Characterization of Putative Virulence Genes on the Related RepFIB ...

APPLIED AND ENVIRONMENTAL MICROBIOLOGY, May 2011, p. 3255–3267 0099-2240/11/$12.00 doi:10.1128/AEM.03023-10 Copyright © 2011, American Society for Microbiology. All Rights Reserved.

Vol. 77, No. 10

Characterization of Putative Virulence Genes on the Related RepFIB Plasmids Harbored by Cronobacter spp.䌤† A. A. Franco,1‡ L. Hu,1‡ C. J. Grim,1,2 G. Gopinath,1 V. Sathyamoorthy,1 K. G. Jarvis,1,2 C. Lee,1 J. Sadowski,1 J. Kim,1,3 M. H. Kothary,1 B. A. McCardell,1 and B. D. Tall1* Center for Food Safety and Applied Nutrition, FDA, Laurel, Maryland1; Oak Ridge Institute for Science and Education, Oak Ridge, Tennessee2; and Washington Internship Program, Washington, DC3 Received 24 December 2010/Accepted 7 March 2011

Cronobacter spp. are emerging neonatal pathogens that cause meningitis, sepsis, and necrotizing enterocolitis. The genus Chronobacter consists of six species: C. sakazakii, C. malonaticus, C. muytjensii, C. turicensis, C. dublinensis, and Cronobacter genomospecies group 1. Whole-genome sequencing of C. sakazakii BAA-894 and C. turicensis z3032 revealed that they harbor similarly sized plasmids identified as pESA3 (131 kb) and pCTU1 (138 kb), respectively. In silico analysis showed that both plasmids encode a single RepFIB-like origin of replication gene, repA, as well as two iron acquisition systems (eitCBAD and iucABCD/iutA). In a chrome azurol S agar diffusion assay, it was demonstrated that siderophore activity was associated with the presence of pESA3 or pCTU1. Additionally, pESA3 contains a cpa (Cronobacter plasminogen activator) gene and a 17-kb type 6 secretion system (T6SS) locus, while pCTU1 contains a 27-kb region encoding a filamentous hemagglutinin gene (fhaB), its specifc transporter gene (fhaC), and associated putative adhesins (FHA locus), suggesting that these are virulence plasmids. In a repA-targeted PCR assay, 97% of 229 Cronobacter species isolates were found to possess a homologous RepFIB plasmid. All repA PCR-positive strains were also positive for the eitCBAD and iucABCD/iutA iron acquisition systems. However, the presence of cpa, T6SS, and FHA loci depended on species, demonstrating a strong correlation with the presence of virulence traits, plasmid type, and species. These results support the hypothesis that these plasmids have evolved from a single archetypical plasmid backbone through the cointegration, or deletion, of specific virulence traits in each species. toxins, adherence factors, and secretion systems (types 3, 4, and 6) (16, 33, 34, 46, 58). Pathogenic Escherichia coli, which comprises six different intestinal or extraintestinal pathotypes, was one of the first organisms for which virulence factors genes, such as those for expression of iron acquisition systems, adherence factors, and enterotoxins, were determined to be carried on plasmids (11, 37, 59). Plasmid-borne virulence gene clusters of one species have also been observed in plasmids of other species or pathogenic groups, suggesting acquisition by horizontal gene transfer (33, 34, 46). Muytjens et al. (47) first performed plasmid analysis and characterization of a small cluster of eight Enterobacter sakazakii strains obtained during a 6-year surveillance study of neonatal meningitis and septicemia cases. This was followed by similar reports which showed that Cronobacter spp. (reported as E. sakazakii) harbored multiple and similarly sized plasmids, that they could be isolated from strains obtained from infants, and that these plasmid-harboring strains could also be isolated both from utensils used to prepare infant formula and from containers of powdered infant formula preparations kept in hospital nurseries (2, 13, 57). The genomes of two Cronobacter species, C. sakazakii ATCC BAA-894 (41) and C. turicensis z3032 (61), have been sequenced, and multiple plasmids are present in each strain, including two homologous plasmids identified as pESA3 (⬃131 kb) in C. sakazakii BAA-894 and pCTU1 (⬃138 kb) in C. turicensis z3032. Recently, we reported that pESA3 encodes an outer membrane protease (named Cronobacter plasminogen activator) that was shown to provide serum resistance to C. sakazakii and may enhance its spread and invasion in a host

Farmer et al. (20) established the taxonomic position of Enterobacter sakazakii, which was previously identified as yellow-pigmented Enterobacter cloacae based on DNA-DNA hybridization studies in combination with phenotypic observations (67). Recently, these organisms were reclassified within the novel genus Cronobacter, which comprises six species groups: C. sakazakii, C. malonaticus, C. muytjensii, C. turicensis, C. dublinensis (with three subspecies, C. dublinensis subsp. dublinensis, C. dublinensis subsp. lausannensis, and C. dublinensis subsp. lactaridi), and Cronobacter genomospecies group 1 (29). Cronobacter spp. can cause neonatal sepsis, necrotizing enterocolitis, and meningitis, with reported mortality rates of 40 to 80%, and survivors often have severe neurological and developmental disorders (38, 48, 68). These opportunistic pathogens have been detected in many types of foods (18, 32, 48), as well as in diverse environments (36). However, only powdered infant formula has been linked to outbreaks of meningitis in neonates and infants (8, 26). Bacterial plasmids have been found to encode a diverse assortment of virulence factors, including antibiotic resistance, * Corresponding author. Mailing address: Room 3607, MOD 1 Facility, Virulence Mechanisms Branch (HFS-025), Division of Virulence Assessment, OARSA, Center for Food Safety and Applied Nutrition, U.S. Food and Drug Administration, 8301 MuirKirk Rd., Laurel, MD 20708. Phone: (301) 210-7880. Fax: (301) 210-7976. E-mail: ben.tall @fda.hhs.gov. ‡ A. A. Franco and L. Hu contributed equally to this project and both should be considered first authors. † Supplemental material for this article may be found at http://aem .asm.org/. 䌤 Published ahead of print on 18 March 2011. 3255

3256

FRANCO ET AL.

(21). In this study, we performed an in silico analysis of pESA3 and pCTU1 and identified several virulence gene clusters encoded on these plasmids, such as two iron acquisition system loci (eitCBAD and iucABCD/iutA), a type six secretion system (T6SS) locus, and a two-partner secretion system (TPS)/filamentous hemagglutinin gene (fhaB), and a transporter gene (fhaC) and associated putative adhesins (FHA locus). We screened a large collection of Cronobacter spp. to determine the occurrence of these homologous plasmids among the species groups as well as the distributions of the virulence gene clusters. MATERIALS AND METHODS Bacterial strains and media. The strains evaluated in this study consisted of 178 C. sakazakii, 25 C. malonaticus, 12 C. muytjensii, 6 C. turicensis, 6 C. dublinensis, and 2 genomospecies group 1 strains from our laboratory culture collection; these strains represent isolates obtained from clinical, food, and environmental sources and from diverse geographical locations. Assignment of the Cronobacter species nomenclature to the 229 strains was performed according to the proposed classification scheme suggested by Iversen et al. (29). All of the strains were PCR positive for the 350-bp amplified region of the Cronobacter zinc metalloprotease (zpx), a genus-specific gene target previously reported by our group (40). Species identity was confirmed using the PCR procedure described by Stoop et al. (62). For all experiments, wild-type C. sakazakii BAA-984 and C. turicensis z3032 strains and their respective pESA3- and pCTU1-cured derivatives were used as controls. Frozen bacterial cultures were stored at ⫺80°C in Trypticase soy broth (BBL, Cockeysville, MD) supplemented with 1% NaCl (TSBS) and 50% glycerol. For propagation, frozen cultures were rapidly thawed and subcultured onto plates containing Trypticase soy agar (TSA; BBL) supplemented with 1% NaCl (TSAS) or Luria-Bertani (LB) agar (LBA; BBL), and the plates were incubated for 16 to 18 h at 37°C. Plasmid and PCR template isolation. Single colonies of each strain were transferred from a TSAS or LBA plate to a culture tube containing 5 ml of TSBS or LB broth. Bacterial broth cultures were slanted to achieve maximum aeration and were incubated for 16 h with agitation at 37°C. Genomic DNA was prepared by serial dilution (1:1,000) of boiled cell cultures in distilled water as described by Chun et al. (12) and was used as PCR template to screen the 229 Cronobacter strains for the presence or absence of plasmid-borne genes. In parallel, plasmids were isolated from a 3.0-ml aliquot from each broth culture by using the Qiaprep spin miniprep kit or the Qiagen plasmid minikit (Qiagen Sciences, Germantown, MD) according to the manufacturer’s instructions. Curing pESA3 and pCTU1. To cure pESA3 and pCTU1 from wild-type strains C. sakazakii strain BAA-894 and C. turicensis strain z3032, plasmids were first labeled with an ampicillin resistance gene by integration of pCVD442::cpa and pCVD442::fhaB into pESA3 and pCTU1, respectively. To construct pCVD442::cpa and pCVD442::fhaB, internal regions of cpa and fhaB were amplified by PCR using primers designed to contain XbaI restriction sites at the 5⬘ and 3⬘ ends of the PCR products (Table 1). The PCR products were digested with XbaI and cloned into a compatible site in the suicide vector pCVD442 (17). pCVD442::cpa and pCVD442::fhaB were transformed into E. coli SM10 ␭pir and then mobilized into nalidixic acid-resistant strains C. sakazakii BAA894NA and C. turicensis strain z3032NA, respectively (21). Single homologous recombinants were selected on LB agar containing ampicillin (100 ␮g/ml) and nalidixic acid (256 ␮g/ml). Plasmids pESA3⌬cpa and pCTU1⌬fhaB, created by integration of pCVD442::cpa and pCVD442::fhaB, respectively, were cured of C. sakazakii BAA894NA and C. turicensis z3032NA by growing these strains in LB broth containing 1% sodium dodecyl sulfate (SDS). Recombinants cured of the plasmids were selected on LB agar containing 10% sucrose as described by Donnenberg and Kaper (17). The losses of pESA3 and pCTU1 in these recombinants, which were sucrose resistant and ampicillin sensitive, were confirmed by plasmid extraction (35) and PCR assays using primers derived from repA, eitA, iucC, and cpa genes and T6SS and fhaB loci (Table 1). The presence of pESA2 in C. zakazakii BAA-894NA (cured of pESA3) and pCTU2 and pCTU3 in C. turicensis z3032NA (cured of pCTU1) was determined by PCR analysis using primers derived from pCTU3 repA and a common region of pESA2/pCTU2 repA (Table 1). Bacterial mating. C. turicensis strain z3032NA harboring plasmid pCTU1⌬fhaB was used as a donor strain, and E. coli DH5␣5 containing the kanamycin resistance plasmid pET30a(⫹) (Novagen, San Diego, CA) was used

