Dopamine D3 receptor stimulation promotes the proliferation of cells ...

Journal of Neurochemistry, 2004, 91, 1292–1301

doi:10.1111/j.1471-4159.2004.02823.x

Dopamine D3 receptor stimulation promotes the proliferation of cells derived from the post-natal subventricular zone V. Coronas,* K. Bantubungi, J. Fombonne,à S. Krantic,à S. N. Schiffmann and M. Roger* *CNRS-UMR 6187, Universite´ de Poitiers, France Faculte´ de Me´decine, Laboratoire de Neurophysiologie, Universite´ Libre, Bruxelles, Belgium àCNRS-UMR 6544, Faculte´ de Me´decine Nord, Marseille, France

Abstract In the adult mammalian brain, neural stem cells persist in the subventricular zone (SVZ) where dopamine D3 receptors are expressed. Here, we demonstrate that addition of 1 lM apomorphine increases cell numbers in post-natal SVZ cell cultures. This effect was prevented by a co-treatment with haloperidol, sulpiride or U-99194A, a D3-preferring antagonist, and mimicked by the dopamine D3 receptor selective agonist 7-hydroxy-dipropylaminotetralin (7-OH-DPAT). EC50 values were 4.04 ± 1.54 nM for apomorphine and 0.63 ± 0.13 nM for 7-OH-DPAT, which fits the pharmacological profile of the D3 receptor. D3 receptors were detected in SVZ cells by RT-PCR

and immunocytochemistry. D3 receptors were expressed in numerous b-III tubulin immunopositive cells. The fraction of apoptotic nuclei remained unchanged following apomorphine treatment, thus ruling out any possible effect on cell survival. In contrast, proliferation was increased as both the proportion of nuclei incorporating bromo-deoxyuridine and the expression of the cell division marker cyclin D1 were enhanced. These findings provide support for a regulatory role of dopamine over cellular dynamics in post-natal SVZ. Keywords: apoptosis, D3 receptor, dopamine, neural stem cells, proliferation, rat, subventricular zone. J. Neurochem. (2004) 91, 1292–1301.

In the adult mammalian brain, stem cells persist in the subventricular zone (SVZ) bordering the lateral ventricles (Garcia-Verdugo et al. 1998; Seaberg and van der Kooy 2002; Marshall et al. 2003). Within their neurogenic niche, SVZ neural stem cells proliferate and generate progenitors committed to neural or glial fates. Glial progenitors widely disperse into the white matter of diverse brain regions (Levison and Goldman 1993; Marshall et al. 2003). In contrast, neuroblasts migrate along the rostral migratory stream, the unique track that guides the cells towards the olfactory bulb where they adopt their final neuronal phenotype (Luskin 1993; Lois and Alvarez-Buylla 1994; Doetsch and Alvarez-Buylla 1996). Owing to the putative use of these cells for brain repair in neurodegenerative diseases or brain traumas, increasing attention has been paid to factors capable of stimulating neurogenesis. A recent report indicates that dopamine, a neurotransmitter implicated in a variety of complex behaviours, modulates cell proliferation in the embryonic germinative zone of the lateral ganglionic eminence (Ohtani et al. 2003). In addition, dopamine receptors have been identified in the neonatal and adult SVZ (Diaz et al. 1997). The

dopamine receptor family comprises the D1-like subclass, including the D1 and D5 receptors, and the D2-like subclass, including the D2, D3 and D4 receptors (Missale et al. 1998). High levels of D3 receptor expression have been reported in the post–natal SVZ (Diaz et al. 1997). This receptor is strongly expressed during development in mitotically active zones of the neuroepithelium (Diaz et al. 1997). Following transfection in a neuroglioblastoma cell line, D3 receptors promote mitogenesis (Pilon et al. 1994; Griffon et al. 1997).

1292

Received February 20, 2004; revised manuscript received June 25, 2004; accepted August 9, 2004. Address correspondence and reprint requests to Dr Valerie Coronas, CNRS: UMR 6187, PBSA, Faculte´ des Sciences, 40, Avenue du Recteur Pineau, 86022 Poitiers Cedex, France. E-mail: [email protected] Abbreviations used: BrdU, bromo-deoxyuridine; cDNA, complementary DNA; EGF, epidermal growth factor; FITC, fluoresceine isothiocyanate; GAPDH, glyceraldehyde-3-phosphate; MEM, minimum essential medium; 7-OH-DPAT, 7-hydroxy-dipropylaminotetralin; SFM, serum-free culture medium; SVZ, subventricular zone; TUNEL, terminal transferase-mediated dUTP biotin nick end labelling.

2004 International Society for Neurochemistry, J. Neurochem. (2004) 91, 1292–1301

D3 receptors and SVZ cell proliferation 1293

In this study, we therefore examined the possible participation of D3 receptors in cell population modulation in the post-natal SVZ. One major finding was that dopaminergic agonists increase SVZ cell numbers via D3 receptors and that this effect results from enhanced mitogenesis. Our data lend support to a regulatory role of dopamine over cellular dynamics in the post-natal SVZ. Preliminary results have been published in abstract form (Coronas and Roger 2002).

