Neurochem Res (2006) 31:463–471 DOI 10.1007/s11064-006-9038-6
ORIGINAL PAPER
Dopamine Promotes the Survival of Embryonic Striatal Cells: Involvement of Superoxide and Endogenous NADPH Oxidase Liping Ma Æ Jiawei Zhou
Accepted: 27 December 2005 / Published online: 9 May 2006 Springer Science+Business Media, Inc. 2006
Abstract The dopaminergic system appears early in mammalian brain development, and a neurodevelopmental role for dopamine (DA) has been suggested. In the present study, we found that DA markedly promoted the survival of embryonic striatal cells in cultures. The failure of DA receptor antagonists to block this survival-promoting effect and the capability of S-apomorphine, which is devoid of DA receptor agonist activity but possesses antioxidative activity as R-apomorphine and DA, to completely mimic this effect suggested that DA receptor activation was not required in the survival-promoting effect elicited by DA, and its antioxidative activity might be involved. Moreover, it was found that mRNA of NADPH oxidase was expressed in the embryonic striatum. Furthermore, DPI or apocynin, NADPH oxidase inhibitors, promoted the survival of embryonic striatal cells. Addition of either DA or DPI into striatal cell cultures decreased the superoxide level. These results indicate that the mechanisms underlying the
L. Ma Æ J. Zhou Key Laboratory of Proteomics, Institute of Biochemistry and Cell Biology, Shanghai Institute for Biological Sciences, 200031 Shanghai, China L. Ma Æ J. Zhou Graduate School of the Chinese Academy of Sciences, 200031 Shanghai, China J. Zhou (&) Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences, Building 23, Room 316, 320 Yueyang Road, 200031 Shanghai, P.R. China e-mail:
[email protected] Tel.: +86-21-5492-1073 Fax: +86-21-5492-1073
neuroprotective effects of DA were likely associated with its antioxidative activity. NADPH oxidase might contribute, at least in part, to ROS generation. Keywords Embryonic Æ Dopamine Æ Striatum Æ Neural precursor cells Æ NADPH oxidase Æ Antioxidant activity
Introduction The development of the central nervous system (CNS) is a complex process, in which multiple factors participate, including neurotransmitters. The expression of neurotransmitters, their receptors and transporters has been described during early development well before the onset of synaptic activity, and their roles in regulating growth during specific developmental period have been suggested (for review, see [1]). For example, GABA and glutamate have been shown to directly or indirectly regulate precursor cell proliferation [2]. Similarly, a role for dopamine (DA) in regulating development of nigrostriatal dopaminergic pathway has been also suggested. In the striatum of developing rat brain, expression of DA receptors D1, D2, D3 and D5 has been observed in E14 [3, 4] while tyrosine hydroxylase (TH)-immunoreactive processes appear in ventricular zone at the same embryonic stage (E14) or even earlier (E12) [5–7]. From the early appearance of mesencephalic DA input in the striatum and their temporal/ spatial relationships to the striatal patch-matrix organization, it has been concluded that DA plays an important role in the development of the striatum [5, 7–9]. In fact, the DA afferents can modulate the morphological characteristics of striatal neurons as well as the expression of striatal neuropeptides [8, 9]. The striatal cells at the time DA appears in the developing striatum exhibit a proliferative potential
123
464
and they are regarded as neural precursor cells that generate neurons and glia of CNS [2, 6]. However, the influence of DA on striatal cells has not been fully understood. In the present study, we investigated the effect of DA on the embryonic neural cells of striatum. It was observed that DA significantly promoted the survival of neural precursor cells and those differentiated cells by its antioxidant activity. NADPH oxidase, which contributes to generation of radical oxygen species (ROS), was expressed in developmental striatum. Inhibitors for NADPH oxidase also showed survival-promoting effect as DA did. It was suggested that DA promoted the survival of striatal cells by antagonizing the ROS, at least in part, produced by NADPH oxidase.
