,b

A,C

A,C B,C

a,b b

B,C

B

0.5

(15-fold; P = 0.015) in cGnRH-II mRNA levels was observed relative to control fish. None of the treatments had any effect on sGnRH steady-state mRNA levels in the telencephalon. A previous microarray study conducted in our laboratory identified the mRNAs for IST and the activins as being decreased by DA agonists (21). Both are important for the control of reproduction and so we assessed the effects of the treatments on their expression in the brain. The relative expression of IST mRNA levels in the telencephalon (Fig. 4) of treated fish followed a similar, albeit not as pronounced, profile as those of cGnRH-II: there was little change except for the combined SCH 23390 + AMPA treatment. This combined treatment induced a 2.8-fold increase (P = 0.002) in IST mRNA levels relative to control fish. An interaction (P = 0.001) was observed between DA antagonists and AMPA for IST expression in the telencephalon. By contrast, none of treatments had any significant effect on hypothalamic IST mRNA levels. Activin ba mRNA levels were significantly increased by SCH 23390 in both the hypothalamus (ten-fold; P = 0.001) and telencephalon (four-fold; P = 0.011) relative to control fish (Fig. 5). Steady-state mRNA levels for activin ba were similarly increased in both the hypothalamus (8.8-fold; P = 0.001) and the telencephalon (4.1-fold; P = 0.007) in the combined SCH 23390 + AMPA treatment relative to control fish. There were no effects of sulpiride alone or in combination with AMPA on activin ba mRNA levels in either tissue. Activin bb mRNA levels remained unaffected by any of the treatments in either telencephalon or hypothalamus (data not shown).

Effect of IST on LH release Given the changes in IST mRNA levels (Fig. 4), we wanted to determine whether IST could participate in the stimulation of LH release. 30 b

25 Relative expression/ housekeeping gene

Real-time RT-PCR

305

cGnRH-II sGnRH

20 15 10 5

a,b*

4 3 2

a

a

a,b

a

1

Fig. 2. Relative expression (mean SEM; n = 4–6) of Gria2a and Gria4 in the hypothalamus of post-spawning ⁄ sexually-regressing female goldfish 5 h post-injection with either SCH 23390 or sulpiride with or without AMPA. Values that are not significantly different from one another are identified by the same letter. There were no statistical differences in the telencephalon relative to saline control (see supporting information Fig. S1).

PA +

de

de pi ri Su l

Su l

pi ri

+ SC H

AM

(D

2)

PA AM

(D

1)

PA

23 39 0

AM

SC H

lin

e

co nt

ro l

0

Sa

Sa

lin e

co nt S ro SC CH H 23 AM l 23 3 P 39 90 A 0 (D 1 S + Su ulp AM ) lp iri P iri de A de ( + D2 AM ) Sa PA lin e co nt ro SC SCH H 2 AM l 23 33 P 39 90 A 0 (D 1 S + Su ulp AM ) lp iri PA iri de de ( + D2 AM ) PA

0.0

Fig. 3. Relative expression (mean SEM; n = 4–6) of cGnRH-II and sGnRH mRNAs in the telencephalon of post-spawning ⁄ sexually-regressing female goldfish 5 h post-injection with either SCH 23390 or sulpiride with or without AMPA. There was no differences observed in the hypothalamus and data from the hypothalamus are not shown. Values that are not significantly different from one another are identified by the same letter. *Indicates marginal significance (P = 0.05) between AMPA alone and SCH 23390 + AMPA.


306


15 b

Hyp 3

2

a,b a

a

a

10 5 0 co

to

nt

1

Iso

ro

l

a

*

Sa

lin

e

Relative expression/ housekeeping gene

Serum (LH) (ng/ml)

Tel

cin

4

AM PA

(D 2)

Fig. 6. Serum luteinising hormone (LH) levels (mean SEM; n = 14) in sexually regressed female goldfish (July) determined by radioimmunoassay 5 h post-injection with 1 lg ⁄ g isotocin. *Indicates significance (P < 0.05).