Materials and methods Primary culture of SVZ cells Newborn and adult male and female Wistar rats supplied by R. Janvier (Le Genest-Saint Isles, France) were used in this study. All experiments were performed in accordance with NIH guidelines for the care and use of laboratory animals. Our SVZ cell culture technique, derived from the procedure of Weiss et al. (1996), has been described previously (Agasse et al. 2004). In short, rat brains were removed from the skull of newborn (1–3-day-old) or adult (8–12-week-old) rats killed by decapitation. The brains were placed in a dissection medium composed of Hank’s solution devoid of Ca2+/Mg2+ (Gibco, Rockville, MD, USA) and supplemented with 15 mM HEPES (Gibco), 25 mM D-glucose (Sigma, St Louis, MO, USA), 100 U/mL penicillin and 100 lg/mL streptomycin (Gibco). Fragments of the SVZ encompassing both ependymal and subependymal layers were dissected out of 500 lmthick coronal sections. The fragments were digested in 0.025% trypsin and 0.265 mM EDTA (Gibco), and dissociated by gentle trituration with a 25 gauge needle fitted to a 1 mL syringe. The resulting cell suspension was centrifuged and the pellet was resuspended in fresh serum-free culture medium (SFM) supplemented with 20 ng/mL epidermal growth factor (EGF; Gibco). For newborn cell cultures, SFM was composed of minimum essential medium (MEM; Gibco) supplemented with 15 mM HEPES (Gibco), 25 mM D-glucose (Sigma), 1 mM sodium pyruvate (Sigma), 100 U/mL penicillin)100 lg/mL streptomycin (Gibco) and 1% N2 (Gibco). For adult cell cultures, SFM was composed of neurobasal medium (Gibco) supplemented with 2 mM glutamine, 100 U/mL penicillin)100 lg/mL streptomycin (Gibco) and 1% B27 (Wachs et al. 2003). Single cells were then plated on uncoated Petri dishes at a density of 3000 cells/cm2, a value that has been previously used to obtain neurosphere colonies from single cells (Seaberg and van der Kooy 2002). The neurospheres were allowed to develop as primary neurospheres in a 95% air)5% CO2 humidified atmosphere at 37C. Ten days following plating, the primary neurospheres were dissociated as single cells that were then replated and allowed to develop as secondary neurospheres. One week after passaging, the secondary neurospheres were seeded onto glass coverslips within 24-well cell culture plates at a density of 80 neurospheres per well in 500 lL SFM supplemented with 20 ng/mL EGF. The different treatments were initiated 24 h after seeding. The effects were tested through three independent experiments, each condition being assayed in four independent wells. Cell cultures maintained in SFM without drug addition were referred to as control cultures.

In two additional experiments, the cultures were incubated for 48 h in SFM without EGF prior to starting the treatment for 1 day with 1 lM apomorphine. Dopaminergic treatments All dopaminergic agonists and antagonists were prepared as at least 10 000· stock solutions in water (apomorphine, 7-hydroxy-dipropylaminotetralin: 7-OH-DPAT, U-99194A; Sigma) or acetic acid (haloperidol, sulpiride; Sigma) and diluted to the appropriate concentrations in SFM devoid of growth factors. Viable cells were counted at various times following treatment with dopaminergic agonists and/or antagonists using the Trypan blue exclusion assay. b-III tubulin immunolabelling The effects of apomorphine on neuronal differentiation were assessed on SVZ cells treated for 1 week with or without 1 lM apomorphine. Following treatment, the preparations were fixed in 4% paraformaldehyde and treated for 10 min in 3% H2O2 in phosphate-buffered saline (PBS). The preparations were then permeabilized and blocked with a 0.1% Triton solution containing 5% horse serum (Vector Laboratories, Burlingame, CA, USA) before successive incubation in: 1/500 mouse monoclonal anti-b-III tubulin antibody (Sigma) overnight at 4C; 1/200 biotinylated horse secondary antiserum (Vector) for 1 h; and 1/100 avidin-biotinperoxidase complex (Vector) for 1 h. The preparations were revealed using the diaminobenzidine chromogen (0.025%; Sigma) intensified with 0.08% NiCl2 in 30 mM Tris-HCl (pH 7.6) buffer containing 0.003% H2O2. The preparations were then dehydrated and mounted on slides in Depex (BDH, Poole, UK). The effects were assessed through two independent experiments. Detection of D3 dopamine receptor mRNAs by RT-PCR Total mRNAs were extracted from SVZ cells, and from the striatum that was used as a positive control for D3 receptors, using the guanidine isothiocyanate-based TRIzol solution (Invitrogen, Merelbeke, Belgium). Total RNA (1 lg) preparations were treated with DNase I (Invitrogen) before reverse transcription into complementary DNA (cDNA) by Superscript II RNase H reverse transcriptase (200 U, Invitrogen) in a 20 lL reaction mixture, containing 100 ng random hexamer primers, 5 mM dNTP, 10 mM 1,4-dithiothreitol and 1 lL RNaseOUT recombinant ribonuclease inhibitor (40 U/lL), for 50 min at 42C. The reverse transcription was stopped by heating at 70C for 15 min. D3 receptor mRNAs were then detected by amplification of 2 lL cDNA in a 25 lL reaction volume in Qiagen (Valencia, CA, USA) PCR buffer containing 400 lM dNTP, 200 nM primers (see Table 1) and 0.5 lL Taq polymerase (5 U/lL). These mRNAs were amplified together with glyceraldehyde-3-phosphate (GAPDH) primers (Table 1). After initial denaturation at 95C for 4 min, amplification was carried out for 40 cycles at the following temperatures: denaturation at 95C for 1 min; annealing at 60C for 1 min; extension at 72C for 1 min. The last cycle reaction was ended by incubation at 72C for 7 min. The reaction was performed on a BioRad (Hercules, CA, USA) Gene Cycler PCR apparatus. The PCR products were fractionated by 1.2% agarose gel electrophoresis. The gels were then ethidium bromide-stained and photographed with a UV transilluminator equipped with CCD camera and thermic


1294 V. Coronas et al.

Primers Dopamine D3 receptor GAPDH

Primer position

Sequences Sense Antisense Sense Antisense

5¢-ATGCATCAGTATCAGACCTGGC-3¢ 772–792 5¢-ATGCTGTAGTAGCGCTTCAGCC-3¢ 974–995 5¢-TCCACCACCCTGTTGCTGTA-3¢ 596–615 5¢-ACCACAGTCCATGCCATCAC-3¢ 1028–1047