APPL. ENVIRON. MICROBIOL. as the recipient strain. Exponential cultures of donor and recipient bacteria were centrifuged, washed, and suspended in fresh LB medium. Donor and recipient cells were mixed in a final ratio of 1:1, and 20 ␮l of this mix was applied to a nitrocellulose filter placed on LB agar. The filter matings were incubated overnight at 37°C, and transconjugants were selected on LB agar containing ampicillin (100 ␮g/ml) and kanamycin (50 ␮g/ml). Siderophore detection. Siderophore production was determined using the chrome azurol S (CAS) agar diffusion (CASAD) assay (55, 56). The CAS agar plate was punched with 5-mm-diamater holes by using a gel puncher. Each hole was filled in a two-step process with 70 ␮l (35 ␮l twice) of cell-free culture supernatant of the test bacteria grown for 18 h in LB broth containing 200 ␮M 2,2⬘-dipyridyl (Sigma Aldrich). After incubation at 37°C for 4 to 8 h, the presence of an orange halo around a hole indicated a culture was positive for siderophore production. PCR assay development for the presence of pESA3 or pCTU1 plasmids and plasmid-specific gene targets. PCR primers were designed that targeted the repA, eitCBAD, iucABCD/iutA, and cpa genes and T6SS, and fhaB loci on pESA3 and pCTU1, taking into account chromosomal homologues, when present, e.g., homologues of the T6SS gene cluster. PCR primer names, sequences, amplicon sizes, and gene target names are shown in Table 1. All primers used in the PCR amplification experiments were prepared by Integrated DNA Technologies (Coralville, IA). All PCR mixtures were prepared using the GoTaq Green master mix (Promega Corp., Madison, WI), which entailed a 25-␮l reaction mixture with 1 unit of GoTaq Hotstart DNA polymerase, 1.5 mM MgCl2, and 200 ␮M each deoxynucleoside triphosphate. Primers were added at 1 ␮M each, and 1 ␮l of the plasmid lysate (approximately 90 ng DNA/25-␮l reaction mixture) or 5 ␮l of boiled genomic DNA sample (approximately 50 ng DNA/25-␮l reaction mixture) served as DNA template. In all PCRs, the polymerase was activated by using a 3-min incubation step at 94°C, followed by 25 cycles of denaturation at 94°C for 30 s and annealing and extension steps according to the PCR parameters described in Table 1. For each reaction, a final extension step of 5 min at the cycle extension temperature, as described for each PCR, was used (Table 1). Plasmid agarose gel electrophoresis analysis. To confirm the results of the repA PCR assay used in this study, plasmids were isolated from representative strains (including plasmid-harboring and plasmid-cured control strains) by using the Kado and Liu procedure (35) and subjected to agarose gel electrophoresis using 0.7% Tris-borate-EDTA (TBE; Invitrogen, Carlsbad, CA) agarose gels in a RunOne (Embi Tec, San Diego, CA) or an IBI (Thermo Fisher Scientific, Inc., Waltham, MA) horizontal electrophoresis unit. Gels were photographed with transilluminated UV light by using a Gel-Chem-Doc XR molecular imaging system (Bio-Rad Laboratories, Hercules, CA). For PCR analysis, these plasmid samples were dialyzed in distilled water using 0.025-␮m VSWP filters (Millipore Corp., Billerica, MA) to remove residual phenol and contained approximately 400 ng DNA/25-␮l reaction mixture. Plasmid preparations using the above cited plasmid kits were also subjected to agarose gel electrophoresis. Nucleotide sequencing. PCRs for nucleotide sequencing were performed using AccuPrime Taq DNA polymerase high fidelity (Invitrogen, Inc., Carlsbad, CA). Primers for sequencing reactions are listed in Table 1. Sequencing of PCR amplicons was performed by Macrogen, Inc. (Rockville, MD), and the sequences were submitted to GenBank. Nucleotide sequence accession numbers. The NCBI accession numbers of the nucleotide sequences used in this study are as follows: the genome of C. sakazakii ATCC BAA-894, CP000783 to CP000785NP_009780; the genome of C. turicensis z3032, FN543093 to FN543096; pESA3, NC_009780; and pCTU1, NC_013283. All de novo sequences which were generated during this study were submitted to GenBank (accession numbers listed in parentheses) and included the following: (i) repA sequences of pCTU1 from C. turicensis strain E681 (HQ536984) and pCGS1 (plasmids named in similar fashion as per the pCTU1 naming scheme) from Cronobacter genomospecies group 1 strains E680 (HQ536988) and NCTC 9529 (HQ536992); pCMA1 from C. malonaticus strains LMG 23826 (HQ536990) and E763 (HQ536983); pCSA1 from C. sakazakii strain Jor100 (HQ536986); pCDD1 from C. dublinensis subsp. dublinensis strain LMG 23823 (HQ536991); pCDL1 from C. dublinensis subsp. lausannensis strain LMG23824 (HQ536989); pCMU1 from C. muytjensii strains Jor174 (HQ536987) and Jor171 (HQ536985); (ii) an internal region of fhaB of pCDD1 from C. dublinensis subsp. dublinensis strain LMG 23823 (HQ587045); and (iii) a partial sequence of iucC of pCDD1 from C. dublinensis subsp. dublinensis strain LMG 23823 (JF412348).

RESULTS Targeted in silico sequence analysis of pESA3 and pCTU1. Targeted in silico sequence analysis of pESA3 and pCTU1

VOL. 77, 2011

TWO PUTATIVE VIRULENCE PLASMIDS IN CRONOBACTER SPP.

3257

TABLE 1. PCR primers used in this study Primer usage group and target

For PCR analysis IncF1B eitA iucC cpa ⌬cpa ⌬T6SS IntT6SS left vgrG T6SS R end IntT6SS right fhaB ⌬FHA CdfhaB CdiucC For sequencing reactionsb repA, 5⬘ end repA, 3⬘ end For plasmid curingc fhaB

Forward and reverse primers

repA a b c

264

56°C for 30 s/72°C for 30 s

pESA3/pCTU1

280

60°C for 30 s/72°C for 30 s

pESA3/pCTU1

660

58°C for 30 s/72°C for 30 s

pESA3/pCTU1

306

56°C for 30 s/72°C for 30 s

pESA3

303 1,693 471

50°C for 30 s/70°C for 90 s 56°C for 30 s/72°C for 60 s

pCTU1 pESA3 pCTU1

1,168

56°C for 30 s/72°C for 90 s

pESA3

850

52°C for 30 s/70°C for 60 s

pESA3

338

56°C for 30 s/72°C for 40 s

pESA3

800

56°C for 30 s/72°C for 60 s

pESA3

804

56°C for 30 s/72°C for 60 s

pCTU1

668

56°C for 30 s/72°C for 60 s

pESA3

735

60°C for 30 s/72°C for 60 s

pCDU1

800

56°C for 30 s/72°C for 60 s

GATGCGCCTTGGCCTGTTTGT GCACAGCTTCACGAACTCCAC CCTTTTTCACGGCGTCGAGCTG TCTCTTCTGGTTCTCCAGCGCG TGCAGTGCCTGATGTCAGGCCAT ACGCCAAACATCTCCTGATAGCG GACAACCCTGAGTTCTGGTAAC ATGCGTATTTCTGCTGGTAA CCGCTCAGTTTCATCTCAAT GCTGAATGATTTTGTGGT GGAATACGCCTGCGCTGATGAC CTGAACAGATGGCCGATCTGGT GGAATACGCCTGCGCTGATGAC CCAGTAATTTCAGCGGCAGCTC GGTTTCACTTCCCGCTGATA CCCGCAGTTAATCACCAGTT CTCAGATTACTGATCGGCGCTG GTATGGCATACCGCAATTGCGC CTCAGATTACTGATCGGCGCTG CTGAACAGATGGCCGATCTGGT GTGGCGAACCCGTATGGCATTAC TGTCGCCTGCTATCTGCGCGTTG GCGAAATGGTGATGCTGACCA TCAACAGAGAGTGGGCAGCGA GTGGCGAACCCGTATGGCACCAC CGTGACGTCGTTTCTGGCATCA CGATCTGCAATTGCTGGAAGCGC ATCAGTGCTGCCATCAGCACAGC

repA_1F repA_1R repA_2F repA_2R

GTGATACTCTCACTGGCGAAG CTGTACTTGGCRGACTGCAC GTGGAGTTCGTGAAGCTGTGCG GGTCAGCATCACCATTTCGCCC

600

55°C for 30 s/72°C for 60 s

pESA3/pCTU1

606

55°C for 30 s/72°C for 60 s

pESA3/pCTU1

fha11

CGACGTACTCTAGAGCGGCAACC TGACGGCGAAAGGCGAC GCGCCACTTCTAGAGACTCATCG CCCTGAAAAGTGGTCGC CGACGGACTCTAGAGTCGAAAG AATTTGTATATGACTCCAGTAC GCGCCACTTCTAGATAATGCTCG TCGTTATCCTTCGCGGTCACCC

