Dissociation between Rat Hippocampal CA1 and Dentate Gyrus Cells ...

GLUCOCORTICOIDS-CRH-ACTH-ADRENAL

Dissociation between Rat Hippocampal CA1 and Dentate Gyrus Cells in Their Response to Corticosterone: Effects on Calcium Channel Protein and Current Neeltje G. van Gemert, Diana M. M. Carvalho, Henk Karst, Siem van der Laan, Mingxu Zhang, Onno C. Meijer, Johannes W. Hell, and Marian Joe¨ls Swammerdam Institute for Life Sciences (N.G.G., D.M.M.C., H.K., M.J.), University of Amsterdam, 1098 XH Amsterdam, The Netherlands; Division of Medical Pharmacology (S.v.d.L., O.C.M.), Leiden/Amsterdam Center for Drug Research and Leiden University Medical Center, 2300 RC Leiden, The Netherlands; and Department of Pharmacology (M.Z., J.W.H.), University of Iowa, Iowa City, Iowa 52242; and Department of Neuroscience and Pharmacology (M.J.), University Medical Center Utrecht, Universiteitsweg 100, 3584 CG Utrecht, The Netherlands

Stress and corticosterone affect, via glucocorticoid receptors, cellular physiology in the rodent brain. A well-documented example concerns corticosteroid effects on high-voltage activated (L type) calcium currents in the hippocampal CA1 area. We tested whether corticosterone also affects calcium currents in another hippocampal area that highly expresses glucocorticoid receptors, i.e. the dentate gyrus (DG). Remarkably, corticosterone (100 nM, given for 20 min, 1– 4.5 hr before recording) did not change high-voltage activated calcium currents in the DG, whereas currents in the CA1 area of the same rats were increased. Follow-up studies revealed that no apparent dissociation between the two areas was observed with respect to transcriptional regulation of calcium channel subunits; thus, in both areas corticosterone increased mRNA levels of the calcium channel-␤4 but not the (␣) Cav1.2 subunit. At the protein level, however, ␤4 and Cav1.2 levels were significantly up-regulated by corticosterone in the CA1 but not the DG area. These data suggest that stress-induced elevations in the level of corticosterone result in a regionally differentiated physiological response that is not simply determined by the glucocorticoid receptor distribution and that the observed regional differentiation may be caused by a gene involved in the translational machinery or in mechanisms regulating mRNA or protein stability. (Endocrinology 150: 4615– 4624, 2009)

W

hen an organism is exposed to stress, the hypothalamus-pituitary-adrenal axis is activated, leading to increased secretion of glucocorticoids from the adrenal glands (1, 2). The main glucocorticoid in rodents, corticosterone, passes the blood-brain barrier and binds to two types of receptors: the mineralocorticoid (MR) and glucocorticoid receptor (GR). The MR binds corticosterone with high affinity and is therefore substantially occupied under basal conditions, whereas the low-affinity GR is fully occupied only when circulating corticosteroid levels are high, e.g. after stress (3). Both corticosteroid receptor types are highly expressed in principal neurons of the ro-

dent hippocampus. The MR is expressed in all hippocampal subfields, whereas the GR is extensively expressed in the CA1 area and dentate gyrus (DG) but at a lower level in area CA3 (4 –7). Due to the high expression of corticosteroid receptors in the hippocampus, stress and corticosterone affect many properties of cells in this area (8, 9). One of the main targets for corticosterone is the current flowing through voltage-dependent calcium channels (VDCCs). Acute stress and corticosterone application lead to a GR-dependent enhancement of calcium current amplitude in the CA1 area (10 –14); this process requires dimerization and

ISSN Print 0013-7227 ISSN Online 1945-7170 Printed in U.S.A. Copyright © 2009 by The Endocrine Society doi: 10.1210/en.2009-0525 Received May 8, 2009. Accepted June 24, 2009. First Published Online July 9, 2009

Abbreviations: ACSF, Artificial cerebrospinal fluid; DG, dentate gyrus; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GR, glucocorticoid receptor; HVA, high-voltage activated; milk-TBS, milk powder in TBS; MR, mineralocorticoid receptor; qPCR, quantitative PCR; SDS, sodium dodecyl sulfate; SSC, saline sodium citrate; TBS, Tris-buffered saline; Tfr, transferrin receptor; VDCC, voltage-dependent calcium channel.