printer. The expected sizes of D3 receptor and GAPDH were 200 bp and 450 bp, respectively. Detection of D3 dopamine receptors by immunocytochemistry The cultures were fixed in 4% paraformaldehyde. The preparations were permeabilized in 0.5% Triton for 20 min. Non-specific binding sites were blocked in 1% bovine serum albumin in PBS containing 0.1% Triton before incubation in 1/100 rabbit polyclonal anti-rat dopamine D3 receptor antibody (Chemicon, Temecula, CA, USA) for 36 h at 4C. The preparations were then revealed by a 2 h incubation in 1/200 goat secondary antiserum coupled to Alexa fluor 488 (Molecular Probes, Eugene, OR, USA) and cell nuclei were visualized using 1/1000 TOPRO-3 (Molecular Probes). The preparations were mounted in Vectashield mounting medium (Vector). Co-immunolabelling of D3 dopamine receptors with nestin or b-III tubulin was performed by incubating the preparations with the dopamine D3 receptor antibody (as above) and 1/500 monoclonal mouse anti-b-III tubulin (Sigma), or 1/500 monoclonal mouse anti-nestin (generous gift from Drs NGuyen and McKay, NIH, USA). The preparations were then revealed by a 2 h incubation in a solution containing 1/200 goat secondary antirabbit serum coupled to Alexa fluor 488, 1/200 goat secondary anti-mouse serum coupled to Alexa fluor 568 (Molecular Probes) and 1/1000 TOPRO-3. Co-immunolabelling of D3 dopamine receptors with GFAP was performed by immunostaining the preparations for D3 receptors and successively incubating in 1/100 polyclonal rabbit anti-GFAP (Dako, Copenhagen, Denmark) for 1 h and in 1/200 biotinylated goat secondary anti-rabbit serum (Vector) for 1 h 30 min. The preparations were revealed by a 1 h incubation in 1/100 avidin neutralite rhodamine (Molecular Probes) and 1/1000 TOPRO-3. Apoptosis detection SVZ cell cultures were treated with 1 lM apomorphine for 0, 1, 2 or 3 days. The effects on apoptosis were examined by terminal transferase-mediated dUTP biotin nick end labelling (TUNEL). Following treatment, the SVZ cell cultures were fixed for 1 h in 4% paraformaldehyde, permeabilized for 30 min in 0.25% Triton X-100 in PBS, treated for 10 min in 2% H2O2 in PBS, and reacted for terminal transferase (0.25 U/lL, Boehringer, Mannheim, Germany) biotinylated dUTP (6 lM, Boehringer) nick end labelling of fragmented DNA in terminal deoxynucleotidyl transferase (TdT) buffer (pH 7.5) during 1 h 30 min at 37C in a humidified chamber. The enzymatic reaction was stopped by a 15 min rinse in 300 mM NaCl)30 mM sodium citrate buffer. Following a 10 min incubation in 2% bovine serum albumin, dUTP added to DNA was revealed by avidin-biotin coupled to peroxidase, using the diaminobenzidine chromogen, and mounted on slides as above.

Accession number

Table 1 PCR primers for D3 receptor detection

NM_017140 BC059110.1

BrdU incorporation assay Proliferation was evaluated through bromo-deoxyuridine (BrdU) incorporation in nuclei during the S phase of the cell cycle. For this purpose, SVZ cells were treated for 1, 2, 3 or 7 days with (Apo) or without (Control) 1 lM apomorphine and then maintained for a further 4 h with 10 lM BrdU. At D0, the cultures were treated for 4 h with 10 lM BrdU and with (Apo) or without (Control) 1 lM apomorphine. The possible effect of D3 receptors on cell proliferation was assessed in three additional experiments. SVZ cells were treated for 1 day with 100 nM apomorphine or 10 nM 7-OH-DPAT and maintained for a further 4 h with 10 lM BrdU. Following completion of the treatment, the cultures were fixed in 4% paraformaldehyde and processed for BrdU immunocytochemistry. Briefly, BrdU was unmasked by successive incubations in 0.5% Triton X-100, 0.125 mg/mL pepsin in 0.1 M HCl, ice-cold 0.1 M and then 2 M HCl at 40C. Following neutralization in pH 8.3 borate buffer, non-specific binding sites were blocked. The preparations were successively incubated in 1/100 rat monoclonal anti-BrdU antibody (Harlan Sera-Laboratory, Loughborough, UK) at 4C overnight, 1/200 biotinylated rabbit secondary antiserum (Vector) for 1 h 30 min, and 1/100 avidin-biotin-peroxidase complex (Vector) for 30 min. The preparations were then revealed using the diaminobenzidine chromogen and mounted as above. Cultures processed without the primary antibody or without addition of BrdU to the culture medium were devoid of labelling, which indicated absence of non-specific labelling. Real-time PCR of cyclin D1 mRNA Cyclin D1 expression was assessed on SVZ cells that had been treated (apo) or not (control) with 1 lM apomorphine for 0, 4, 8, 18 or 24 h. For this purpose, total RNAs were extracted from the various cultures using the kit Rneasy Mini (Qiagen, Courtaboeuf, France). For RT-PCR, 1 lg total RNA was reverse transcribed to cDNA in 20 lL reaction mixture containing 5 lM random hexamer primers, 500 lM dNTP, 10 mM 1,4-dithiothreitol and 10 U/mL Moloney murine leukaemia virus (MML-V) reverse transcriptase in 20 mM Tris-HCl buffer for 60 min at 37C, followed by heating at 100C for 5 min. Cyclin D1 mRNAs were quantified by real-time PCR (Taq Man) using 2· SYBER green PCR Master Mix (PE Applied Biosystems, Courtaboeuf, France). Amplification of cDNA corresponding to 50 ng total RNA was performed in a 25 lL reaction volume with buffer consisting of SYBER Green-I Dye, AmpliTaq Gold DNA polymerase, and dNTPS with dUTP. Cyclin D1 and GAPDH primers (Table 2) were used in 300 nM and 150 nM concentrations, respectively. The initial two steps of PCR consisted of heating to 50C for 2 min and then to 95C for 10 min, followed by 40 reiterations of a two-step PCR cycle (denaturation at 95C for 20 s and annealing/extension at 60C for 30 s). The reaction was performed