983

58°C for 30 s/72°C for 60 s

pCTU1

551

56°C for 30 s/72°C for 60 s

pESA3

GAGACTGGCAGACCCGGCATA TGCGTTCACGAGCTGCCTGG CGCCTCAGTGTGTTCACTCCG TAGCTCCCATAGACTCGGATC

398

59°C for 30 s/72°C for 40 s

pESA2/pCTU2

551

52°C for 30 s/70°C for 60 s

pCTU3

cpamut5 cpamut6

To identify pESA2/pCTU2 and pCTU3 repA

Plasmid association

F1B2fw F1B2rv EitAF1 EitAR1 IucCF IucCR cpafw cparv ⌬cpafw ⌬cparv ⌬t6ssfw ⌬t6ssrv ⌬t6ssfw t6ssrv vgrGfw vgrGrv t6ssfw t6ssrw3 t6ssfw ⌬t6ssrv fhafw fharv ⌬fhafw ⌬fharv cdfhafw cdfharv cdiucfw cdiucfw

fha12 cpa

Annealing/extension cycle parametersa

Amplicon size (bp)

Sequence (5⬘–3⬘)

InF2Fw IncF2Rv H1Fw H1Rv

All PCRs were performed with 25 cycles (see Materials and Methods for further details). Note that the two PCR products obtained from the two repA sequencing reactions overlapped by 164 bp. The underlined sequence portions show the restriction site for XbaI.

revealed that these two plasmids share a high degree of sequence homology for each plasmid, although there are a number of inserted and deleted regions specific to each plasmid (Fig. 1). Many of these unique clusters of genes, such as the two iron acquisition system loci (eitCBAD and iucABCD/iutA) and the cpa locus and T6SS of pESA3 and the downstream regions of the FHA cluster of pCTU1, were most likely ac-

quired via horizontal gene transfer, as evidenced by a significant change in G⫹C content at these sites (Fig. 1). BlastN analysis of the homologous, single replication protein gene repA (ESA_pESA3, location 115 to 588, and CT_pCTU1, location 110354 to 111367) indicated that these two plasmids are members of the plasmid incompatibility group IncFIB. Phylogenetic cluster analysis (Fig. 2) of repA genes from

3258

FRANCO ET AL.

APPL. ENVIRON. MICROBIOL.

FIG. 1. Sequence alignment of pESA3 and pCTU1, produced with the Artemis Comparison Tool (ACT). A schematic of each plasmid is shown above (or below) its corresponding ruler. The sequence of pESA3 was modified by rejoining the repA gene at the 3⬘ end, which is split in the GenBank sequence. The G⫹C content (as a percentage) is shown between the plasmid ORF schematic and the ACT homology output; pESA3 and pCTU1 have a mean G⫹C contents of 56.85% and 56.05%, respectively. Select genes or loci are shown in color as follows: eit (red), iuc (orange), parAB and repA (purple), integrase (black) and associated genes (white), cpa (teal), T6SS (blue), and FHA (brown). In the middle section, the red color indicates significant nucleotide homology, as determined by BlastN analysis, between pESA3 and pCTU1, and the location on each plasmid, for example eit, iuc, parAB, and repA. White indicates regions or loci present on one plasmid and absent on the other, e.g., cpa, T6SS, and FHA.

pESA3 and pCTU1 as well as those from representative strains from the other Cronobacter species indicated that, as a group, they are most closely related to the RepFIB repA genes of pILF82 harbored by pathogenic E. coli, pHCM2 of Salmonella enterica serovar Typhi, and pMT1 harbored by Yersinia pestis. The repA sequences from Cronobacter spp. also separated into two distinct clusters, with clade 1 comprised of C. sakazakii strains BAA-894 and Jor100, C. malonaticus strains E763 and LMG 23826, C. dublinensis subsp. lausannensis strain LMG 23824, C. turicensis strains z3032 and E681, and the two Cronobacter genomospecies group 1 strains E680 and NCTC 9529. Strains residing in cluster 2 are C. muytjensii strains Jor174 and Jor171 and C. dublinensis subsp. dublinensis strain LMG 23823. In silico analysis of pESA3 and pCTU1 showed that both plasmids possess parAB partioning genes immediately upstream of repA, but they did not possess the typical F-transfer (tra) or mobilization (mob) regions commonly found in RepFIB plasmids harbored by other members of the Enterobacteriaceae (33). A site-specific integrase was observed in the in silico analysis of each plasmid (ESA_pESA3p05520 and Ctu_1p00690) and was found to belong to the ␭ phage family of integrases in an operon arrangement with three genes encoding a hypothetical protein and two tandem helicases (Fig. 1). Interestingly, C. sakazakii BAA-894 and C. turicensis z3032 each possess a cryptic conjugative plasmid, pESA2 and pCTU2, respectively, which could function to transfer pESA3 and pCTU1 if a mob region were present on these plasmids (41, 61). To this end, results of conjugation mating experiments using C. turicensis strain z3032 as donor and E. coli DH5␣ as recipient showed that pCTU1 was not self-transferred or mobilized by a pCTU2-mediated coconjugative mechanism (data not shown).

Cronobacter species RepFIB plasmid-encoded putative virulence factors. Homologues of several putative virulence factors are also found on both plasmids, indicating that the presence of these plasmids likely contributes to the virulence of Cronobacter spp. For example, both plasmids encode two highly conserved iron acquisition systems (Fig. 1). In addition, pESA3 encodes a T6SS and the cpa gene, which was recently demonstrated to be an important virulence factor in C. sakazakii (21), while pCTU1 contains a 27-kb region encoding a two-partner secretion system and FHA locus (Fig. 1). (i) Iron acquisition gene clusters. The capability of iron acquisition is generally thought to be a prerequisite for a pathogen to establish infections when entering a host (15, 23). Plasmids pESA3 and pCTU1 harbor two iron(III) acquisition systems, eitCBAD (plasmid locations pESA_74943 to _77745 and pCTU1_45608 to _46366) and iucABCD/iutA (pESA3_119253 to _127220 and pCTU1_98772 to _106741) (Fig. 1). The eitCBAD operon shares significant homology with many ABC transporters that mediate the translocation of iron, siderophores, and heme (39). The eitABCD operon is found in several enteric pathogens, both chromosomally and plasmid borne (33). Interestingly, in silico analyses of the nucleotide sequence of the eit operons of pESA3 and pCTU1 cluster them distantly from other representative plasmid-borne eit operons, with the eit operons of pESA3 and pCTU1 having a different gene arrangement, i.e., two oppositely oriented operons, eitCBA and eitD, compared to the typical operon arrangement of eitABCD (see Fig. S1a in the supplemental material). The eitCBAD operons of both pESA3 and pCTU1 are flanked downstream by two unknown proteins (in pCTU1, one of these proteins may be an inner membrane protein) and upstream by a gene encoding a major facilitator superfamily (MFS) protein.

VOL. 77, 2011


FIG. 2. Phylogenetic cluster analysis of repA. The evolutionary history was inferred using the neighbor-joining method (64). The percentages of replicate trees in which the associated taxa clustered together in the bootstrap test (1,000 replicates) are shown next to the branches (64). The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the maximum composite likelihood method (65), and data shown are the number of base substitutions per site. Codon positions included were the first, second, and third and noncoding positions. All positions containing gaps and missing data were eliminated from the data set (complete deletion option). There were a total of 780 positions in the final data set. Phylogenetic analyses were conducted by using MEGA4 (65).

3259

MFS-like proteins consist of a large and diverse group of secondary transporters, including uniporters, symporters, and antiporters, which facilitate the transport of a variety of substrates, such as ions, sugar phosphates, nucleosides, and amino acids, across cytoplasmic or internal membranes. The iucABCD/iutA operon consists of five genes responsible for synthesis and transport of a hydroxymate aerobactin-like siderophore (39). The iucABCD/iutA operon of pESA3 and pCTU1 is highly conserved and shares a high degree of homology with iron acquisition gene clusters harbored by other enteric organisms (see Fig. S1b in the supplemental material), indicating that these genes are commonly found within the Enterobacteriaceae and that they are easily transferable, since the operons are found both chromosomally and on plasmids. The iucABCD/iutA operon of pESA3 and pCTU1 clustered most closely with another small clade comprised of Enterobacter cloacae, Enterobacter hormaechei, and Escherichia fergusoni. This subcluster falls within a larger cluster represented by several Yersinia species and Serratia proteamaculans (see Fig. S1b). Again, as with the eitCBAD operon, this operon is flanked upstream by a gene encoding an MFS-like protein, ShiF. Additionally, upstream of shiF is a homologue of viuB, a FAD-binding siderophore-interacting protein which has a high binding constant that allows bacteria to sequester iron from transferrin and lactoferrin and suggests that viuB may dictate serum survival within a host, an attribute known to aid in pathogenicity (3). In both plasmids, this gene cluster is flanked downstream by parBA. To determine if pESA3 and pCTU1 encode functionally active siderophore systems, we assayed wild-type C. sakazakii BAA-894 and C. turicensis z3032 and their plasmid-cured derivative strains for iron(III) uptake in a CASAD assay (56). Surprisingly, the wild-type strains (harboring plasmids pESA3 and pCTU1), but not the plasmid-cured derivatives of BAA894 and z3032, possessed siderophore activity (see Fig. S2 in the supplemental material) suggesting that this activity is solely plasmid associated. (ii) Cronobacter plasminogen activator (cpa) gene locus. In silico analysis of pESA3 revealed the presence of an omptin superfamily homologue, pESA3p05434, recently named Cpa by Franco et al. (21) (Fig. 1 and 3). Cpa shares significant identity with the plasminogen activators Pla of Yersinia pestis and PgtE of Salmonella enterica (21). Other examples of plasmid-borne omptins include PlaA, encoded on pEP36 harbored by Erwinia pyrifoliae, and protease VII encoded on pKP187 and harbored by Klebsiella pneumoniae strain 342 (27, 43). Pla and PgtE contribute to the pathogenesis of Y. pestis and Salmonella enterica by several mechanisms, such as invasiveness, systemic spread, and uncontrolled proteolysis of a variety of host proteins, including plasminogen, i.e., ␣2-antiplasmin (␣2AP) and complement proteins (27, 42, 43, 53, 60). We recently found that Cpa has the capacity to provide serum resistance to C. sakazakii BAA-894 by proteolytically cleaving complement components, as well as activate plasminogen and inactivate the plasmin inhibitor ␣2-AP, suggesting that this protein is an important virulence factor for C. sakazakii (21). On pESA3, cpa is flanked upstream by an MFS-1 homologue and downstream by cpmJK, encoding proteins involved in carbapenem resistance (Fig. 3). The cpa-flanking regions found on pESA3 are conserved on pCTU1; however, instead of a 1,427-bp re-

3260

FRANCO ET AL.