Endocrinology, October 2009, 150(10):4615– 4624

endo.endojournals.org

4615

4616

van Gemert et al.

Glucocorticoids in CA1 and Dentate

DNA binding of GRs (13). It was recently shown that corticosterone affects the L- but not N-type calcium current, probably by increasing the number of available channels in the plasma membrane (14). Quantitative PCR analysis suggested that mRNA expression of the two VDCC subunits that can form the pore of neuronal L-type channels, Cav1.2 and Cav1.3 (15), is unaffected by corticosterone (14). However, expression of the auxiliary ␤4-subunit was increased 1 h after corticosterone incubation, which could account for the enhanced current, e.g. by increasing surface expression of the channel (16). These effects of corticosterone were found in the CA1 area. Much less is known about corticosteroid actions on calcium currents in the hippocampal DG, in which glucocorticoids were found to have strong transcriptional effects (e.g. Ref. 17), which could have equally strong consequences for hippocampal transmission. Preliminary observations in 3-wk handled animals indicate that corticosterone may be less efficient in changing calcium currents of DG than CA1 cells (18). It should be realized, though, that handling by itself can affect neuronal responsiveness to corticosterone, as earlier described for CA1 neurons (19). So far, the effect of acute GR activation on calcium currents in the DG of naive animals has not been studied. In the present study, we therefore examined whether the acute (1– 4.5 h after incubation) effect of corticosterone on voltage-dependent calcium currents in the DG is different from that in the CA1 area. If there are indeed regional differences, one may wonder whether the hormone targets the same or different genes in the two areas. Hence, we investigated, in both the CA1 and DG area, the effects of corticosterone on the most obvious targets for the hormone leading to changes in calcium current amplitude, i.e. the relevant VDCC ␣- and ␤-subunits (20). We focused on the Cav1.2 ␣-subunit, which is the pore-forming subunit responsible for most of the L-type current in hippocampal cells (21–23), and the ␤4-subunit, which was found to be transcriptionally regulated in CA1 cells (14). The hormonal regulation of these subunits was studied at the transcript as well as the protein level.

Materials and Methods


Electrophysiology Rats (n ⫽ 12) were taken out of their home cage at 0930 h and quickly decapitated, i.e. under conditions that corticosterone levels are very low (e.g. see Ref. 14). Trunk blood was collected and centrifuged for 20 min at 5000 rpm (room temperature). Plasma was stored at ⫺20 C for later determination of corticosterone levels by RIA. Plasma corticosterone levels cannot be easily translated to central levels, in view of the peripheral presence of hormone binding globulins. The brain was removed from the skull and put in ice-cold carbogenated (95% O2-5% CO2) dissection buffer (14); 400-␮m coronal slices were cut on a vibroslicer (VT 1000S; Leica, Heidelberg, Germany). Slices were kept in carbogenated artificial cerebrospinal fluid (ACSF) (see Ref. 14). After 1 h equilibration in ACSF at room temperature, slices were incubated for 20 min in vitro with 100 nM corticosterone (dissolved in 0.01% ethanol; Sigma, Zwijndrecht, The Netherlands) or vehicle solution at 32 C. After this, slices were left for more than 1 h in ACSF at room temperature to allow time for development of genomic effects. Hippocampal slices were transferred one at a time to a recording chamber and continuously perfused with warm (⬃32 C) carbogenated ACSF containing the following compounds to block Na⫹ and K⫹ currents: tetrodotoxin (0.5 ␮M), tetraethylammonium-Cl (10 mM), 4-aminopyridin (5 mM), and CsCl (5 mM). Cells were visualized using an upright microscope (104 Optiphot, ⫻40 water immersion objective, ⫻10 ocular; Nikon, Tokyo, Japan). Patch pipettes for whole-cell recording were pulled from borosilicate glass (1.5 mm outer diameter, impedance 3– 4 M⍀) on a Sutter puller and filled with recording solution as described earlier (14). Calcium currents were recorded with an Axopatch 200B amplifier (Axon Instruments, Foster City, CA). Series resistance was compensated for about 70%. Currents were evoked by 200-msec pulses to increasing voltage levels (between ⫺80 and 0 mV), either from a 3-sec hyperpolarizing prepulse at ⫺130 mV or directly from holding potential (⫺65 mV) (Fig. 1A). Currents evoked after a hyperpolarizing prepulse are considered to represent the total voltage-dependent calcium current; when stepping directly from holding potential, the focus is on high-voltage activated currents. For each sweep, peak and sustained components were analyzed (Fig. 1B). A period of 10 sec was introduced between successive pulses to allow extrusion of calcium ions. Data acquisition/analysis was performed with PClamp/Clampfit software (version 8.2; Axon Instruments). Correction for leak current was applied offline. Membrane capacitance was read directly off the capacitance compensation potentiometer on the amplifier. For each experimental group, we recorded between one and three cells per animal, with an average of two. No more than one cell was recorded per slice.