Table 2 PCR primers for cyclin D1 quantification

Primers Cyclin D1 GAPDH

Sense Antisense Sense Antisense

on an ABI Prism 7700 Sequence Detection System (SDS). For the purpose of data quantification, cyclin D1 and GAPDH transcripts were co-amplified in the same PCR. The cyclin D1 and GAPDH mRNA levels were determined from standard curves (50 ng, 10 ng, 2 ng, 0.4 ng cDNA corresponding to a mix of all unknown cDNA samples in a final reaction volume of 25 lL). Cyclin D1 mRNA levels were then normalized over GAPDH mRNA levels for all samples. Samples were derived from eight independent cultures at 4 and 24 h, and from three independent experiments at 8 and 18 h. Data analysis and statistics Cell culture micrographs were obtained using a DMIL inverted microscope (Leica, Wetzlar, Germany) coupled to a digital Olympus camera (Labosi, Elancourt, France). Micrographs of BrdU- or TUNEL-labelled cells were obtained using a BX60 Olympus microscope coupled to a SPOT 2 digital camera (Diagnostic Instruments, Sterling Heights, MI, USA). Fluorescent labelling was examined with a laser scanning confocal unit (Bio-Rad MRC 1024) equipped with a 15 mW argon-krypton gas laser associated with an inverted microscope (Olympus IX70). The data were processed with the Laser Sharp 3.2 software (Bio-Rad). Alexa fluor 488 (Molecular Probes) was excited with the 488 nm blue line and emission of the dye was collected via a photomultiplier through a 522 nm band pass filter (32 nm width). Excitation and emission values for Alexa fluor 568 (Molecular Probes) and rhodamine (Molecular Probes) were 568 nm and 605 nm, and 647 nm and 680 nm for TOPRO-3. The TOPRO-3 emission light was represented in blue as conventional. Maximal resolution was obtained with an Olympus plan apo ·60 water objective lens. Optical sectioning of the specimen was driven by a Z-axis stepping motor. The surfaces occupied by SVZ cell cultures were measured using the Neurolucida system for image analysis (MicrobrightFied Inc., Colchester, VT, USA) coupled to a BX60 Olympus microscope. Cell counts were also performed using the Neurolucida system. The percentages of cells labelled with b-III tubulin, BrdU or TUNEL were obtained following tabulation of positive and negative cells in each coverslip. Under every experimental condition, 10 fields of view were examined in each coverslip at 400· magnification. As no statistical difference was found in control conditions across replicated experiments, the values for each set of three experiments were pooled for statistical analysis. Data were expressed as mean ± SEM. Statistical significance of differences was examined by one-way analysis of variance (ANOVA) followed by the posthoc Fisher’s PLSD test for multiple comparisons (Statview 5.0 software, SAS Institute, Cary, NC, USA). Statistical significance was set for p-values < 0.05.

Sequences

Primer position

Accession number

5¢ 5¢ 5¢ 5¢

2782–2799 2841–2859 1805–1823 1869–1890

D14014

GACAGACCGCGGCTCCTT 3¢ CAACGTGAATCTGGTTCCGA 3¢ GCAACAGGGTGGTGGACCT 3¢ CTCTCAGTATCCTTGCTGGGCT 3¢

AF106860

Dose curves were obtained by plotting total cell numbers versus the logarithm of dopaminergic ligand concentrations. These curves were fitted with the GraphPad Prism Software (San Diego, CA, USA) to non-linear, sigmoidal regression, which allowed EC50 values to be obtained.

Results

Apomorphine increases SVZ cell numbers SVZ cell cultures maintained for 1 week in the absence or presence of apomorphine displayed distinctive aspects according to culture conditions. As shown in Figs 1(a) and (b), neurospheres maintained with apomorphine were largely expanded compared with control. The areas occupied by the SVZ cell populations were increased by a factor of 2.9 in the presence of apomorphine (p < 0.0001). The effects of apomorphine on cell numbers were then examined (Fig. 1c). In control conditions, a substantial increase in cell numbers was found from day (D) 0 to D1, which likely resulted from the persistence of the effects of EGF being withdrawn immediately before starting the treatments. Indeed, when cultures were deprived of EGF for 48 h before the treatments, cell numbers no longer increased between D0 (74 075 ± 2061 cells) and D1 (76 631 ± 4809 cells). On the following days, cell numbers remained steady (Fig. 1c). No statistical difference in cell numbers was found at D0 between control and apomorphine conditions but, from D1 onwards, cell numbers were significantly higher in the apomorphine culture (Fig. 1c). At D7, SVZ cultures maintained with apomorphine contained about 50% more cells than control cultures. When the cells were deprived of EGF 48 h before the treatments, apomorphine still increased cell numbers significantly (p < 0.001) at D1 (104 335 ± 6645 cells) compared with control. Effects of apomorphine on neuronal differentiation The possible effect of apomorphine on neuronal differentiation was assessed by counting b-III tubulin immunoreactive cells. Our data indicate that following 1 week of treatment with 1 lM apomorphine, the proportion of b-III tubulin immunolabelled cells increased significantly (p ¼ 0.015) in the cultures (14.5 ± 1.2%) compared with the control (10.7 ± 0.6). This finding therefore indicates that



Fig. 1 (a, b) Aspects of SVZ cell cultures maintained for 7 days in the absence (a) or presence (b) of 1 lM apomorphine. Scale bar: 100 lm. (c) Time-course of the effects of apomorphine on SVZ cell numbers. The cultures were maintained for 1, 2, 3, 4 or 7 days with (Apo) or without (Control) 1 lM apomorphine. Means ± SEM of three independent experiments. Statistical differences from control at each timepoint: *p ¼ 0.02; ***p < 0.0001.

apomorphine not only expands SVZ cell numbers but also slightly favours neuronal differentiation in the cultures. Pharmacological aspects of apomorphine-induced effects An involvement of dopaminergic receptors in the growthpromoting effect of apomorphine was confirmed following co-treatment of SVZ cell cultures with apomorphine and haloperidol, a dopaminergic antagonist. As shown in Fig. 2(a), the apomorphine-induced increase in cell number was prevented by co-treatment with 1 lM haloperidol, whereas haloperidol by itself did not exert any effect. The possible involvement of D3 receptors in these apomorphine-induced effects was then examined. We determined the half-maximal effects (EC50) of apomorphine and 7-OH-DPAT, a D3-preferring agonist, on the increase in cell number (Fig. 2b). Both apomorphine and 7-OH-DPAT induced a dosedependent increase in SVZ cell numbers. Half-maximal