+

de Su

lp

iri

Su

lp

de

iri

+

SC H

SC H

23

lin Sa

AM PA

(D 1) 39

0

AM PA

e

co

nt

ro

l

0

Fig. 4. Relative expression (mean SEM; n = 4–6) of isotocin (IST) mRNA in the telencephalon and hypothalamus of post-spawning ⁄ sexually-regressing female goldfish 5 h post-injection with either SCH 23390 or sulpiride with or without AMPA. Values that are not significantly different from one another are identified by the same letter. There were no statistical differences in IST mRNA levels in the hypothalamus.

b

15 Relative expression/ housekeeping gene

Tel Hyp b

10 B

B,C

5 A a

A,B

A,C a

A a

a PA

2)

AM

(D

+ de

iri Su

lp

iri

lp Su

+ H SC

de

AM

0 39 23

SC

H

lin Sa

PA

1) (D

PA AM

e

co

nt

ro

l

0

Fig. 5. Relative expression (mean SEM; n = 4–6) of activin ba mRNA in the telencephalon (Tel) and hypothalamus (Hyp) of post-spawning ⁄ sexuallyregressing female goldfish 5 h post-injection with either SCH 23390 or sulpiride with or without AMPA. Values that are not significantly different from one another are identified by the same letter.

Therefore, to investigate whether IST is capable of inducing LH release from the pituitary in vivo, 1 lg ⁄ g IST was injected into sexually regressed female goldfish. Figure 6 shows a significant moderate increase (167%; P = 0.022) in serum LH levels at 5 h post-injection.

Discussion Earlier experiments found that activation of glutamate receptors with NMDA had a mild stimulatory effect on LH release that was not modulated in vivo by either testosterone implantation or neurotoxin-mediated DA depletion in sexually regressed goldfish (22).

Other experiments we performed with goldfish indicated that AMPA has rapid and robust stimulatory effects on LH release (10). This information, coupled with our microarray study investigating the effects of DA agonists on gene expression in the goldfish neuroendocrine brain (15, 21), led us to test the hypothesis that DA may inhibit AMPA-dependent glutamate-mediated LH release. Consistent with this hypothesis, the present study shows for the first time that the injection of a DA D1-receptor antagonist primes post-spawning ⁄ sexually-regressing female goldfish for AMPA-stimulated LH release. Grodum et al. (23) investigated the effects of the D1 antagonist NNC 01-0687 on pituitary hormone release in human males and Vacher et al. (24) studied the effect of the D1 agonist SKF 38393 in trout. Both studies found no change in the release of pituitary LH, concluding that D1 receptors were not involved in modulating basal LH release. The results of the present study corroborate these findings, in that SCH 23390, a D1-specific receptor antagonist, alone had no effect on basal circulating LH. However, other data in the present study indicate that the DA D1 system provides an important modulatory and inhibitory effect on LH release. A combined treatment of SCH 23390 with AMPA, a glutamate agonist, increased serum LH levels in post-spawning female goldfish, a time when AMPA treatment alone was ineffective. Interestingly, in an experiment with sexually regressed female goldfish (September), AMPA treatment alone elevated serum LH levels corroborating results obtained in male goldfish at the same time of the year (10); on the other hand, blockade of D1 receptors with SCH 23390 had no further potentiating effects. The observations that DA antagonists alone do not affect serum LH levels in both experiments are not unexpected because the inhibitory DA tone on LH release is known to be lowest in sexually regressing and sexually regressed fish (4). These results also indicate that the D1 inhibitory influence on LH release, as well as the effectiveness of AMPA in stimulating LH secretion, is seasonal. Seasonal effects of neuropeptides and neurotransmitters on LH is the rule rather than the exception in the goldfish model (25–27). Goldfish and many temperate teleosts have highly seasonal reprodutive cycles. Part of this is a result of the cyclicity of circulating sex steroids and resultant feedback modulation at the level of the brain and pituitary (25, 28). Furthermore, DA levels fluctuate throughout the annual reproductive cycle of the