Animals All experiments were approved by the Animal Experiment Committee (DED135). Male Wistar rats (6 – 8 wk of age, ⬃150 g; Harlan, Horst, The Netherlands) were group housed on a 12-h light, 12-h dark cycle (lights on 0800 h) with access to food and water ad libitum. All animals were adrenally intact so that MRs were already substantially occupied and effects caused by corticosterone administration expected to be mediated via GRs (24). We confined our investigations to the dorsal half of the hippocampus to avoid septotemporal differentiation (25).

In situ hybridization Animals (n ⫽ 8 per group) were either left undisturbed in their home cage (naive group) or received a sc injection with corticosterone (10 mg per 100 g body weight; in arachide oil) (cort group) or vehicle (veh group) in a total volume of 500 ␮l. One hour after the injection, at 0930 h, nonstressed animals were taken from their home cage and quickly decapitated. Trunk blood was collected and plasma stored to determine corticosterone levels. Brains were removed from the skull and frozen on dry



0 mV

A

B

total

-65 mV

3s

200 ms

0 mV

HVA

-65 mV -80 mV

200 ms

voltage (mV)

C

sustained

peak

-65 mV

-80 mV -130 mV

voltage (mV)

D

0

0 -60

-50

-40

4617

-30

-20

-10

-150

CORT

-50

-40

-30

-20

-10

0 -50

-100

-150

VEH CORT

current density (pA/pF)

-100

current density (pA/pF)

-50

VEH

-60

0

-200

-200

FIG. 1. Differential effects of corticosterone on calcium currents in CA1 and DG cells. A, Total calcium current was evoked with the voltage protocol shown on top. A 3-sec hyperpolarizing prepulse was given to activate all VDCCs. When stepping directly from holding potential with the voltage protocol shown below, only part (HVA) of the currents are activated. Results presented here focus on the latter protocol. B, Typical HVA current (evoked by a voltage step to 0 mV) indicating how the peak and sustained part of each trace were determined. Current density is shown as a function of voltage for HVA calcium currents in CA1 pyramidal cells (C) and DG cells (D) incubated 1– 4.5 h earlier with vehicle solution (VEH) or corticosterone (CORT; 100 nM). Here only values in the range from ⫺50 to 0 mV are depicted because currents evoked by more negative steps were negligible. Each point represents the average ⫾ SEM. Data were obtained in n cells and N animals: CA1/vehicle, n ⫽ 8 (n ⫽ 5); CA1/corticosterone, n ⫽ 5 (n ⫽ 4); DG/vehicle, n ⫽ 15 (n ⫽ 7); DG/corticosterone, n ⫽ 15 (n ⫽ 7).

ice. On a cryostat, 12-␮m-thick coronal sections containing the hippocampus were cut, put on SuperFrost Plus slides (MenzelGlaser, Braunschweig, Germany), and stored at ⫺80 C. Sections were fixed with 4% paraformaldehyde (Sigma) for at least 30 min and subsequently washed twice in PBS. Then sections were acetylated for 10 min in 0.1 M triethanolamine (pH 8.0) with 0.25% acetic anhydride, washed in 2⫻ saline sodium citrate (SSC) for 10 min, and dehydrated in an ethanol series (50, 80, 100, 100%; 1 min each).

The different oligonucleotide probes (0.33 pmol; see Table 1) were end labeled with 35S-dATP (NEN Life Science Products, Boston, MA) using terminal deoxynucleotidyl transferase (Promega, Madison, WI), purified with chloroform extraction, and ethanol precipitated. Per slide, 100 ␮l hybridization mix containing 50% formamide, 10% dextran sulfate, 20 mM dithiothreitol, 25 mM NaSO4, 1 mM Na-pyrophosphate, 4⫻ SSC, 5⫻ Denhardt’s solution, 100 ␮g/ml poly A, 100 ␮g/ml herring sperm DNA, and 1 ⫻ 106 cpm of the oligonucleotide probe was added.