Fig. 2 Pharmacology of apomorphine effects on SVZ cultures. (a) Variations in cell numbers, expressed as percentages of control, following treatment for 7 days with 1 lM apomorphine (Apo), 1 lM haloperidol (Halo), or co-treatment with 1 lM apomorphine and 1 lM haloperidol (Apo + Halo). (b) Variations in cell numbers in SVZ cultures maintained for 7 days in the presence of increasing concentrations of apomorphine (Apo) or 7-OH-DPAT (DPAT). (c) Variations in cell numbers following 7 days of treatment with 1 lM apomorphine (Apo), 1 lM sulpiride (Sulp), 1 lM U-99194A (U-99), or co-treatment with 1 lM apomorphine and 1 lM sulpiride (Apo + Sulp), or 1 lM apomorphine and 1 lM U-99194A (Apo + U-99). Means ± SEM of three independent experiments. Statistical differences from control: ***p < 0.0001.

effects (EC50) were obtained with 4.04 ± 1.54 nM apomorphine and 0.63 ± 0.13 nM 7-OH-DPAT. To further strengthen the demonstration of an involvement of D3 receptors, SVZ cell cultures were co-treated with apomorphine and sulpiride, a D2-like antagonist (Missale et al. 1998), or U-99194A, a D3-preferring antagonist (LaHoste et al. 2000). As shown in Fig. 2(c), the increase in SVZ cell numbers induced by apomorphine was prevented by co-treatment with either 1 lM sulpiride or 1 lM U99194A, whereas neither antagonist alone exerted an effect. Evidence of D3 receptors in SVZ cell cultures The expression of D3 dopamine receptors in SVZ cell cultures was then examined by RT-PCR analysis and immunohistochemistry.



(a)

(b)

Fig. 3 (a) RT-PCR of D3 dopamine receptor mRNAs in SVZ cells (lane 2) and striatum (lane 3). PCR products were co-electrophoresed with a standard DNA ladder (lane 1) or with a control PCR performed without mRNAs (water, lane 4). (b) RT-PCR of GAPDH used as an internal control.

thereby confirming the gene expression of this receptor subtype in these cells. Following immunocytochemical treatment of the SVZ cultures, D3 dopamine receptors were systematically detected within the neurospheres. Representative confocal illustration of D3 receptor immunolabelling is provided in Fig. 4(a–e). Numerous cells were immunopositive. At higher magnification, D3 receptor immunoreactivity was particularly obvious in cell processes (Fig. 4f). Many of these D3 receptor immunoreactive cells were also immunopositive for nestin, a marker of immature cells (Fig. 4g). However, not all nestinpositive cells co-expressed D3 receptors (Fig. 4h). Numerous D3 receptor-immunolabelled cells co-expressed b-III tubulin, a marker of cells engaged in the neuronal lineage (Figs 4i and 4k). However, these two antibodies also labelled separate populations of cells (Fig. 4j). In contrast, only a few D3 immunoreactive cells were immunostained with GFAP, a glial cell marker (Fig. 4l). These data indicate that D3 receptors are present on immature cells as well as on cells engaged in the neural lineage.

For RT-PCR analysis, the adult striatum was used as a positive control. As illustrated in Fig. 3, D3 receptor mRNAs were detected in both SVZ cells and striatum extracts,

Cellular mechanisms underlying apomorphine growth-promoting effects The apomorphine-induced increase in SVZ cell numbers could result from inhibition of cell death and/or promotion of

Fig. 4 Immunocytochemical detection of D3 dopamine receptors in SVZ cell cultures.The cultures were incubated with TOPRO-3 (blue) to label cell nuclei, anti-D3 dopamine receptor antibody (green fluorescence), and with either anti-nestin (g–h), anti-b-III tubulin (i–k) or antiGFAP (l) antibodies (red fluorescence). (a–e) A series of confocal sections through a neurosphere reveals numerous D3 receptor-positive cells. (f) At higher magnification, D3 receptor immunoreactivity is

primarily found on cell processes. (g) co-expression of nestin and D3 dopamine receptors. (h) A number of nestin-positive cells do not coexpress D3 receptors. (i, k) Numerous cells located in the periphery of the neurosphere co-express b-III tubulin and D3 receptors. (j) Coexpression of these two markers is, however, not systematic. (l) Very few GFAP immunoreactive cells co-express D3 receptors (arrowhead).Scale bar: a–e, g–j, l: 40 lm; f: 20 lm; k: 15 lm.



(a) (a)

(b) (b) Fig. 5 (a) Representative photomicrograph of a TUNEL-stained culture maintained for 2 days in the control condition. Apoptotic nuclei appear as darkly-stained, shrunken or fragmented nuclei. Scale bar: 100 lm. (b) Percentages of apoptotic nuclei in SVZ cultures maintained for 0, 1, 2 or 3 days with (Apo) or without (Control) 1 lM apomorphine. Means ± SEM of two independent experiments.

cell proliferation. Therefore, a TUNEL assay was first performed to label apoptotic cells in the SVZ cultures (Fig. 5a). Addition of apomorphine did not return significant modifications in the proportion of apoptotic nuclei at any time tested (Fig. 5b), thus precluding a possible effect of apomorphine on cell death. Similar increases in the proportion of apoptotic nuclei were found between day 0 and day 1 under control and apomorphine conditions, which likely resulted from EGF removal as noted in previous studies dealing with various cellular models (Loo et al. 1998; Danielsen and Maihle 2002). Cell proliferation was then investigated through application of BrdU at various time-points following apomorphine addition. In the control condition, the percentage of BrdUpositive nuclei was maintained in the range of 8–12% from D1 to D3 (Fig. 6c). Proliferation had decreased to 3% at D7, the consequence of which was probably not yet apparent on the total cell numbers at this time-point (Fig. 1). As indicated by Figs 6(a) and 6(b), apomorphine-treated cultures contained more immunolabelled nuclei than the control ones. The effects of apomorphine were quantified by tabulating immunopositive and immunonegative nuclei (Fig. 6c). No