catfish, Heteropneustes fossilis (29), a finding not at variance with the possibility that the effect of DA antagonists may differ in different stages of the seasonal reproductive cycle. Indeed, our recent discovery of a DA D2-receptor alternative splice in the goldfish, its season-dependent expression, and its implication in maintaining the DAergic tone (30), may alter telencephalic and hypothalamic responses to DA. Although speculative, this, in turn, could alter the cellular response of neurotransmitters, such as the glutamate agonist AMPA. Further investigations into the factors mediating the seasonally variable response observed in the present study, as well as how seasonal changes in gonadal steroid levels affect DAergic tone and DA receptors, are warranted. However, it is unlikely that the potentiating effect of D1 antagonist on AMPA stimulation of LH release is the result of direct action on pituitary because specific D1 agonists or antagonists have no effect on LH release from goldfish pituitary cells in vitro, nor did they affect the response of LH release when challenged with sGnRH (31). High expression of D1 receptors in eel hypothalamus (32) and our the results of our own study indicate that actions of SCH 23390 on higher brain centres are likely. To further understand the neuroendocrine effects of DA, we also investigated the expression of other genes that are known or postulated stimulators of LH release in the goldfish (i.e. cGnRH-II, sGnRH, IST and the activins) (20). The expression of cGnRH-II mRNA levels across treatments was similar to the responses of circulating LH levels in those same treatments, whereas sGnRH remained unaffected. Canosa et al. (33) demonstrated that both sGnRH and cGnRH-II are differentially regulated during natural ovulation and spawning, and suggested that the periovulatory LH surge is primarily regulated by sGnRH, whereas cGnRH-II regulates spawning behaviour. Nevertheless, both forms of GnRH have been shown to stimulate LH release from goldfish pituitary fragments (34), and to increase circulating LH in goldfish in vivo (22, 35). In pituitary cells prepared from sexually regressed females, cGnRH-II elicits a biphasic and more prolonged (peak and plateau) LH response, whereas sGnRH elicits a monophasic response of shorter duration (peak only) (36). Both GnRHs induce biphasic responses from pituitary cells prepared from sexually recrudescing and pre-spawning females, suggesting that seasonal reproductive differences in the actions and ⁄ or involvement of the two GnRHs on LH release in this species (36). Within the gonadotroph, the signalling mechanism of each GnRH is different, particularly in the differential use of calcium stores (37). Whether sGnRH and cGnRH-II gene expression is similarly affected by DA antagonists and ⁄ or AMPA treatments at other times of the seasonal reproductive cycle as in the present experiments with post-spawning female fish needs to be examined in future studies. Notably, the expression profile for IST in the telencephalon following DA antagonists and ⁄ or AMPA treatments was also similar to treatment-induced changes in circulating LH levels in June. IST is the fish homolog to the mammalian oxytocin, and IST mRNA levels are increased during the spawining season in goldfish (27). We have already reported that IST injections can increase oestradiol levels in female goldfish (38), and that exposure to the female postovulatory sex pheromone prostaglandin F2a rapidly increases IST

307

expression in the telencephalon sexually mature male goldfish (39). AMPA has been shown to increase oxytocin release from rat hypothalamic explants (40). Furthermore, Gria3 protein is colocalised with oxytocin in rat and monkey hypothalamic magnocellular neurones (41). In fish, the magnocellular and parvocellular neurones synthesising IST are located in the preoptic area in the telencephalon and project widely in the brain and to the posterior pituitary (42). In the present study, AMPA alone was insufficient in increasing the IST mRNA levels in the telencephalon but, when fish were pre-treated with a D1-antagonist, AMPA increased IST mRNA levels substantially in the same tissue. This suggests that IST is under the dual regulatory action of DA and glutamate and this conclusion is supported by the statistically significant interaction of these treatments. The modulation of IST mRNA levels in the present study is particularly relevant because we show that IST injection induces a rapid and moderate increase in circulating LH levels in vivo. In rats, an additive effect of oxytocin and GnRH on LH release has been demonstrated (43). Thus, the results of the present study suggest that LH release may be under the stimulatory action of IST, mediated through the stimulatory control of glutamate, acting through the AMPA receptor, and the inhibitory control of DA, acting through the D1 receptor. Activin ba mRNA levels were significantly increased in SCH 23390-treated fish, with or without the addition of AMPA in both the hypothalamus and the telencephalon. Previous microarray analyses revealed that activin ba subunit mRNA was decreased in the hypothalamus 5 h post-injection with SKF 38393, a D1-specific agonist (21). Real-time RT-PCR confirmed this as a 5.0-fold (P = 0.049) decrease in activin ba mRNA levels (see Supporting information, Fig. S2). These two results clearly demonstrate that activin ba expression is under the regulatory control of DA acting through the D1 receptor. The activins are members of the transforming growth factor b superfamily and are homo- or heterodimeric proteins. Activin A comprises two ba subunits, whereas activin B is made up of two bb subunits and activin AB is made up of one ba and one bb subunit. Activin A is a potent stimulator of FSH from the rat pituitary in vitro (44). Activin A is also able to stimulate LH release when injected i.c.v. into the rat hypothalamus in vivo (45), as well as stimulate LH release in a dose-dependent manner from goldfish perifused pituitary fragments in vitro (46). Furthermore, activin is also capable of stimulating GnRH release in the GnRH-secreting GT1-7 mouse neuronal cell line (47). Thus, the increase in circulating LH levels observed in the present study may partly be the result of an increase in activin ba. That a large increase in activin ba mRNA levels was observed for the D1 antagonist treatment alone, with no concominant increase in LH levels, suggests that activin alone is insufficient in stimulating LH release at this time of year. Martyniuk et al. (9) showed that baclofen, a GABAB receptor agonist, but not the GABAA receptor agonist muscimol, increased activin ba mRNA expression in the goldfish in vivo. It is known that GABA and DA inhibit each other (10), although it is currently unclear as to whether it is DA or GABA, or both, that are directly affecting activin ba expression. Studies are currently underway in our laboratory to further examine neurotransmitter-regulated activin expression.