FIG. 3. cpa locus of pESA3. The schematic shows the pESA3 cpa locus, 1,427 bp, collapsed region (dashed lines) in pCTU1 (37 bp), and conserved upstream and downstream flanking genes rimL (COG1670; acetyltransferase of the type rimL N-acetylase of ribosomal proteins), MFS-1, the major facilitator superfamily transporter (putative antibiotic resistance drug efflux pump); cpmJK, homologous (41% amino acid identity) to proteins of Photorhabdus luminescens subsp. laumondii TTO1 involved in carbapenem resistance; TR, transcriptional regulator; gloA, gene with the functional domain of lactoylglutathione lyase (also known as glyoxalase I), bleomycin resistance protein, or dioxygenase; and PCR primers (arrows with superscript numbers) used for plasmidotype screening. Primer 1, ⌬cpafw; primer 2, ⌬cparv; primer 3, cpafw; primer 4, cparv.

gion containing cpa, pCTU1 has a specific 37-bp region (Fig. 3). Also in this region, on both plasmids is a palindromic inverted repeat (IR) of 10 to 13 nucleotides, separated by a 10-bp spacer, forming a stem-loop structure. Interestingly, the small pCTU1-specific sequence is located upstream of this IR, while the cpa locus on pESA3 is located downstream. We hypothesize that the IR is most likely a transposon attachment site, which would explain the presence of cpa on pESA3 (Fig. 3). (iii) T6SS-encoding regions or the T6SS locus. The T6SS is a recently characterized secretion system which appears to be involved in bacterial pathogenesis as a potential phage-like nanosyringe for the translocation of putative effector proteins (4, 31). T6SS gene clusters have been found in both pathogenic and nonpathogenic bacterial species (4). Several bacterial species have one or two copies of T6SS clusters, but a few species,

including Burkholderia species, have four to six clusters, suggesting redundancy for virulence or specificities for particular niches or hosts (4, 5, 31). T6SSs are typically comprised of a conserved core gene cluster of 13 to 15 open reading frames (ORFs) (5). In silico analysis of pESA3 harbored by BAA-894 revealed that this T6SS gene cluster consists of 16 ORFs (ESA_pESA3p05491 to -5506) (Fig. 1 and 4). Two effector proteins identified in other homologues of T6SS are also seen in this plasmid-borne T6SS gene cluster: Hcp1 (hemolysin coregulated protein 1) and VgrG (valine-glycine repeat G protein) are encoded by single-copy genes in this cluster (4, 5, 31). The COG3157 domain of this Hcp1 is shared by two other proteins on pESA3 and the chromosome of C. sakazakii strain BAA-894, although the latter loci are not associated with a T6SS gene cluster. The VgrG protein also has related proteins distributed on the chromosome, but most of them are not

FIG. 4. The T6SS cluster of pESA3, 16,937 bp long, compared to the collapsed region (dashed lines) on pCTU1 (32 bp), including conserved upstream and downstream flanking genes and PCR primers (arrows with superscript numbers) used for plasmidotype screening. T6SS cluster genes (diagonal shading) are identified by their COG numbers, unless otherwise specified. DUF2931, putative lipoprotein. Flanking genes were identified by closest or most probable BlastX homology. arsCBR, arsenic resistance gene operon; dapA, homologue of dihydrodipicolinate synthetase; PRK11272, drug/metabolite transporter; gntR, putative transcriptional regulator with DNA-binding and aminotransferase domain; dsbGD, disulfide bond formation/isomerization genes; scsA, homologue of suppressor of copper sensitivity from Serratia odorifera DSM 4582; ynaJ, putative inner membrane protein; SMI1_KNR4, regulator of 1,3-␤-glucan synthase activity; ymjA, conserved hypothetical protein of Enterobacteriaceae; eitABCD, iron(III) siderophore operon. PCR primers (arrows with superscript numbers) used for plasmidotype screening were as follows: primer 1, ⌬t6ssfw; primer 2, ⌬t6ssrv; primer 3, t6ssrv; primer 4, vgrGfw; primer 5, vgrGrv; primer 6, t6ssfw; primer 7, t6ssrv3.

VOL. 77, 2011


3261

FIG. 5. FHA locus of pCTU1 (27,421 bp), compared to the collapsed region (dashed lines) of pESA3 (266 bp), including conserved upstream and downstream flanking genes. The FHA cluster includes a homologue of fhaC, two partner secretion proteins, and fhaB, the filamentous hemagglutinin precursor (diagonal gray lines); accessory adhesins (fha1 to -5; black) and accessory outer membrane protein homologues (FHA OMP; vertical gray lines) are also shown. Flanking genes include parAB, chromosome/plasmid partitioning proteins; repA, plasmid replication protein; HP_PGM, His residue phosphotase/phosphoglycerate mutase; COG4705, conserved membrane-anchored protein; rimL, COG1670 acetyltransferase of the type rimL N-acetylase of ribosomal proteins; MFS_1, major facilitator superfamily transporter. Genes encoding hypothetical proteins are indicated by white arrows. PCR primers (indicated by arrows with superscript numbers) used for plasmidotype screening were as follows: primer 1, ⌬fhafw; primer 2, ⌬fharv; primer 3, fhafw; primer 4, fharv.

associated with any T6SS gene cluster. Other genetic components of the T6SS contained on pESA3 include genes encoding membrane-embedded proteins, such as IcmF-DotU/IcmHSciN homologues. IcmF/DotU share significant homology with similar homologues of T4SS stabilization proteins (5). Additionally, an energizing component, ClpV, whose ATPase activity is crucial for T6SS activity (4), is also present within the plasmid-borne T6SS locus. ClpV is a member of the Hsp100/ Clp family of AAA⫹ (ATPases associated with various cellular activities) proteins (4). The major T6SS gene cluster of pESA3 is flanked upstream by a gntR-like homologue whose product is characterized as a transcriptional regulator with two functional domains, an N-terminal DNA-binding helix-turn-helix domain and an aminotransferase C-terminal ligand-binding and oligomerization domain (Fig. 5). Downstream of the T6SS cluster are three putative genes encoding increased copper tolerance, including dsbG (24). The regions flanking the T6SS gene cluster on pESA3 are conserved on pCTU1; however, the 16,937-bp T6SS locus is replaced by a specific 32-bp sequence (Fig. 4). In addition to the plasmid-borne T6SS cluster seen in pESA3, a larger cluster encoding 28 known T6SS proteins is present on the chromosome of BAA-894 between bp 3867420 and 3897047. This cluster shares homology with a shorter cluster found on the chromosome of C. turicensis z3032 (between bp 74000 and 90400). The chromosomal T6SS cluster in BAA 894 does not share significant homology at the nucleotide level with the pESA3 T6SS gene locus. While the T6SS gene cluster of pESA3 is absent from pCTU1, some of its predicted proteins, like VgrG and clpV, share homology with proteins found in two partial clusters on the chromosome of C. turicensis z3032 (between bp 2019520 and 2031123 and bp 2049130 and 2062940) and a second cluster located on the chromosome of C. sakazakii strain BAA-894 between bp 1966728 and 1978959 (41). This suggests that the chromosomal T6SS loci and that

associated with the pESA3-like plasmids in Cronobacter spp. may possibly have distinct origins. (iv) FHA locus. In silico sequence analysis of pCTU1 revealed the presence of a specific ⬃27-kb region containing fhaB, fhaC, and five associated putative adhesins (Fig. 5). The fhaB and fhaC genes encode proteins with significant identity to protein members of a two-partner secretion system (TPS). TPSs translocate large proteins or protein domains, mostly adhesins and hemolysins, and have been identified in many bacterial genera, including human, animal, and plant pathogens (30). TPSs are composed of two proteins, the transported protein (named fhaB in this study) and the specific transporter (fhaC) (30). The secretion of the filamentous hemagglutinin (FHA), a 230-kDa adhesin of Bordetella pertussis, represents a model TPS (1). By using the KEGG Sequence Similarity database (SSDB) motif program (http://www.genome.jp/keg /ssdb), similar FHA-like proteins FhaB and ShlA/HecA/FhaA exofamily were found in Pantoea ananatis and Erwinia billingiae EB661. SSDB analysis of the predicted protein encoded by fhaB of pCTU1 revealed at least three carbohydratedependent hemagglutination active sites throughout the molecule, 42 tandem hemagglutinin repeating motifs, and three N-terminal phage replisome organizer (Phage_rep_org_N) protein motifs. Similar to what was observed in the cpa and the T6SS gene clusters encoded on pESA3, the 27,421-bp FHA locus of pCTU1 is replaced by a 266-bp sequence on pESA3 (Fig. 5). This pESA3-specific sequence has some stretches of high homology to pCTU1 in the 5⬘ region; however, the 3⬘ region is highly divergent. Curing of pESA3 and pCTU1 from C. sakazakii BAA-894 and C. turicensis z3032. C. sakazakii BAA-894 and C. turicensis z3032 were successfully cured of pESA3 and pCTU1, respectively, after growing the strains in the presence of 1% SDS as described in Materials and Methods. Curing of pESA3 and

3262

FRANCO ET AL.