(c) Fig. 6 (a, b) Representative micrographs of BrdU-immunolabelled nuclei in SVZ cell cultures maintained for 1 day with (b) or without (a) 1 lM apomorphine. BrdU was added during the last 4 h of the coculture. Scale bar: 100 lm. (c) Percentages of BrdU-immunostained nuclei in SVZ cultures maintained for 0, 1, 2, 3 or 7 days with (Apo) or without (Control) 1 lM apomorphine. Means ± SEM of three independent experiments. Statistical differences from control at each timepoint: **p ¼ 0.0003; ***p < 0.0001.

statistical difference in the proportion of BrdU-labelled nuclei was found on D0 between the two experimental conditions. On D1, the proportion of cells incorporating BrdU was significantly increased in the apomorphine condition (p < 0.0001) compared with the control (Fig. 6c). The



magnitude of the proliferative effects induced by apomorphine was close to that previously reported in the NG108-15 cell line transfected with the dopamine D3 receptor (Pilon et al. 1994; Griffon et al. 1997). The mitogenic-promoting activity of apomorphine was maintained over the control for a few days. However, the effect declined over time and was completely lost at D7. The effects of apomorphine at a lower concentration (100 nM) and 7OH-DPAT (10 nM) were also tested on cell proliferation at D1. The proportion of BrdU-incorporating nuclei was significantly increased from 11.8 ± 0.5% in the control to 18.4 ± 0.6% in the presence of apomorphine (p < 0.0001), or to 18.5 ± 1.1% in the presence of 7-OHDPAT (p < 0.0001). Taken together, these data lend support to the participation of D3 receptors in the apomorphinetriggered proliferation. Effect of apomorphine on cyclin D1 expression Extracellular signals that stimulate mitogenesis typically act by increasing the expression of early G1-phase regulatory molecules (Sherr 1994). Cyclin D1 expression is induced by a variety of mitogenic signals in different cell types, including neuronal progenitors (Pestell et al. 1999; Kenney and Rorwitch 2000; Zhu et al. 2003). The expression of this cell-cycle molecule was therefore monitored in the present study. Our results indicate that the transcriptional induction of cyclin D1, expressed as the ratio of cyclin D1/GAPDH mRNA levels, regularly increased in the control condition from 4 to 18 h and then showed a sharp decrease between 18 and 24 h (Fig. 7). Following apomorphine treatment, the transcriptional induction of cyclin D1 was significantly larger than that seen in the control condition whatever the timepoint considered. The increase in cyclin D1 transcription

Fig. 8 Effects of apomorphine or 7-OH-DPAT on adult SVZ cultures. Variations in cell numbers, expressed as percentages of control, following treatment for 7 days with 100 nM 7-OH-DPAT (DPAT) or 1 lM apomorphine (Apo), or co-treatment with 1 lM apomorphine and 1 lM haloperidol (Apo + Halo). Means ± SEM of three independent experiments. Statistical differences from control: **p < 0.001; *p < 0.004.

induced by apomorphine was rapid as it was observed as soon as 4 h after starting the treatment. This increase was systematically present in all independent cultures examined. Effects of apomorphine and 7-OH-DPAT on adult SVZ cell cultures We then assessed whether the preceding results obtained with newborn SVZ cells also apply to adult SVZ cells. Neurospheres obtained from adult rats were maintained in the absence (control) or presence of 1 lM apomorphine or 100 nM 7-OH-DPAT for 1 week. Our results showed that apomorphine also increased cell numbers in adult SVZ cultures (Fig. 8). This effect was blocked by haloperidol and mimicked by 7-OH-DPAT. Discussion

This study provides the first evidence that post-natal SVZ cells in culture express D3 receptor mRNA and protein and that D3 receptor stimulation increases SVZ cell numbers. This effect relies on an increase in proliferation and is preceded by the induction of cyclin D1 expression.

Fig. 7 Cyclin D1 mRNA levels in SVZ cell cultures. The SVZ cultures were maintained for 4, 8, 18 or 24 h with (Apo) or without (Control) 1 lM apomorphine. Cyclin D1 mRNA expression was normalized over GAPDH mRNA level determined by co-amplification. Mean ratios of cyclin D1/GAPDH mRNA levels were calculated for each individual sample in both control and apomorphine conditions. Means ± SEM of three (at 8 and 18 h) or eight (at 4 and 24 h) independent experiments. Statistical differences from control at each time-point: *p < 0.02; **p < 0.01.

Pharmacological aspects of apomorphine growthpromoting properties In our study, apomorphine increased cell numbers in SVZ cultures. It could be proposed that apomorphine merely exerts a free radical scavenger effect (Gassen et al. 1998; Fornai et al. 2001). However, as in our experimental conditions no effect on cell death was triggered by apomorphine, the hypothesis of a neuroprotective effect is unlikely. Further, the reported neuroprotective activity of apomorphine was obtained with micromolar concentrations (Gassen et al. 1998) and was not reversed by the dopaminergic receptor



antagonist, haloperidol (Fornai et al. 2001). In the present study, the increase in cell number occurred within the range of nano to micromolar concentrations, and haloperidol did reverse the growth-promoting effect of apomorphine, which argues in favour of a dopamine receptor-dependant stimulation of cell proliferation. We also provide further evidence that the stimulation obtained with dopaminergic agonists displayed pharmacological characteristics that correspond to D3 receptor properties. Indeed, the only dopamine receptors that present a high affinity for 7-OH-DPAT are the D2 and D3 receptors. D3 receptors display a nanomolar affinity for 7-OH-DPAT but the affinity for apomorphine is lower. The reverse situation is observed for D2 receptors (Levesque et al. 1992; Missale et al. 1998). In our study, therefore, half-maximal effect values nicely fit the pharmacological profile of D3 receptors. In addition, apomorphine effects were prevented by sulpiride, a D2-like antagonist (Missale et al. 1998) or U-99194A, a D3 selective antagonist (LaHoste et al. 2000). Further, D3 receptor mRNAs were present in our SVZ cell cultures, a finding that is in line with previous in vivo studies (Diaz et al. 1997). Finally, D3 receptors were also identified in our cultures using immunocytochemistry, an observation which is in agreement with a preliminary report on the in vivo detection of D3 receptor protein in the SVZ (Baker et al. 2004). Collectively, our findings provide strong evidence for the participation of D3 receptors in the increase in cell numbers in SVZ cell cultures. Apomorphine-triggered cell proliferation The apomorphine-induced increase in cell numbers in the SVZ cultures was accompanied by an increase in the proportion of nuclei incorporating BrdU during the S phase of the cell cycle, which is a commonly used index for the evaluation of cell proliferation (Luskin et al. 1997; CooperKuhn and Kuhn 2002; Ohtani et al. 2003). The stimulation of proliferation by apomorphine was most pronounced on the first days of the treatment. This effect was no longer present after 7 days, probably due to D3 receptor down-regulation, as has been reported in vivo (Chiang et al. 2003). That apomorphine exerts a mitogenic effect is further supported by the rapid increase in cyclin D1 transcripts. Indeed, cyclin D1 expression is classically considered as a mitogen sensor indicative of entry into the cell division cycle (Sherr 1994). As expected, following apomorphine treatment, the increase in cyclin D1 transcription that normally occurs in the early G1 phase of the cell cycle preceded the increase in BrdU incorporation occurring during DNA synthesis in the S phase. The increase in cyclin D1 expression was observed as early as 4 h following apomorphine application. This delay is similar to that found following mitogenic stimulation in various cell types, including neuronal precursors (Pestell et al. 1999; Kenney and Rorwitch 2000). The present findings indicating a possible mitogenic role of dopamine on SVZ cell proliferation extend previous