308


In the present study, the D1 antagonist SCH 23390 reduced Gria4 mRNA levels in the hypothalamus, whereas the D1 agonist SKF38393 increased hypothalamic Gria2a subunit expression as determined in a microarray analysis (15). These observations indicate that DA D1 action can increase AMPA receptor subunit expression. On the other hand, AMPA application reduced Gria2a mRNA levels in the hypothalamus. The effect of AMPA treatment alone was reversed in the presence of DA antagonists, suggesting a DAergic influence on the differential autoregulation of ionotropic glutamate receptor subunits by AMPA in this part of the brain. In situ hybridisation experiments and ⁄ or quantification of gene expression in smaller tissue preparations containing discrete hypothalamic ⁄ telecephalonic regions would be needed in the future to precisely evaluate the influence of DA and ⁄ or AMPA on Gria subunits mRNA levels in specific hypothalamic nuclei. Taken together, the results reported in the present study suggest that blockage of the D1 receptor primes the goldfish for AMPA-stimulated LH release. The exact mechanism of action is currently unknown, although it is speculated to be through an increase in activin ba initiated by blockage of D1 receptors in conjunction with modulation of the AMPA receptors, which primes the fish brain for glutamate-stimulated induction of cGnRH-II and IST and the subsequent release of LH from the pituitary. It is recognised that this hypothesis requires further testing because we are only able to quantify levels of mRNA at this time. It will be necessary to quantify specific peptide and protein levels in the brain. Future studies aiming to investigatate the seasonality and mechanism of action of the DA D1-mediated response observed in the present study may provide further insights into the central regulation of reproduction.

5

6

7

8

9

10

11

12

13

Acknowledgements This work was supported by OGS (J.T.P.), the Parkinson’s Research Consortium of Ottawa (J.T.P., V.L.T.) and NSERC (J.P.C., V.L.T.). The authors would like to thank Bill Fletcher and the University of Ottawa Animal Care and Veterinary services. The authors declare that they have no conflicts of interest.

Received 20 November 2009, revised 22 December 2010, accepted 23 January 2011

14

15

16

17

References 1 Dufour S, Weltzien FA, Sebert ME, N LEB, Vidal B, Vernier P, Pasqualini C. Dopaminergic inhibition of reproduction in teleost fishes: ecophysiological and evolutionary implications. Ann NY Acad Sci 2005; 1040: 9– 21. 2 Yu KL, Peter RE. Adrenergic and dopaminergic regulation of gonadotropin-releasing hormone release from goldfish preoptic-anterior hypothalamus and pituitary in vitro. Gen Comp Endocrinol 1992; 85: 138–146. 3 Omeljaniuk RJ, Shih SH, Peter RE. In-vivo evaluation of dopamine receptor-mediated inhibition of gonadotrophin secretion from the pituitary gland of the goldfish, Carassius auratus. J Endocrinol 1987; 114: 449– 458. 4 Peter RE, Chang JP, Nahorniak CS, Omeljaniuk RJ, Sokolowska M, Shih SH, Billard R. Interactions of catecholamines and GnRH in regulation of