TABLE 1. Oligonucleotides and mismatch control sequences (with eight nucleotide alterations each; in uppercase) used for mRNA in situ hybridization and the duration of exposure to film (in days) Gene

Oligonucleotide sequence (5ⴕ–3ⴕ)

Mismatch control sequence (5ⴕ–3ⴕ)

Exposure

Cav1.2 ␤1 ␤2 ␤3 ␤4

gtgggtggggattctccatctgctgtaatggacttcagctcaatt ctgttgtcggtcatctcctcctcataatcttcctcctcttcccag tgtggccattgctgctgtggctctcctctctgtggttatgttca gttctctaacagagctacagccatgagctgtctgtcctgcctca ttgctatgcctcatccgctgactctgtagtccagagattgctgtg

gtTggtggTgattcGccatcGgctgtCatggaAttcagAtcaatG cGgttgtAggtcaGctcctActcatCatcttActcctAttcccCg GgtggcAattgcTgctgtTgctctActctcGgtggtGatgttAa TttctcGaacagCgctacCgccatTagctgGctgtcAtgcctAa tGgctatTcctcaGccgctTactctTtagtcAagagaGtgctgGg

21 5 20 13 14

␤1 ␤2 ␤3

CA1/naïve

CA1/vehicle

CA1/corticosterone

DG/naïve

DG/vehicle

DG/corticosterone

118.5 ⫾ 4.8 57.8 ⫾ 6.3 47.0 ⫾ 1.8

120.4 ⫾ 3.4 64.3 ⫾ 8.2 49.9 ⫾ 2.3

121.7 ⫾ 4.1 65.6 ⫾ 3.0 46.7 ⫾ 0.7

130.4 ⫾ 5.0 51.7 ⫾ 7.3 57.6 ⫾ 2.1

132.6 ⫾ 3.5 65.9 ⫾ 9.5 60.6 ⫾ 2.2

133.5 ⫾ 3.9 63.6 ⫾ 4.9 58.8 ⫾ 0.9

The numbers show the ␤1–3 subunit mRNA expression in CA1 area or DG of naïve, vehicle-injected, and corticosterone-injected animals. OD is expressed in arbitrary units (average ⫾ SEM). None of the treatments resulted in significant effects for any of these ␤-subunits. Results based on n ⫽ 8 animals per experimental group.

4618

van Gemert et al.


Sections were coverslipped and incubated overnight at 42 C. The next day, coverslips were removed and sections were rinsed in 1⫻ SSC at room temperature, washed in 1⫻ SSC twice for 30 min at 50 C, and once for 5 min at room temperature. Slides were dehydrated in an alcohol series, air dried, and exposed to a Biomax MR film (Kodak, Rochester, NY) for different durations (see Table 1), depending on signal intensity. Four hippocampal sections per probe per animal were scanned and loaded into Image J (Image J, version 1.37; National Institutes of Health, Bethesda, MD). Gray values of the cell layers CA1, CA3, and dentate gyrus were measured. Quantification of gray values was calibrated using [14C]microscales (Amersham, Aylesbury, UK). Per animal, the gray values for each region were averaged. The values of all animals of the same group were averaged.