APPL. ENVIRON. MICROBIOL. TABLE 2. Plasmidotype patterns observed for Cronobacter isolates

Species

No. of isolates of the species

No. of isolates with the indicated plasmidotypea cpa

repA cpa

T6SS ⌬ cpa

Int L

vgrG

R end

FHA Int R

⌬ T6SS

fhaB

⌬ FHA

C. sakazakii C. malonaticus C. turicensis C. muytjensii C. dublinensis Genomospecies group 1

178 25 6 12 6 2

177 (99) 173 (98) 0 (0) 172 (97) 87 (49) 90 (51) 47 (27) 0 (0) 35 (19) 137 (77) 25 (100) 0 (0) 18 (72) 0 (0) 0 (0) 0 (0) 0 (0) 21 (84) 25 (100) 0 (0) 6 (100) 0 (0) 6 (100) 0 (0) 1 (16) 0 (0) 0 (0) 3 (50) 6 (100) 0 (0) 9 (75) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 5 (83) 0 (0) 1 (20) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 2 (100) 2 (100) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 2 (100) 2 (100) 0 (0)

Total

229

224 (97)

175 (78)

25 (11)

172 (76) 87 (38) 87 (38) 47 (20) 26 (11)

69 (30)

Iron acquisition dfhaB

eit

iuc

0 (0) 177 (100) 177 (100) 0 (0) 25 (100) 25 (100) 0 (0) 6 (100) 6 (100) 9 (100) 9 (100) 1 (11) 5 (100) 5 (100) 1 (20) 0 (0) 2 (100) 2 (100)

137 (61) 14 (6)

224 (100) 212 (95)

Cdiuc 0 (0) 0 (0) 0 (0) 9 (100) 5 (100) 0 (0)

14 (6)

a

Numbers within parentheses are the percent PCR positive for each gene locus in relation to the total number of plasmid-harboring strains of that species, except for the data for repA, which are in relation to the total number of strains.

pCTU1 and conservation of pESA2 in BAA-894 and pCTU2 and pCTU3 in z3032 were confirmed by plasmid extraction and agarose gel electrophoresis (curing of pESA3 is shown in Fig. S3 of the supplemental material). Furthermore, the plasmidcured derivatives of C. sakazakii BAA-894 and C. turicensis z3032 were PCR negative for all pESA3/pCTU1 plasmid targets (data not shown). Additionally, BAA-894 and z3032 wildtype and plasmid-cured derivative strains were PCR positive for the repA gene of pESA2/pCTU2, whereas PCR assays designed to detect the pCTU3 repA gene were positive in the wild-type strain and plasmid-cured derivative of C. turicensis z3032 (data not shown). Taken together, these results demonstrated that the plasmid-cured derivatives of these strains lacked only pESA3 or pCTU1 plasmids, respectively. Detection of RepFIB plasmids among Cronobacter spp. based on repA-targeted PCR. A total of 229 strains of Cronobacter spp. were screened by PCR, using primers targeting the repA gene, for the presence of a pESA3- or pCTU1-like plasmid. Among the six species groups, 224 strains (97%) were PCR positive for repA (Table 2). The five repA PCR-negative strains included three C. muytjensii strains, E456, E488, and ATCC 51329, C. sakazakii CDC 9363-75, and C. dublinensis CDC 0743-75. Kado and Lui (35) plasmid preparations from these five strains and from the plasmid-harboring and plasmidcured derivatives of C. sakazakii strain BAA-894 were subjected to agarose gel electrophoresis to confirm the repA PCR results (see Fig. S3 in the supplemental material). Except for C. muytjensii E488, four of the five repA PCR-negative strains, as well as the pESA3-cured derivative of C. sakazakii BAA894, did not harbor a pESA3-like plasmid compared to the wild-type control strain. Similar results were observed for the plasmid-harboring and plasmid-cured derivatives of C. turicensis strain z3032 (data not shown). Agarose gel electrophoresis did show a plasmid band of the appropriate size of pESA3 in C. muytjensii strain E488, most likely indicating that a nonRepFIB-like or a distantly related plasmid of similar size is present in this strain. Detection of Cronobacter species plasmid-borne putative virulence factor genes by PCR. The putative virulence genes or gene clusters and associated conserved flanking regions of pESA3 and pCTU1 identified from the in silico analysis were targeted in a PCR plasmid typing or “plasmidotyping” scheme. Specifically, these included the two shared iron acquisition

gene clusters, eitCBAD and iucABCD/iutA, as well as cpa, T6SS, and the FHA loci. Iron acquisition gene systems. PCR primers derived from eitA and iucC genes of pESA3/pCTU1 were used to screen for the presence of the eitCBAD and iucABC/iutA iron acquisition gene clusters, respectively (Table 1). All 224 plasmid-harboring Cronobacter species strains were PCR positive for eitA; however, only 212 (95%) of these strains were positive for iucC (Table 2). Strains negative for the iucC gene included four C. dublinensis strains (67%) and eight C. muytjensii strains (67%). In accordance with results of the repA PCR assay, we hypothesized that the negative results for the iucC PCR target observed for strains of C. dublinensis and C. muytjensii are likely explained by nucleotide sequence divergence. A large region of the iucC gene of C. dublinensis subsp. dublinensis strain LMG23823 was amplified using conserved primers and sequenced. From this sequence, CdiucC-specific primers were designed (Table 1), and these strains were retested. The results shown in Table 2 demonstrate that the iucABC/iutA cluster is present in the C. muytjensii and C. dublinensis strains previously thought to be negative for the iucABC/iutA cluster, and they confirm that all RepFIB plasmid-harboring Cronobacter spp. strains possess both iron acquisition gene clusters. cpa locus. PCR screening using cpa-specific primers (Fig. 3 and Table 1) revealed that the majority (173 of 177 [98%]) of the C. sakazakii isolates harbor the cpa gene. In addition, the two genomospecies group 1 strains were PCR positive for cpa (Table 2). All other Cronobacter species tested were PCR negative for cpa. To confirm these results, a second set of primers were designed, targeting the conserved flanking regions upstream and downstream of the cpa locus on both pESA3 and pCTU1 (primers ⌬cpa [Table 1; Fig. 3]). This PCR assay yields an amplicon of 303 bp if the cpa gene is absent, as is the case for pCTU1, and produces a 1,693-bp product if the gene is present, as is the case for pESA3 (Fig. 3). The results of the ⌬cpa PCR assay corroborated the results of the cpa PCR assay for the six C. turicensis, one C. dublinensis, and 18 C. malonaticus strains. In contrast, three of the four C. sakazakii strains that were PCR negative for the cpa gene also failed to produce a PCR product when we used the flanking region primers (⌬cpa), suggesting that the cpa gene is absent in these strains and that these regions were either deleted, rearranged, or their nucleotide sequences differed greatly from that of pESA3 and

VOL. 77, 2011


TABLE 3. T6SS patterns observed among 177 RepFIB plasmidharboring strains of C. sakazakii No. of C. sakazakii strains with T6SS pattern

T6SS Int L

vgrG

T6SS R end

T6SS Int R

2a 2 1 85 1 39 47b

⫺ ⫺ ⫺ ⫹ ⫹ ⫹ ⫹

⫺ ⫺ ⫹ ⫺ ⫺ ⫹ ⫹

⫺ ⫹ ⫹ ⫺ ⫹ ⫹ ⫹

⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫹

a The two plasmid-harboring C. sakazakii strains that did not contain T6SS loci were CDC 1059-77 and CDC 4963-71. b The T6SS PCR pattern of pESA3. Note that 175 of the 177 (98%) plasmidharboring C. sakazakii strains harbored at least a partial T6SS cluster.

pCTU1. The fourth strain, C. sakazakii ATCC 29544, gave an approximately 500-bp product with the ⌬cpa PCR assay. All of the C. muytjensii strains and four of the C. dublinensis strains did not produce a product when we used either set of primers. This was true even after efforts were made to reduce the PCR cycle annealing temperatures. T6SS locus. Due to the large size and known heterogeneity of T6SS gene clusters, four separate PCR assays were designed to characterize this cluster, based on the T6SS genes present on pESA3 (Table 1 and Fig. 4). The primers for the T6SS cluster target VgrG (ESA_pESA3p05500) are specific to the VgrG gene sequence present on pESA3. Furthermore, to assess whether the entire T6SS was absent, a fifth PCR assay was designed based on the conserved flanking regions of the T6SS present in both pESA3 and pCTU1 (primers ⌬T6SS [Table 1 and Fig. 4]). These primers amplify a 471-bp region in pCTU1 (lacks the T6SS) and flank the 16,937-bp T6SS region in pESA3, a fragment too large (17,377 bp) to be amplified under the PCR conditions utilized. DNA amplification in the T6SS PCR assays revealed that all plasmid-harboring C. malonaticus, C. muytjensii, C. dublinensis, and genomospecies group 1 strains were negative for the four T6SS targets (Table 2). One strain of C. turicensis, E688, was PCR positive for vgrG; however, this strain also produced the expected amplicon when we used the ⌬T6SS primers (Table 2), indicating that the amplified vgrG gene in this strain is located in a different T6SS locus, possibly one of the two loci previously described in C. turicensis z3032 which were found on the chromosome. In contrast, 175 of the 177 (98%) plasmid-harboring C. sakazakii strains encoded at least a partial T6SS cluster (Table 3), with most strains possessing the 5⬘ region of the cluster (Table 2, Int L). Additionally, 87 of the 177 plasmid-harboring C. sakazakii strains (49%) were positive for the T6SS effector gene vgrG, and 90 (51%) were positive for right side of the T6SS cluster (R end); however, only 47 (27%) were positive for the right integration site of the T6SS gene cluster (Int R) of pESA3. Three strains, C. sakazakii ATCC 29544, ES614, and ES617, appeared to only possess the 3⬘ region of the T6SS locus (Table 3). Analysis of the T6SS PCR results for the 177 plasmid-harboring strains of C. sakazakii revealed six distinct patterns (Table 3). Surprisingly, the T6SS PCR pattern associated with pESA3 was not the most commonly observed pat-