18 19 20 21

22

gonadotropin secretion in teleost fish. Recent Prog Horm Res 1986; 42: 513–548. Levavi-Sivan B, Safarian H, Rosenfeld H, Elizur A, Avitan A. Regulation of gonadotropin-releasing hormone (GnRH)-receptor gene expression in tilapia: effect of GnRH and dopamine. Biol Reprod 2004; 70: 1545– 1551. Kumakura N, Okuzawa K, Gen K, Kagawa H. Effects of gonadotropinreleasing hormone agonist and dopamine antagonist on hypothalamuspituitary-gonadal axis of pre-pubertal female red seabream (Pagrus major). Gen Comp Endocrinol 2003; 131: 264–273. Hibbert B, Fung I, McAuley R, Lariviere K, MacNeil B, Bafi-Yeboa N, Livesey J, Trudeau V. Increased GAD67 mRNA levels are correlated with in vivo GABA synthesis in the MPTP-treated catecholamine-depleted goldfish brain. Mol Brain Res 2004; 128: 121–130. Hibbert B, Fung I, McAuley R, Samia M, Trudeau V. Catecholamine depletion modulates serum LH levels, GAD67 mRNA, and GABA synthesis in the goldfish. Gen Comp Endocrinol 2005; 140: 176–183. Martyniuk CJ, Chang JP, Trudeau VL. The effects of GABA agonists on glutamic acid decarboxylase, GABA-transaminase, activin, salmon gonadotrophin-releasing hormone and tyrosine hydroxylase mRNA in the goldfish (Carassius auratus) neuroendocrine brain. J Neuroendocrinol 2007; 19: 390–396. Trudeau VL, Spanswick D, Fraser EJ, Lariviere K, Crump D, Chiu S, MacMillan M, Schulz RW. The role of amino acid neurotransmitters in the regulation of pituitary gonadotropin release in fish. Biochem Cell Biol 2000; 78: 241–259. Meyer A, Schartl M. Gene and genome duplications in vertebrates: the one-to-four (-to-eight in fish) rule and the evolution of novel gene functions. Curr Opin Cell Biol 1999; 11: 699–704. Hoppmann V, Wu JJ, Soviknes AM, Helvik JV, Becker TS. Expression of the eight AMPA receptor subunit genes in the developing central nervous system and sensory organs of zebrafish. Dev Dyn 2008; 237: 788– 799. Bailey JD, Centers A, Jennes L. Expression of AMPA receptor subunits (GluR1-GluR4) in gonadotrophin-releasing hormone neurones of young and middle-aged persistently oestrous rats during the steroid-induced luteinising hormone surge. J Neuroendocrinol 2006; 18: 1–12. Garyfallou VT, Lemos D, Urbanski HF. Expression profiling of genes encoding glutamate and GABA receptor subunits in three immortalized GnRH cell lines. Brain Res 2006; 1086: 50–54. Popesku JT, Martyniuk CJ, Denslow ND, Trudeau VL. Rapid dopaminergic modulation of the fish hypothalamic transcriptome and proteome. PLoS ONE 2010; 5: e12338. Yu KL, Rosenblum PM, Peter RE. In vitro release of gonadotropinreleasing hormone from the brain preoptic-anterior hypothalamic region and pituitary of female goldfish. Gen Comp Endocrinol 1991; 81: 256–267. Peter RE, Nahorniak CS, Chang JP, Crim LW. Gonadotropin release from the pars distalis of goldfish, Carassius auratus, transplanted beside the brain or into the brain ventricles: additional evidence for gonadotropinrelease-inhibitory factor. Gen Comp Endocrinol 1984; 55: 337–346. Zhao E, Basak A, Trudeau VL. Secretoneurin stimulates goldfish pituitary luteinizing hormone production. Neuropeptides 2006; 40: 275–282. Fleige S, Pfaffl MW. RNA integrity and the effect on the real-time qRTPCR performance. Mol Aspects Med 2006; 27: 126–139. Zohar Y, Munoz-Cueto JA, Elizur A, Kah O. Neuroendocrinology of reproduction in teleost fish. Gen Comp Endocrinol 2010; 165: 438–455. Popesku JT, Martyniuk CJ, Mennigen J, Xiong H, Zhang D, Xia X, Cossins AR, Trudeau VL. The goldfish (Carassius auratus) as a model for neuroendocrine signaling. Mol Cell Endocrinol 2008; 293: 43–56. Trudeau VL, Sloley BD, Peter RE. Testosterone enhances GABA and taurine but not N-methyl-D,L-aspartate stimulation of gonadotropin