Western blot Data from 31 animals were used for the Western blot experiments. Hippocampal slices were prepared and incubated with vehicle solution or corticosterone as described for the electrophysiology experiments. Two to 3 h after incubation, the CA1 area and dentate gyrus were dissected from each slice under a binocular, immediately frozen on dry ice, and stored at ⫺80 C until use. Per sample, CA1 or DG tissue from five to nine hippocampal slices was used. Samples were homogenized in 250 ␮l ice-cold sucrose buffer containing sucrose (300 mM), Tris (10 mM), EGTA (10 mM), and EDTA (10 mM). Protease inhibitors were added to the buffer: 1 ␮g/ml pepstatin A, 200 ␮M phenylmethanesulfonyl fluoride, 10 ␮g/ml leupeptin, and 20 ␮g/ml aprotinin. The homogenate was spun for 2 min at 5000 ⫻ g to remove larger cell fragments and nuclei, and the supernatant was centrifuged for 8 min at 7000 rpm. The pellet from this spin (P2) is enriched in heavy membranes, including the plasma membrane. The supernatant of the second spin was centrifuged for 30 min at 70,000 rpm in a TLA 100.3 ultracentrifuge rotor (Beckman, Palo Alto, CA). The pellet from this ultracentrifuge spin (P3) is enriched in light membranes. Both pellets (P2 and P3) were resuspended separately in 100 ␮l 1% sodium dodecyl sulfate (SDS), sonicated for 20 sec, and heated to 60 C for 10 min. Subsequently proteins were extracted with SDS sample buffer for 20 min at 65 C, and 30 ␮l per sample were run on SDS-PAGE and transferred to a polyvinyl difluoride membrane (Bio-Rad, Hercules, CA). The membrane was blocked by incubation for 1 h with 10% milk powder in Tris-buffered saline (TBS) (milk-TBS) and blots were incubated with monoclonal mouse antibody against ␤4 (NeuroMab, Davis, CA; 1:500) and polyclonal rabbit antibody against Cav1.2 in milk-TBS for 4 h at room temperature. To control for the amount of protein loaded per sample, blots were stained with antibodies for glyceraldehyde-3-phosphate dehydrogenase (GAPDH; Chemicon, Temecula, CA; 1:5000) and transferrin receptor (Tfr; Zymed Laboratories Inc., San Francisco, CA; 1:500). Blots were washed three times with milk-TBS and incubated with secondary antibody (horseradish peroxidase-bound sheep-antimouse; Amersham, Piscataway, NJ) diluted 1:5000 in milk-TBS. Subsequently blots were washed in 0.05% Tween 20 in TBS for at least 1 h (four changes) and then in TBS for 20 min, and ECL Plus reagent (Amersham) or Super Signal West Femto (Pierce Biotechnology, Rockford, IL) was applied. ECL or Femto signals were detected by film exposure, scanned, and quantified with Image J (National Institutes of Health).


Gray values were corrected for background and per sample Cav␤4 or Cav1.2 protein expression was corrected for GAPDH (␤4) or Tfr (Cav1.2) immunosignal intensity, respectively. Both GAPDH and Tfr protein expression are unaltered by corticosterone (data not shown) so that the use of different standards should not affect the outcome of the experiments. Gray values in the vehicle-treated groups were set at 100%, and relative change as a result of corticosterone incubation was calculated. For Cav1.2 we saw two bands, consistent with earlier reports on proteolytic processing of the C terminus of Cav1.2 (21). We quantified the whole area spanning both bands because there were no obvious differences in the ratios of the Cav1.2 long to short form.

Data analysis All data are presented as mean ⫾ SEM. Data on the calcium current amplitude was analyzed with a general linear model for repeated measures, with corticosterone/vehicle treatment as the independent factor. Capacitance was compared between the DG and CA1 region with two-way ANOVA, with region and treatment as between-subjects factors. For the in situ hybridization experiments, data were analyzed using a univariate analysis, with region and treatment as fixed variables followed by post hoc comparisons of the mean (significant differences). Statistical analysis of the Western blot data were performed with a paired t test for vehicle vs. corticosterone-incubated samples.

Results Electrophysiology We recorded 43 hippocampal cells, divided over four experimental groups (CA1 vs. DG, ⫾ corticosterone (CORT); for group sizes see legend of Fig. 1). With respect to capacitance, a main effect of region (P ⬍ 0.0001) but not treatment (P ⫽ 0.18) was observed nor an interaction between region and treatment (P ⫽ 0.27). Post hoc analysis revealed that the membrane capacitance was significantly smaller in DG than CA1 cells (CA1: 40.8 ⫾ 2.2 pF; DG: 11.6 ⫾ 0.6 pF; P ⬍ 0.0001), suggesting a smaller cell surface of DG cells. To examine the effects of corticosterone, we concentrated on high-voltage activated (HVA) currents because particularly the L-type calcium current amplitude is affected by hormone treatment in CA1 neurons (10, 14). Cells in the CA1 region or DG were recorded 1– 4.5 h after a 20-min application of 100 nM corticosterone (mean delay ⫾ SEM: 168 ⫾ 12 min); this concentration is sufficient to enhance calcium current amplitude in the CA1 area via DNA binding of GR homodimers (13). As expected (10, 11, 13), HVA calcium currents in the CA1 area were significantly increased in the range of voltage steps between ⫺20 and 0 mV (F1,11 ⫽ 8.2, P ⬍ 0.05, not shown). Similarly, current density over this range was significantly enhanced by corticosterone (F1,11 ⫽ 12.9, P ⬍ 0.005, Fig. 1C). In the DG, however, corticosterone