reports on diverse effects of dopamine over mitosis. Indeed, reduction in cell proliferation was found in embryonic cortical precursors or in explants of embryonic lateral ganglionic eminence following addition of D1-like receptor agonists (Zhang and Lidow 2002; Ohtani et al. 2003). Similarly, application of D2-like receptor agonists on lactotropes hampered cell proliferation (Arita et al. 1998). In contrast, addition of D2-like receptor agonists increased mitogenesis in cell lines transfected with specific dopaminergic receptors, or in embryonic lateral ganglionic eminence explants (Chio et al. 1994; Pilon et al. 1994; Griffon et al. 1997; Ohtani et al. 2003). Interestingly, dopamine D3 receptors are maintained in the post-natal SVZ, a remnant of the embryonic neuroepithelium (Tramontin et al. 2003), and might thus exert mitogenic effects during post-natal life. Modulation of cellular dynamics in the post-natal SVZ by neurotransmitters Our findings provide evidence for a positive effect of dopamine D3 receptors on mitogenesis and neuronal differentiation in post-natal SVZ cells. Only a few studies have reported modulatory effects of neurotransmitters in the postnatal SVZ. Following inhibition of serotonin synthesis or selective lesion of serotoninergic fibres, decreased proliferation was indeed found in the SVZ of adult animals (Brezun and Daszuta 1999). More recently, several reports have indicated that systemic or intracerebral administration of 7-OH-DPAT enhances cell proliferation and neuronal differentiation in the SVZ of adult rats (Baker et al. 2004; Van Kampen et al. 2004). Further, dopaminergic depletion of the just adjacent striatum is followed by a reduction of cell proliferation in the SVZ (Baker et al. 2004). Finally, recent work in the adult mouse indicates that tyrosine-hydroxylase immunopositive fibres that densely innervate the striatum also contact the SVZ itself (Gaillard et al. 2004). In line with these findings, our in vitro study further demonstrates that D3 receptors are expressed by SVZ cells, some of which are engaged in neuronal fate. Our data also indicate that apomorphine directly increases SVZ cell numbers through D3 activation. This D3 receptor-mediated mitogenic effect is probably at the origin of the increase in SVZ cell proliferation that was observed in vivo following D3 agonists administration (Van Kampen et al. 2004). Our in vitro observations, together with previous in vivo findings, thus provide convincing evidence of a modulatory action of dopamine over cellular dynamics in the post-natal SVZ. Acknowledgements The authors thank Dr A. Cantereau for excellent assistance with confocal microscopy. KB and SNS are supported by the FMRE (Belgium, Neurobiology 99–01 and 02–04), FRSM (Belgium, 3.4551.98/3.4507.02), Action de Recherche Concerteé, the A. & D. Van Buuren Foundation and by a Televie grant.



References Agasse F., Roger M. and Coronas V. (2004) Neurogenic and intact or apoptotic non-neurogenic areas of adult brain release diffusible molecules that differentially modulate the development of subventricular zone cell cultures. Eur. J. Neurosci. 19, 1459–1468. Arita J., Hashi A., Hoshi K., Mazawa S. and Suzuki S. (1998) D2 dopamine-receptor-mediated inhibition of proliferation of rat lactotropes in culture is accompanied by changes in cell shape. Neuroendocrinology 68, 163–171. Baker S. A., Baker K. A. and Hagg T. (2004) Dopaminergic nigrostriatal projections regulate neural precursor proliferation in the adult mouse subventricular zone. Eur. J. Neurosci. 20, 575–579. Brezun J. M. and Daszuta A. (1999) Depletion in serotonin decreases neurogenesis in the dentate gyrus and the subventricular zone of adult rats. Neuroscience 89, 999–1002. Chiang Y. C., Chen P. C. and Chen J. C. (2003) D3 dopamine receptors are down-regulated in amphetamine sensitized rats and their putative antagonists modulate the locomotor sensitization to amphetamine. Brain Res. 972, 159–167. Chio C. L., Lajiness M. E. and Huff R. M. (1994) Activation of heterologously expressed D3 dopamine receptors: comparison with D2 dopamine receptors. Mol. Pharmacol. 45, 51–60. Cooper-Kuhn C. and Kuhn H. G. (2002) Is it all DNA repair? Methodological considerations for detecting neurogenesis in the adult brain. Dev. Brain Res. 134, 13–21. Coronas V. and Roger M. (2002) Dopamine-induced increase in cell number in rat subventricular zone cell cultures. FENS Abstract, 1, A038.8. Danielsen A. J. and Maihle N. J. (2002) The EGF/ErbB receptor family and apoptosis. Growth Factors 20, 1–15. Diaz J., Ridray S., Mignon V., Griffon N., Schwartz J. C. and Sokoloff P. (1997) Selective expression of dopamine D3 receptor mRNA in proliferative zones during embryonic development of rat brain. J. Neurosci. 17, 4282–4292. Doetsch F. and Alvarez-Buylla A. (1996) Network of tangential pathways for neuronal migration in the adult mammalian brain. Proc. Natl Acad. Sci. USA 93, 14 895–14 900. Fornai F., Battaglia G., Gesi M., Orzi F., Nicoletti F. and Ruggieri S. (2001) Dose-dependent protective effects of apomorphine against methamphetamine-induced nigrostriatal damage. Brain Res. 898, 27–35. Gaillard A., Roger M., Seneé A. and Jaber M. (2004) Intranigral transplantation of embryonic mesencephalic cells in animal model of Parkinson’s disease restores dopaminergic innervation to the striatum. FENS Abstract 2, A214.5. Garcia-Verdugo J., Doetsch F., Wichterle H., Lim D. A. and AlvarezBuylla A. (1998) Architecture and cell types of the adult subventricular zone: in search of the stem cells. J. Neurobiol. 36, 234–248. Gassen M., Gross A. and Youdim M. B. (1998) Apomorphine enantiomers protect cultured pheochromocytoma (PC12) cells from oxidative stress induced by H2O2 and 6-hydroxydopamine. Mov. Disord. 13, 242–248. Griffon N., Pilon C., Sautel F., Schwartz J. C. and Sokoloff P. (1997) Two intracellular signaling pathways for the dopamine D3 receptor: opposite and synergistic interactions with cAMP. J. Neurochem. 68, 1–19. Kenney A. M. and Rorwitch D. H. (2000) Sonic hedgehog promotes G1 cyclin expression and sustained cell cycle progression in mammalian neuronal precursors. Mol. Cell Biol. 20, 9055–9067. LaHoste G. J., Henry B. L. and Marshall J. F. (2000) Dopamine D1 receptors synergize with D2, but not D3 or D4, receptors in the striatum without the involvement of action potentials. J. Neurosci. 20, 6666–6671.