23

24

25

26

27

28

29

30

31

32

33

34

35

36

37

secretion in the goldfish: possible sex steroid feedback mechanisms. J Neuroendocrinol 1993; 5: 129–136. Grodum E, Andersen M, Hangaard J, Koldkjaer O, Hagen C. Lack of effect of the dopamine D1 antagonist, NNC 01-0687, on unstimulated and stimulated release of anterior pituitary hormones in males. J Endocrinol Invest 1998; 21: 291–297. Vacher C, Mananos EL, Breton B, Marmignon MH, Saligaut C. Modulation of pituitary dopamine D1 or D2 receptors and secretion of follicle stimulating hormone and luteinizing hormone during the annual reproductive cycle of female rainbow trout. J Neuroendocrinol 2000; 12: 1219–1226. Sohn YC, Yoshiura Y, Kobayashi M, Aida K. Seasonal changes in mRNA levels of gonadotropin and thyrotropin subunits in the goldfish, Carassius auratus. Gen Comp Endocrinol 1999; 113: 436–444. Sokolowska M, Peter RE, Nahorniak CS, Chang JP. Seasonal effects of pimozide and des Gly10 [D-Ala6] LH-RH ethylamide on gonadotrophin secretion in goldfish. Gen Comp Endocrinol 1985; 57: 472–479. Zhang D, Xiong H, Mennigen JA, Popesku JT, Marlatt VL, Martyniuk CJ, Crump K, Cossins AR, Xia X, Trudeau VL. Defining global neuroendocrine gene expression patterns associated with reproductive seasonality in fish. PLoS ONE 2009; 4: e5816. Kobayashi M, Aida K, Hanyu I. Annual changes in plasma levels of gonadotropin and steroid hormones in goldfish. Bull Jpn Soc Sci Fish 1986; 52: 1153–1158. Senthilkumaran B, Joy KP. Changes in hypothalamic catecholamines, dopamine-b-hydroxylase, and phenylethanolamine-N-methyltransferase in the catfish Heteropneustes fossilis in relation to season, raised photoperiod and temperature, ovariectomy, and estradiol-17b replacement. Gen Comp Endocrinol 1995; 97: 121–134. Popesku JT, Navarro-Martıń L, Trudeau VL. Evidence for alternative splicing of a dopamine D2 receptor in a teleost. Physiol Biochem Zool 2011 in press (URL: http://www.jstor.org/stable/10.1086/658290). Chang JP, Yu KL, Wong AO, Peter RE. Differential actions of dopamine receptor subtypes on gonadotropin and growth hormone release in vitro in goldfish. Neuroendocrinology 1990; 51: 664–674. Kapsimali M, Vidal B, Gonzalez A, Dufour S, Vernier P. Distribution of the mRNA encoding the four dopamine D(1) receptor subtypes in the brain of the european eel (Anguilla anguilla): comparative approach to the function of D(1) receptors in vertebrates. J Comp Neurol 2000; 419: 320–343. Canosa LF, Stacey N, Peter RE. Changes in brain mRNA levels of gonadotropin-releasing hormone, pituitary adenylate cyclase activating polypeptide, and somatostatin during ovulatory luteinizing hormone and growth hormone surges in goldfish. Am J Physiol Regul Integr Comp Physiol 2008; 295: R1815–R1821. Lovejoy DA, Corrigan AZ, Nahorniak CS, Perrin MH, Porter J, Kaiser R, Miller C, Pantoja D, Craig AG, Peter RE, Vale WW, Rivier JE, Sherwood NM. Structural modifications of non-mammalian gonadotropin-releasing hormone (GnRH) isoforms: design of novel GnRH analogues. Regul Pept 1995; 60: 99–115. Peter RE, Nahorniak CS, Sokolowska M, Chang JP, Rivier JE, Vale WW, King JA, Millar RP. Structure-activity relationships of mammalian, chicken, and salmon gonadotropin releasing hormones in vivo in goldfish. Gen Comp Endocrinol 1985; 58: 231–242. Lo A, Chang JP. In vitro application of testosterone potentiates gonadotropin-releasing hormone-stimulated gonadotropin-II secretion from cultured goldfish pituitary cells. Gen Comp Endocrinol 1998; 111: 334–346. Chang JP, Johnson JD, Sawisky GR, Grey CL, Mitchell G, Booth M, Volk MM, Parks SK, Thompson E, Goss GG, Klausen C, Habibi HR. Signal transduction in multifactorial neuroendocrine control of gonadotropin secretion and synthesis in teleosts-studies on the goldfish model. Gen Comp Endocrinol 2009; 161: 42–52.