3263

tern; rather, a much-truncated version of the T6SS cluster was observed for the majority of the strains. These results suggest that this region of the plasmid is in great genetic flux, with either insertions or deletions most likely occurring in 3⬘ region of the gene cluster, which is further supported by the observed changes in the G⫹C content in this region (Fig. 1). To further investigate the approximate size of the T6SS cluster, a subset of C. sakazakii strains, which were PCR negative for the 3⬘ region of the T6SS cluster (T6SS R end and/or IntR), were subjected to long-range PCR analysis using either the ⌬T6SS or the T6SS Int R PCR primers. Results from these experiments corroborated that the most common T6SS cluster among C. sakazakii strains is much smaller than that of pESA3, ranging from 4 to 9 kb in size, and revealed that some T6SS clusters were much longer than that of pESA3, containing an additional 9 to 12 kb, and may represent an intact Cronobacter spp. RepFIB T6SS (see. Fig. S4 in the supplemental material). FHA locus. To determine the occurrence of the FHA locus in Cronobacter species RepFIB plasmids, we designed PCR primers targeting fhaB and the shared regions of pESA3 and pCTU1 flanking the FHA locus (Table 1 and Fig. 5). Primers ⌬FHA flank the 27,421-bp FHA locus in pCTU1 and yield a 668-bp amplicon when the locus is absent, as in pESA3. PCR screening revealed that all six of the C. turicensis strains, both of the genomospecies group 1 strains, and the 25 C. malonaticus strains harbored an FHA locus on their RepFIB plasmids (Table 2). Interestingly, 35 C. sakazakii strains (19%) also possessed an fhaB gene in addition to the pESA3-specific loci, cpa and T6SS. These results were corroborated by the ⌬FHA PCR assay (Table 2). None of the RepFIB plasmid-harboring strains of C. dublinensis or C. muytjensii strains yielded an amplicon for either the fhaB or the ⌬FHA locus in standard PCR assays; however, all strains yielded a weak fhaB PCR amplicon when the annealing temperature was lowered. The corresponding PCR product from C. dublinensis subsp. dublinensis LMG 23823 was sequenced. As expected, these two homologues were only 86% identical, accounting for the above results. Therefore, new primers were designed that were specific for the C. dublinensis subsp. dublinensis homologue of fhaB (primers dfhaB [Table 1]). PCR results using these primers showed that all plasmid-harboring C. dublinensis and C. muytjensii strains were positive for this target (Table 2), indicating that C. dublinensis and C. muytjensii RepFIB plasmids possess an fhaB-like locus, which we named CdfhaB. Evolution of the putative virulence plasmids in Cronobacter spp. Hierarchical clustering was performed for the eight targets, repA, C. turicensis fhaB (CtfhaB), C. dublinensis fhaB (CdfhaB), cpa, eitA, iucC, C. dublinensis iucC (CdiucC), and T6SS, screened from 224 plasmid-harboring Cronobacter spp. (Fig. 6). The clustering grouped the RepFIB plasmids of Cronobacter spp. into three major clades and revealed a strong correlation between plasmidotype and species. Ninety-eight percent of C. sakazakii strains clustered in clade 1A. Within this group, 80% of C. sakazakii strains harbored a plasmid similar to pESA3; that is, they contained eit and iuc clusters, cpa, and T6SS, but lacked the FHA locus. However, also found in this clade were those strains of C. sakazakii (19%) whose plasmids, in addition to the previously mentioned pESA3 gene targets, also possess an FHA locus. Clade 1B comprises C. malonaticus and C. turicensis. All strains of these species har-

3264

FRANCO ET AL.


FIG. 6. Hierarchical clustering of PCR prevalence results for 8 plasmids traits screened from among 224 Cronobacter species isolates. A positive PCR is indicated by a score of 1, and a negative reaction is indicated by a 0. A PCR-positive result of at least one of the targets of the T6SS was considered positive for the group as a whole. Cluster analysis was performed using the unweighted pair group method with arithmetic mean (UPGMA) found in the Bionumerics software suite of programs (Applied Maths, Inc., Austin, TX). The percentage of strains positive for each subgroup was rounded to the nearest whole number.

bor RepFIB plasmids with putative virulence traits identical to pCTU1; that is, they contain eit and iuc operons and an FHA locus but lack cpa and the T6SS locus. The two genomospecies group 1 strains were also clustered within clade 1B, possessing a RepFIB plasmid, which is a hybrid of pESA3 and pCTU1, containing the shared eit and iuc operons, as well as cpa and the FHA locus. Clade 2 contained the RepFIB plasmids of all C. dublinensis and C. muytjensii strains. All strain information and results have been submitted to the Pathogen Annotated Tracking Resource Network (PATRN), located at http://www.patrn.net (63) and they are available to all users after a free registration process. DISCUSSION The IncF group of plasmids, harbored by many enteric pathogens, consists of eight related replicon designations: RepFIA, RepFIB, RepFIC, RepFIV, RepFV, RepFVI, RepFVII, and RepFIIA (9, 33, 54). IncF plasmids range in size from 1 kb to several hundred kilobases and from 1 copy to several hundred copies per cell, with all known members possessing an additional origin of replication, usually RepFIIA. For example, pCoo and pECOS88 harbored by E. coli strains possess dual cointegrated replication regions, consisting of both RepI1 and RepFIIA replicon sites or RepFIB and RepFIIA replicon sites, respectively (22, 52, 59). In silico analysis showed that Cronobacter species plasmids pESA3 and pCTU1 have a single replicon of the incompatibility group RepFIB. The origin of replication gene has proven to be a useful gene target in the development of both DNA hybridization-based (14) and PCRbased plasmid classification systems (7), i.e., it is widely accepted that the presence of an origin of replication gene detected by PCR is synonymous with the presence of a plasmid of that incompatibility group (7, 50). PCR analysis using primers derived from the repA genes of pESA3 and pCTU1 indicated that most Cronobacter spp. harbor a homologous RepFIB plasmid. The exception to this, on a species level, is C. muytjensii,

for which only 75% of the strains tested were positive for the repA gene. The high prevalence of these plasmids in Cronobacter spp. supports the hypothesis that these plasmids play an important role in these bacteria. Iron is an essential microelement for bacteria (15, 23). It is required as a cofactor for important enzymes involved in many fundamental cellular processes, including electron transfer, cellular respiration, and superoxide metabolism. Iron is also an important factor for bacterial pathogenesis (6, 49, 66). As part of the innate immune system, human hosts limit iron availability via iron-binding proteins in order to reduce the level of free iron to levels that will not support bacterial growth. A pathogen’s ability to acquire iron from its host during infection is crucial for successful pathogenesis. Under iron starvation growth conditions, bacteria produce high-affinity iron-binding molecules, such as siderophores, to scavenge iron from their environment. The iron-siderophore complexes are transported into bacteria by specific iron transport systems. Most iron transport systems consist of an outer membrane receptor, a periplasmic binding protein, and an ABC transporter formed by permease and ATPase proteins (19, 39). Plasmids pESA3 and pCTU1 contain two clusters of genes, a homologue of an ABC transport-mediated iron uptake and siderophore system (eitCBAD operon) and a siderophore-mediated iron acquisition system (iucABCD/iutA operon). In the present study, we successfully cured pESA3 and pCTU1 and we showed that both plasmids, but not the BAA-894 or z3032 chromosomes, encode active siderophores. Further, our PCR results showed that all Cronobacter species RepFIB plasmids contain both the eitCBAD and iucABCD/iutA iron acquisition operons. These results suggest that presence of these plasmids may be crucial for systemic survival of Cronobacter spp. in a host. The Cronobacter species RepFIB plasmids have evolved by acquisition, or deletion, of a number of putative species-specific virulence traits, including the cpa gene as well as the T6SS and FHA locus. Hierarchical clustering of the PCR results (Fig. 6) targeting the various plasmid virulence traits revealed

VOL. 77, 2011


that the Cronobacter species group as clades, and the clustering results are in agreement with previous phylogenetic clustering results based on chromosomal targets, namely, 16S rRNA (28, 29), and genomic DNA microarray results as described by Healy et al. (25). Acquisition of these virulence traits, in some cases, appears to be species specific, for example, the T6SS on plasmids of C. sakazakii, suggesting recent acquisition. Conversely, the distribution of the FHA locus, which is present in 100% of Cronobacter spp. except C. sakazakii (19% presence), suggests a loss of this locus by most strains of C. sakazakii. The evolutionary history of the cpa gene is less clear; the distribution of the gene locus among the strains of Cronobacter spp. used in this study suggests that the gene was acquired on the RepFIB plasmids of C. sakazakii and genomospecies group 1 as separate events. Taken together, we hypothesize that the ancestral Cronobacter species RepFIB plasmid possessed the eit and iuc operons, as well as the FHA locus, plasmidotype characteristics of current C. turicensis and C. malonaticus strains. Interestingly, RepFIB virulence plasmids pLVPK of Klebsiella pneumoniae, pECOS88 from E. coli, and pAPEC-01colBM and pAPEC-02-colV from avian pathogenic E. coli, in addition to possessing a common repA also contain one or both iron acquisition operons present on the RepFIB Cronobacter plasmids (9, 33, 52). Furthermore, similar to pESA3, plasmids pECOS88 and pAPEC-01-colBM contain a gene homologous to cpa (33, 52). Apparently, these virulence plasmids and Cronobacter species RepFIB plasmids have evolved from a common ancestor, and the repA gene and the eitCBAD (eitABCD) and iucABCD/iutA iron acquisition operons remain as part of the archetypical backbone of these plasmids. Phylogenetic cluster analysis based on the nucleotide sequence of the repA gene supports the hierachical clustering of the plasmid virulence target PCR results. As before, C. dublinensis and C. muytjensii formed a separate clade (clade 2) within the cluster of the Cronobacter species (Fig. 2). The high variability in the repA sequence between the Cronobacter species, compared to E. coli and Y. pestis, suggests that these plasmids were acquired long ago in the evolutionary history of the genus Cronobacter. The correlations of plasmidotype and repA sequence with each species suggests that these plasmids have evolved independently in each species. Results of the mating experiments confirmed that these RepFIB plasmids are not mobilizable by conjugative plasmids present in the same strain. With regard to the T6SS gene cluster found on the RepFIB plasmids of the C. sakazakii strains used in this study, we observed considerable variation (Table 3). Indeed, the T6SS gene cluster represented by the gene architecture encoded on pESA3 was not the most common type observed. These results support the observations by Boneman et al. (4) and others (5) that among enteric Gram-negative bacteria, significant variability in T6SS gene architecture exists. Recently, Jani and Cotter (31) described three roles that T6SSs may play during host-microbe interactions: (i) T6SSs act as a delivery system of effector proteins, e.g., Hcp1, VgrG, and other toxins (31, 44, 45); (ii) T6SSs act as a host immune modulation system; (iii) T6SSs may influence interbacterial interactions and relationships within a host. Although the role of the T6SS in C. sakazakii is currently not known, studies with Helicobacter hepaticus