Materials and methods Animals All animal experiments were carried out in accordance with the United States National Institutes of Health Guide for the Care and Use of Laboratory Animals. Female, Sprague-Dawley rats were obtained from an animal house (Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences). Presence of the plug was taken to indicate conception and the day of plug was regarded as embryonic day (E) 0. Cultures and treatments Cell cultures were prepared from the striatum of E14 rat embryos (n=3). Dissociated cells were seeded to poly-Llysine (10 lg/ml, Sigma, St. Louis, MO, USA) coated 96well or 48-well plates at a cell density of 2.5 · 105/cm2. Cells were maintained at 37C in a humidified atmosphere of 5% CO2 and 95% air, in Dulbecco’s modified Eagle’s medium (DMEM, Life Technologies, Gaithersburg, MD, USA) and Ham’s F12 (1:1), supplemented with 1% N2 supplement (Life Technologies) and streptomycin/penicillin, a similar culture system to that for neural precursor cells in presence of growth factors [10]. Cells derived from cortical cortex of E14 rats were obtained using the same manipulations except that the cortical tissues were digested by 0.025% trypsin for 5 min before dissociation. A variety of compounds, such as DA (0.02–10 lM), R-apomorphine (R-APO, 0.02–5 lM), S-APO (0.02–10 lM), apocynin (0.05–1 mM) and diphenyleneiodonium (DPI, 0.05–5 lM) were added immediately after cells were seeded, except that DA receptor antagonists SKF83566 (1–10 lM) and spiperone (1–10 lM) were applied to cultures as least 2 h before R-APO or DA was added. Doses of R-APO, S-APO, DPI and apocynin shown in figures were those exhibiting
123
Neurochem Res (2006) 31:463–471
significant difference (survival-promoting effect) compared to untreated, and higher doses reached a plateau. Cell viability was examined 24 h following treatment or at indicated time points. Cell viability measurements Cell viability assays were performed using two methods, i.e. MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-dipheyltetrazolium bromide, Sigma) assay and fluorescein diacetate (FDA) staining. For MTT assays, cultures were incubated with 5 mg/ml MTT at 37C for 2 h. The formazan product was dissolved in solution containing 20% sodium dodecyl sulfate and 50% N,N-dimethylformamide at 37C for at least 6 h, and the absorption was determined at 570 nm in a microplate reader (Model 550, Bio-Rad) after automatic subtraction of background readings. To perform FDA staining, the cells were stained with 10 lg/ml FDA (C24H16O7, Sigma), which rendered viable cells bright green under epi-fluorescence. The number of surviving cells was counted. In both cases, the results were expressed as a percentage of live cells counted in paired untreated cultures. Immunocytochemistry Mouse anti-nestin antibody (1:300, BD Pharmingen) was used to identify neural precursor cells. The peroxidase was visualized by incubation with diaminobenzidine (DAB) (Sigma). TUNEL assay Terminal deoxynucleotidyl transferase-mediated biotinylated UTP nick end labeling (TUNEL) technique was used to examine apoptotic cell at 24 h in vitro. The staining was performed according to the manufacturer’s instruction manual (Promega, Madison, WI, USA). Occurrence of apoptosis was quantified by scoring the percentage of TUNEL-positive cells in the total cell count. Cell count For positive cells counting, in all cases, the number of positively stained cells was counted at 200 · magnification in five selected fields per well (i.e. 3-, 6-, 9-, and 12-o’clock positions and in the center). The data were expressed as percentage of paired untreated cultures (n=3). Semi-quantitative RT-PCR Reverse transcription-polymerase chain reaction (RT-PCR) was employed to reveal expression of NADPH oxidase in
Neurochem Res (2006) 31:463–471
striatal cells or cortical cells (n=3). Primers were also designed to amplify regions of coding sequence from the glyceraldehydes-3-phosphate dehydrogenase (GAPDH) gene. Primers used to amplify a region of interest were as follows: gp91-phox, 5¢-TTCCAGTGCGTGTTGCTC-3¢ (forward) and 5¢-TTTCCAAGTCATAGGAGGGT-3¢ (reverse); p22-phox, 5¢-ACGCTTCACGCAGTGGTA-3¢ (forward) and GACAGCAGTAAGTGGAGGACA (reverse); p47-phox, 5¢-ATCGCTGACTACGAGAAGGG-3¢ (forward) and 5¢-CAGGAATCGGACGCTGTT-3¢ (reverse); GA PDH, 5¢-CCCACGGCAAGTTCAACGGCA-3¢ (forward) and 5¢-TGGCAGGTTTCTCCAGGCGGC-3¢ (reverse). PCR was performed sequentially (denaturation–annealing– extension) at the following conditions: p47-phox, 45 s at 94C, 45 s at 60C and 60 s at 72C (32 cycles); p22-phox, 30 s at 94C, 30 s at 60C and 60 s at 72C (32 cycles); gp91-phox, 45 s at 94C, 45 s at 58C, and 60 s at 72C (32 cycles); GAPDH, 30 s at 94C, 30 s at 56C, and 60 s at 72C (22 cycles). For semi-quantitative RT-PCR, the conditions were the same as above except the cycling numbers (28 cycles for NADPH oxidase subunits). Measurement of superoxide release The release of superoxide was determined by measuring the superoxide dismutase (SOD)-inhibitable reduction of cytochrome c as described previously [11]. Cultures grown in 48-well plates (1 · 106/well) were maintained in phenol red-free DMEM/F12 (400 ll/well). Four hours later, 40 ll of ferricytochrome c (100 lM) was added in combination with or without 600 U/ml SOD. To determine the effect of DA or NADPH oxidase inhibitor DPI on cellular superoxide levels, they were added into the culture immediately after plating. Thirty minutes after the addition of cytochrome c, the optical density was measured by spectrophotometry at 550 nm and converted to nmol of cytochrome c reduced using the extinction coefficient E550=21.0 · 103 M)1 cm)1. The reduction of cytochrome c, which can be inhibited by pre-treatment with SOD, reflects superoxide release. While DPI alone had no effect on the oxidation status of cytochrome c, DA alone can increase the oxidation of cytrochrome c in absence of cells. The effect of DA on the oxidation of cytochrome c was taken into consideration by subtraction from the results. Statistical analysis All data were expressed as means SEM of triplicates from three independent experiments (n=3). Statistical analysis used commercially available statistical software (GraphPad Prism v4.0, GraphPad Software Inc. San Diego, CA, USA). Student–Newman–Keuls test (as a post hoc
465
test) was used to compare data samples from the untreated group with the different treatment groups, or between pairs of groups. Differences were considered significant only when P-values were