Levesque D., Diaz J., Pilon C., Martres M. P., Giros B., Souil E., Schott D., Morgat J. L., Schwartz J. C. and Sokoloff P. (1992) Identification, characterization, and localization of the dopamine D3 receptor in rat brain using 7-[3H]hydroxy-N, N-di-n-propyl-2aminotetralin. Proc. Natl Acad. Sci. USA 89, 8155–8159. Levison S. W. and Goldman J. E. (1993) Both oligodendrocytes and astrocytes develop from progenitors in the subventricular zone of postnatal rat forebrain. Neuron 10, 201–212. Lois C. and Alvarez-Buylla A. (1994) Long-distance neuronal migration in the adult mammalian brain. Science 264, 1145–1148. Loo D. T., Bradford S., Helmrich A. and Barnes D. W. (1998) Bcl-2 inhibits cell death of serum-free mouse embryo cells caused by epidermal growth factor deprivation. Cell Biol. Toxicol. 14, 375–382. Luskin M. B. (1993) Restricted proliferation and migration of postnatally generated neurons derived from the forebrain subventricular zone. Neuron 11, 173–189. Luskin M. B., Zigova T., Soteres B. J. and Stewart R. R. (1997) Neuronal progenitor cells derived from the anterior subventricular zone of the neonatal rat forebrain continue to proliferate in vitro and express a neuronal phenotype. Mol. Cell Neurosci. 8, 351–366. Marshall C. A. G., Suzuki S. O. and Goldman J. E. (2003) Gliogenic and neurogenic progenitors of the subventricular zone. Glia 43, 52–61. Missale C., Nash S. R., Robinson S. W., Jaber M. and Caron M. G. (1998) Dopamine receptors: from structure to function. Physiol. Rev. 78, 189–225. Ohtani N., Goto T., Waeber C. and Bhide P. G. (2003) Dopamine modulates cell cycle in lateral ganglionic eminence. J. Neurosci. 23, 2840–2850. Pestell R. G., Albanese C., Reutens A. T., Segall J. E., Lee R. J. and Arnold A. (1999) The cyclins and cyclin-dependent kinase inhibitors in hormonal regulation of proliferation and differentiation. Endocrine Rev. 20, 501–534. Pilon C., Levesque D., Dimitriadou V., Griffon N., Martres M. P., Schwartz J. C. and Sokoloff P. (1994) Functional coupling of the human dopamine D3 receptor in a transfected NG 108–15 neuroblastomaglioma hybrid cell line. Eur. J. Pharmacol. 268, 129–139. Seaberg R. M. and van der Kooy D. (2002) Adult rodent neurogenic regions: the ventricular subependyma contains neural stem cells, but the dentate gyrus contains restricted progenitors. J. Neurosci. 22, 1784–1793. Sherr C. J. (1994) G1 phase progression: cycling on cue. Cell 79, 551–755. Tramontin A. D., Garcia-Verdugo J. M., Lim D. A. and Alvarez-Buylla A. (2003) Postnatal development of radial glia and the ventricular zone (VZ): a continuum of the neural stem cell compartment. Cereb. Cortex 13, 580–587. Van Kampen J. M., Hagg T. and Robertson H. A. (2004) Induction of neurogenesis in the adult rat subventricular zone and neostriatum following dopamine D3 receptor stimulation. Eur. J. Neurosci. 19, 2377–2387. Wachs F. P., Couillard-Despres S., Engelhardt M. et al. (2003) High efficacy of clonal growth and expansion of adult neural stem cells. Lab. Invest. 83, 949–962. Weiss S., Dunne C., Hewson J., Wohl C., Wheatley M., Peterson A. C. and Reynolds B. A. (1996) Multipotent CNS stem cells are present in the adult mammalian spinal cord and ventricular neuroaxis. J. Neurosci. 16, 7599–7609. Zhang L. and Lidow M. S. (2002) D1 dopamine receptor regulation of cell cycle in FGF- and EGF-supported primary cultures of embryonic cerebral cortical precursor cells. Int. J. Dev. Neurosci. 20, 593–606. Zhu Y., Jin K., Mao X. O. and Greenberg D. A. (2003) Vascular endothelial growth factor promotes proliferation of cortical neuron precursors by regulating E2F expression. FASEB J. 17, 186–193.