3265

and S. enterica serovar Typhimurium, reported by Chow and Mazmanian (10) and Parsons and Heffron (51), respectively, suggest that infections with wild-type strains of these organisms lead to a milder inflammatory response and less colonization than that with their T6SS isogenic mutants, which were found to cause an increased host inflammatory response and could colonize host systems better than isogenic wild-type strains. It is intriguing that most C. sakazakii strains harbor a plasmidborne T6SS gene cluster that is reduced in size (Table 3). Without T6SS core components these strains may naturally supercolonize host environments, causing a greater proinflammatory response. Studies are under way in our laboratory to understand the critical size needed for full functionality of the T6SS cluster in Cronobacter spp. in comparison to T6SS clusters of other enteric pathogens. Although there are examples of isolates obtained from clinical sources in all of the species groups analyzed in this study, except for the genomospecies group 1, we did not observe any correlation between source, clinical relevance, and plasmidotype. However, better surveillance and epidemiological studies combined with functional studies of the various putative virulence factors are needed. Two important evolutionary points can be deduced from the results of this study: that these plasmids have evolved in a similar way as the chromosomal genome of the Cronobacter species and that C. dublinensis and C. muytjensii strains (clade 2) have diverged significantly from the other species to a point at which PCR primers designed from pESA3 and pCTU1 nucleotide sequences will not anneal to homologous genes that are not highly conserved. This is supported by the fact that all C. dublinensis and C. muytjensii strains were fhaB and iucC positive only when specific primers derived from C. dublinensis CdfhaB and CdiucC were used. This conclusion would explain the negative results observed for both the cpa gene and T6SS locus, given that a binary opposition strategy was used (Table 1). Recently, we demonstrated that Cpa, encoded by pESA3, provides serum resistance to C. sakazakii BAA-894 by proteolytically cleaving complement components, as well as the activation of the human proenzyme plasminogen to plasmin and the inactivation of the plasmin inhibitor ␣2-AP (21). In the current studies, we demonstrated the functionality of the iuc siderophore acquisition system encoded on pESA3 and pCTU1. Together, these properties may contribute to the systemic survival of C. sakazakii and subsequent invasion of the central nervous system to cause disease. In conclusion, we have demonstrated that pESA3 and pCTU1 encode active siderophores, and in silico analysis have shown that these plasmids encode other potential virulence factors, including Cpa, a T6SS, and a filamentous hemagglutinin. A repA-targeted PCR assay revealed that most Cronobacter species strains harbor a homologous RepFIB-like plasmid, and hierarchical clustering of virulence factor PCR assay results combined with phylogenetic analysis of repA sequences demonstrated a strong correlation between the RepFIB-like plasmid type, or “plasmidotype,” with specific Cronobacter spp., suggesting that these nonmobile plasmids were acquired long ago and have coevolved with each of the different species in a fashion similar to their chromosomal genomes. Further, our results support the hypothesis that these plasmids have

3266

FRANCO ET AL.

evolved from an ancestral plasmid whose elements persist in the form of conserved backbone genes and gene clusters, such as the eitCBAD and iucABCD/iutA iron acquisition systems, yet have evolved through the cointegration of virulence traits that may be essential for and specific to the respective pathotypes of each species. Clearly, representative RepFIB plasmids from more Cronobacter spp. need to be sequenced and compared to further corroborate or refute these conclusions. The current study provides significant new insights into the contribution of pESA3 and closely related pCTU1 in the virulence of Cronobacter spp. Furthermore, this study also helps in understanding the molecular evolution of these plasmids in Cronobacter species strains. ACKNOWLEDGMENTS When this study started, L. Hu was an FDA Commissioner’s Fellow; she is now an Oak Ridge Institute for Science and Education (ORISE) fellow. K. G. Jarvis and C. J. Grim are also ORISE fellows, and we thank the FDA’s Office of the Commissioner and the Department of Energy for their support. We also thank the Joint Institute of Food Safety and Applied Nutrition Internship and Washington Internship Programs for the support of undergraduate students J. Sadowski, C. Lee, and J. Kim, respectively. Lastly, we thank M. Kotewicz for critically reading the manuscript and for offering helpful comments. REFERENCES 1. Arai, H., and Y. Sato. 1976. Separation and characterization of two distinct hemagglutinins contained in purified leukocytosis-promoting factor from Bordetella pertussis. Biochem. Biophys. Acta 444:765–782. 2. Biering, G., et al. 1989. Three cases of neonatal meningitis caused by Enterobacter sakazakii in powdered milk. J. Clin. Microbiol. 27:2054–2056. 3. Bogard, R. W., and J. D. Oliver. 2007. Role of iron in human serum resistance of the clinical and environmental Vibrio vulnificus genotypes. Appl. Environ. Microbiol. 73:7501–7505. 4. Bonemann, G., A. Pietrosiuk, A. Diemand, H. Zentgraf, and A. Mogk. 2009. Remodeling of VipA/VipB tubules by ClpV-mediated threading is crucial for type VI protein secretion. EMBO J. 28:315–325. 5. Boyer, F., G. Fichant, J. Berthod, Y. Vandenbrouck, and I. Attree. 2009. Dissecting the bacterial type VI secretion system by a genome wide in silico analysis: what can be learned from available microbial genomic resources? BMC Genomics 10:104. 6. Calderwood, S. B., and J. J. Mekalanos. 1987. Iron regulation of Shiga-like toxin expression in Escherichia coli is mediated by the fur locus. J. Bacteriol. 169:4759–4764. 7. Carattoli, A., et al. 2005. Identification of plasmids by PCR-based replicon typing. J. Microbiol. Methods 63:219–228. 8. Centers for Disease Control and Prevention. 2002. Enterobacter sakazakii infections associated with the use of powdered infant formula—Tennessee. MMWR Morb. Mortal. Wkly. Rep. 51:297–300. 9. Chen, Y. T., et al. 2004. Sequencing and analysis of the large virulence plasmid pLVPK of Klebsiella pneumoniae CG43. Gene 337:189–198. 10. Chow, J., and S. K. Mazmanian. 2010. A pathobiont of the microbiota balances host colonization and intestinal inflammation. Cell Host Microbe 7:265–276. 11. Chu, C., and C.-H. Chiu. 2006. Evolution of the virulence plasmids of non-typhoid Salmonella and its association with antimicrobial resistance. Microbes Infect. 8:1931–1936. 12. Chun, J., A. Huq, and R. R. Colwell. 1999. Analysis of 16S-23S rRNA intergenic spacer regions of Vibrio cholerae and Vibrio mimicus. Appl. Environ. Microbiol. 65:2202–2208. 13. Clark, N. C., B. C. Hill, C. M. O’Hara, O. Steingrimsson, and R. C. Cooksey. 1990. Epidemiologic typing of Enterobacter sakazakii in two neonatal nosocomial outbreaks. Diagn. Microbiol. Infect. Dis. 13:467–472. 14. Couturier, M., F. Bex, P. L. Bergquist, and W. K. Mass. 1988. Identification and classification of bacterial plasmids. Microbiol. Rev. 52:375–395. 15. Crosa, J. H., and C. T. Walsh. 2002. Genetics and assembly line enzymology of siderophore biosynthesis in bacteria. Microbiol. Mol. Biol. Rev. 66:223– 249. 16. Datta, N., and R. W. Hedges. 1971. Compatibility groups among fi-R factors. Nature 234:222–223. 17. Donnenberg, M. S., and J. B. Kaper. 1991. Construction of an eae deletion mutant of enteropathogenic Escherichia coli by using a positive-selection suicide vector. Infect. Immun. 59:4310–4317.