309

38 Mennigen JA, Martyniuk CJ, Crump K, Xiong H, Zhao E, Popesku J, Anisman H, Cossins AR, Xia X, Trudeau VL. Effects of fluoxetine on the reproductive axis of female goldfish (Carassius auratus). Physiol Genomics 2008; 35: 273–282. 39 Mennigen JA, Lado WE, Zamora JM, Duarte-Guterman P, Langlois VS, Metcalfe CD, Chang JP, Moon TW, Trudeau VL. Waterborne fluoxetine disrupts the reproductive axis in sexually mature male goldfish, Carassius auratus. Aquat Toxicol 2010; 100: 354–364. 40 Pampillo M, del Carmen Diaz M, Duvilanski BH, Rettori V, Seilicovich A, Lasaga M. Differential effects of glutamate agonists and D-aspartate on oxytocin release from hypothalamus and posterior pituitary of male rats. Endocrine 2001; 15: 309–315. 41 Ginsberg SD, Price DL, Blackstone CD, Huganir RL, Martin LJ. The AMPA glutamate receptor GluR3 is enriched in oxytocinergic magnocellular neurons and is localized at synapses. Neuroscience 1995; 65: 563–575. 42 Saito D, Komatsuda M, Urano A. Functional organization of preoptic vasotocin and isotocin neurons in the brain of rainbow trout: central and neurohypophysial projections of single neurons. Neuroscience 2004; 124: 973–984. 43 Evans JJ, Hurd SJ, Mason DR. Oxytocin modulates the luteinizing hormone response of the rat anterior pituitary to gonadotrophin-releasing hormone in vitro. J Endocrinol 1995; 145: 113–119. 44 Vale W, Rivier J, Vaughan J, McClintock R, Corrigan A, Woo W, Karr D, Spiess J. Purification and characterization of an FSH releasing protein from porcine ovarian follicular fluid. Nature 1986; 321: 776–779. 45 MacConell LA, Widger AE, Barth-Hall S, Roberts VJ. Expression of activin and follistatin in the rat hypothalamus: anatomical association with gonadotropin-releasing hormone neurons and possible role of central activin in the regulation of luteinizing hormone release. Endocrine 1998; 9: 233–241. 46 Ge W, Chang JP, Peter RE, Vaughan J, Rivier J, Vale W. Effects of porcine follicular fluid, inhibin-A, and activin-A on goldfish gonadotropin release in vitro. Endocrinology 1992; 131: 1922–1929. 47 Gonzalez-Manchon C, Bilezikjian LM, Corrigan AZ, Mellon PL, Vale W. Activin-A modulates gonadotropin-releasing hormone secretion from a gonadotropin-releasing hormone-secreting neuronal cell line. Neuroendocrinology 1991; 54: 373–377. 48 Hoskins LJ, Xu M, Volkoff H. Interactions between gonadotropin-releasing hormone (GnRH) and orexin in the regulation of feeding and reproduction in goldfish (Carassius auratus). Horm Behav 2008; 54: 379–385.

Supporting Information The following supplementary material is available: Fig. S1. Relative expression (mean SEM; n = 4–6) of Gria2a and Gria4 in the telencephalon of post-spawning ⁄ sexually-regressing female goldfish 5 h post-injection with either SCH 23390 or sulpiride with or without AMPA. Fig. S2. Activin ba steady-state mRNA levels in the hypothalamus of female goldfish (n = 5 each) 5 h post-injection with SKF 38393, a selective D1-receptor agonist. This supplementary material can be found in the online article. Please note: Wiley-Blackwell is not responsible for the content or functionality of any supplementary material supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article.