APPL. ENVIRON. MICROBIOL. 18. Drudy, D., et al. 2006. Characterization of a collection of Enterobacter sakazakii isolates from environmental and food sources. Int. J. Food Microbiol. 110:127–134. 19. Faraldo-Gomez, J. D., and M. S. Sansom. 2003. Acquisition of siderophores in Gram-negative bacteria. Nat. Rev. Mol. Cell Biol. 4:105–116. 20. Farmer, J. J., III, M. A. Asbury, F. W. Hickman, D. J. Brenner, and the Enterobacteriaceae Study Group. 1980. Enterobacter sakazakii: a new species of “Enterobacteriaceae” isolated from clinical specimens. Int. J. Syst. Bacteriol. 30:569–584. 21. Franco, A. A., et al. 2011. Cpa, the outer membrane protease of Cronobacter sakazakii, activates plasminogen and mediates resistance to serum bactericidal activity. Infect. Immun. 79:1578–1587. 22. Froehlich, B., J. Parkhill, M. Sanders, N. A. Quail, and J. R. Scott. 2005. The pCoo plasmid of enterotoxigenic Escherichia coli is a mosaic cointegrate. J. Bacteriol. 187:6509–6516. 23. Griffiths, E. 1999. Iron in biological systems, p. 1–26. In J. Bullen and E. Griffiths (ed.), Iron and infection. Wiley, Chichester, United Kingdom. 24. Gupta, S. D., H. C. Wu, and P. D. Rick. 1997. A Salmonella typhimurium genetic locus which confers copper tolerance on copper-sensitive mutants of E. coli. J. Bacteriol. 179:4977–4984. 25. Healy, B., et al. 2009. Microarray-based genomic indexing of the Cronobacter genus (Enterobacter sakazakii). Int. J. Food Microbiol. 136:159–164. 26. Himelright, I., E. Harris, V. Lorch, and M. Anderson. 2002. Enterobacter sakazakii infections associated with the use of powdered infant formula— Tennessee, 2001. JAMA 287:2204–2205. 27. Hritonenko, V., and C. Stathopoulos. 2007. Omptin proteins: an expanding family of outer membrane proteases in Gram-negative Enterobacteriaceae. Mol. Membr. Biol. 24:395–406. 28. Iversen, C., M. Waddington, J. J. Farmer, and S. J. Forsythe. 2006. The biochemical differentiation of Enterobacter sakazakii genotypes. BMC Microbiol. 6:94. 29. Iversen, C., et al. 2008. Cronobacter gen. nov., a new genus to accommodate the biogroups of Enterobacter sakazakii, and proposal of Cronobacter sakazakii gen. nov., comb. nov., C. malonaticus sp. nov., C. turicensis sp. nov., C. muytjensii sp. nov., C. dublinensis sp. nov., Cronobacter genomospecies 1, and of three subspecies, C. dublinensis sp. nov. subsp. dublinensis subsp. nov., C. dublinensis sp. nov. subsp. lausannensis subsp. nov., and C. dublinensis sp. nov. subsp. lactaridi subsp. nov. Int. J. Sys. Evol. Microbiol. 58:1442–1447. 30. Jacob-Dubuisson, F., C. Locht, and R. Antoine. 2001. Two-partner secretion in Gram-negative bacteria: a thrifty, specific pathway for large virulence proteins. Mol. Microbiol. 40:306–313. 31. Jani, A., and P. A. Cotter. 2010. Type VI secretion: not just for pathogenesis anymore. Cell Host Microbe 8:2–6. 32. Jaradat, Z. W., Q. O. Ababneh, I. M. Saadoun, N. A. Samara, and A. M. Rashdan. 2009. Isolation of Cronobacter spp. (formerly Enterobacter sakazakii) from infant food, herbs and environmental samples and the subsequent identification and confirmation of the isolates using biochemical, chromogenic assays, PCR and 16S rRNA sequencing. BMC Microbiol. 9:225. 33. Johnson, T. J., and L. K. Nolan. 2009. Pathogenomics of the virulence plasmids of Escherichia coli. Microbiol. Mol. Biol. Rev. 73:750–774. 34. Juhas, M., D. W. Crook., and D. W. Hood. 2008. Type IV secretion systems: tools of bacterial horizontal gene transfer and virulence. Cell. Microbiol. 10:2377–2386. 35. Kado, C. I., and S. T. Liu. 1981. Rapid procedure for detection and isolation of large and small plasmids. J. Bacteriol. 145:1365–1373. 36. Kandhai, M. C., M. W. Reij, L. G. Gorris, O. Guillaume-Gentil, and M. van Schothorst. 2004. Occurrence of Enterobacter sakazakii in food production environments and households. Lancet 363:39–40. 37. Kaper, J. B., J. P. Nataro, and H. L. Mobley. 2004. Pathogenic Escherichia coli. Nat. Rev. Microbiol. 2:123–140. 38. Kleiman, M. B., S. D. Allen, P. Neal, and J. Reynolds. 1981. Meningoencephalitis and compartmentalization of the cerebral ventricles caused by Enterobacter sakazakii. J. Clin. Microbiol. 14:352–354. 39. Koster, W. 2001. ABC transporter-mediated uptake of iron, siderophores, heme and vitamin B12. Res. Microbiol. 152:291–301. 40. Kothary, M. H., B. A. McCardell, C. D. Frazar, D. Deer, and B. D. Tall. 2007. Characterization of the zinc-containing metalloprotease (zpx) and development of a species-specific detection method for Enterobacter sakazakii. Appl. Environ. Microbiol. 73:4142–4151. 41. Kucerova, E., et al. 2010. Genome sequence of Cronobacter sakazakii BAA894 and comparative genomic hybridization analysis with other Cronobacter species. PLoS One 5:e9556. 42. Kukkonen, M., et al. 2001. Protein regions important for plasminogen activation and inactivation of ␣2-antiplasmin in the surface protease Pla of Yersinia pestis. Mol. Microbiol. 40:1097–1111. 43. Kukkonen, M., and T. K. Kornhonen. 2004. The omptin family of enterobacterial surface proteases/adhesins: from housekeeping in Escherichia coli to systemic spread in Yersina pestis. Int. J. Med. Microbiol. 294:7–14. 44. Ma, A. T., S. McAuley, S. Pukatzki, and J. J. Mekalanos. 2009. Translocation of a Vibrio cholerae Type VI secretion effector requires bacterial endocytosis by host cells. Cell Host Microbe 5:234–243. 45. Ma, A. T., and J. J. Mekalanos. 2010. In vivo actin cross-linking induced by

VOL. 77, 2011

46.

47. 48. 49.

50. 51.

52.

53.

54. 55. 56.

57.


Vibrio cholerae type VI secretion system is associated with intestinal inflammation Proc. Natl. Acad. Sci. U. S. A. 107:4365–4370. Mellata, M., J. W. Touchman, and R. Curtiss III. 2009. Full sequence and comparative analysis of the plasmid pAPEC-1 of avian pathogenic E. coli X7122 (O78:K80:H9). PLoS One 4:e4232. Muytjens, H. L., et al. 1983. Analysis of eight cases of neonatal meningitis and sepsis due to Enterobacter sakazakii. J. Clin. Microbiol. 18:115–120. Nazarowec-White, M., and J. M. Farber. 1997. Enterobacter sakazakii: a review. Int. J. Food Microbiol. 34:103–113. Negre, V. L., et al. 2004. The siderophore receptor IroN, but not the highpathogenicity island or the hemin receptor ChuA, contributes to the bacteremic step of Escherichia coli neonatal meningitis. Infect. Immun. 72:1216– 1220. Novick, R. P. 1987. Plasmid incompatibility. Microbiol. Rev. 51:381–395. Parsons, D. A., and F. Heffron. 2005. sciS, an icmF homolog in Salmonella enterica serovar Typhimurium, limits intracellular replication and decreases virulence. Infect. Immun. 73:4338–4345. Peigne, C., et al. 2009. The plasmid of Escherichia coli strain S88 (O45:K1: H7) that causes neonatal meningitis is closely related to avian pathogenic E. coli plasmids and is associated with high level bacteremia in a neonatal rat meningitis model. Infect. Immun. 77:2272–2284. Ramu, P., et al. 2007. The surface protease PgtE of Salmonella enterica affects complement activity by proteolytically cleaving C3b, C4b and C5. FEBS Lett. 581:1716–1720. Saul, D., et al. 1989. Nucleotide sequence and replication characteristics of RepFIB, a basic replicon of IncF plasmids. J. Bacteriol. 171:2697–2707. Schwyn, B., and J. B. Neilands. 1987. Universal chemical assay for the detection and determination of siderophores. Anal. Biochem. 160:47–56. Shin, S. H., Y. Lim, S. E. Lee, N. W. Yang, and J. H. Rhee. 2001. CAS agar diffusion assay for the measurement of siderophores in biological fluids. J. Microbiol. Methods 44:89–95. Simmons, B. P., M. S. Gelfand, M. Haas, L. Metts, and J. Ferguson. 1989. Enterobacter sakazakii infections in neonates associated with intrinsic contamination of powdered infant formula. Infect. Control Hosp. Epidemiol. 10:398–401.

3267

58. Smith, H. W., and S. Halls. 1967. Studies on Escherichia coli enterotoxin. J. Pathol. Bacteriol. 93:531–543. 59. So, M., H. W. Boyer, M. Betlach, and S. Falkow. 1976. Molecular cloning of an Escherichia coli plasmid determinant than encodes for the production of heat-stable enterotoxin. J. Bacteriol. 128:463–472. 60. Sodeinde, O. A., and J. D. Goguen. 1989. Nucleotide sequence of the plasminogen activator gene of Yersinia pestis: relationship to ompT of Escherichia coli and gene E of Salmonella typhimurium. Infect. Immun. 57:1517–1523. 61. Stephan, R., A. Lehner, P. Tischler, and T. Rattei. 2011. Complete genome sequence of Cronobacter turicensis LMG 23827, a food-borne pathogen causing deaths in neonates. J. Bacteriol. 193:309–310. 62. Stoop, B., A. Lehner, C. Iversen, S. Fanning, and R. Stephan. 2009. Development and evaluation of rpoB based PCR systems to differentiate the six proposed species within the genus Cronobacter. Int. J. Food Microbiol. 136:165–168. 63. Tall, B. D., et al. 2010. Development and application of a Pathogen Annotated Tracking Resource Network (PATRN) system to aid analysis of foodborne pathogens, abstr. R-2447. Abstr. 110th Gen. Meet. Am. Soc. Microbiol. American Society for Microbiology, Washington, DC. 64. Tamura, K., M. Nei, and S. Kumar. 2004. Prospects for inferring very large phylogenies by using the neighbor-joining method. Proc. Natl. Acad. Sci. U. S. A. 101:11030–11035. 65. Tamura, K., J. Dudley, M. Nei, and S. Kumar. 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24:1596–1599. 66. Torres, A. G., P. Redford, R. A. Welch, and S. M. Payne. 2001. TonBdependent systems of uropathogenic Escherichia coli: aerobactin and heme transport and TonB are required for virulence in the mouse. Infect. Immun. 69:6179–6185. 67. Urmenyi, A. M., and A. White-Franklin. 1961. Neonatal death from pigmented coliform infection. Lancet i:313–315. 68. van Acker, J., et al. 2001. Outbreak of necrotizing enterocolitis associated with Enterobacter sakazakii in powdered milk formula. J. Clin. Microbiol. 39:293–297.