did not affect the peak amplitude of HVA calcium currents at all (F1,28 ⫽ 0.13, P ⫽ 0.72) or the current density (F1,28 ⫽ 0.012, P ⫽ 0.92, Fig. 1D) over the same range or any other range. Also for the sustained component of the HVA current, which mostly represents L-type calcium currents (14), a significant enhancement by corticosterone was observed for voltage steps in the range of ⫺20 to 0 mV in the CA1 area (F1,11 ⫽ 4.9, P ⬍ 0.05; data not shown) but not the DG (F1,28 ⫽ 0.33, P ⫽ 0.57). In the DG, the peak HVA amplitude at ⫺20 mV (i.e. the maximal current) as seen 1–2 h after corticosterone treatment (mean ⫾ SEM: 1.5 ⫾ 0.3 nA, n ⫽ 4) was comparable with that seen at later time points, i.e. 2–3 h (1.4 ⫾ 0.3 nA, n ⫽ 8) or more than 3 h after treatment (1.8 ⫾ 0.3 nA, n ⫽ 3; ANOVA over the three time bins: F2,12 ⫽ 0.61, P ⫽ 0.6); values for all of these bins were in the same range as the overall averaged value observed in vehicle-treated slices (1.7 ⫾ 0.2 nA). This argues against any slowly developing enhancement of calcium currents by corticosterone in the DG. In situ hybridization To test the hypothesis that the differential effect of corticosterone on calcium currents in CA1 vs. DG is due to differences in regulation of calcium channel subunit mRNA expression, we used in situ hybridization. We here only extensively describe and discuss the results of the most relevant subunits: the Cav1.2 ␣-subunit, the poreforming subunit of the L-type calcium channel (15) responsible for more than 80% of the L-type current in hippocampal cells (23), and the auxiliary ␤4 subunit, previously found to be transcriptionally regulated by corticosterone in the rodent CA1 area with quantitative PCR (qPCR) (14) and which, for example, plays a role in surface expression of the channel (16, 26). Hippocampal mRNA expression of the VDCC subunits was tested in naive animals and 1 h after injection with a high dose of corticosterone or vehicle. Plasma corticosterone levels were below the detection limit (i.e. 1 ␮g/dl) in most of the naive and vehicle-injected animals. In the corticosterone-injected group, plasma corticosterone level of one animal was greater than 2 SD removed from the mean; this animal was excluded from further analysis. In the remaining group (n ⫽ 7), the averaged plasma corticosterone level was 16.6 ⫾ 6.2 ␮g/dl, a concentration that will substantially activate GRs (24). Hybridization with the mismatch control probes never yielded any specific signal (data not shown). Figure 2 shows that signals for mRNA expression of the Cav1.2 subunit are moderately high in the CA3 area and DG, with lower levels in the CA1 region. Statistical analysis revealed a main effect of region (P ⬍ 0.0001) and


4619

FIG. 2. Calcium channel subunit Cav1.2 mRNA expression in the hippocampal subfields CA1, CA3, and DG. Expression (gray value in arbitrary units) was significantly decreased by an injection with vehicle solution (VEH) when compared with naive, whereas injection with a high dose of corticosterone (CORT) had no additional effect. On the right, hippocampal Cav1.2 mRNA hybridization signals are shown for a naive, vehicle-, and corticosterone-injected animal. Asterisk indicates significant difference between the groups (P ⬍ 0.05). These were based on n ⫽ 8 animals in the naive and vehicle-treated group and n ⫽ 7 in the corticosterone-injected group. Data of this study on the comparison between vehicle- and CORT-treated rats in CA1 were reported earlier (54). AU, Arbitrary units.

treatment (P ⬍ 0.001) but no interaction between treatment and area (F4,68 ⫽ 1.7, P ⫽ 0.17), indicating that, contrary to the hypothesis, all hippocampal areas responded similarly to the various treatments. In addition to testing the effect of treatment per area, we therefore also examined main effects of each treatment over all hippocampal subfields. Somewhat to our surprise, expression of the Cav1.2 subunit was significantly reduced in rats receiving a single vehicle injection vs. naive animals in all hippocampal areas (main effect naive vs. vehicle: P ⬍ 0.001; CA1: P ⬍ 0.05; CA3: P ⬍ 0.05; DG: P ⬍ 0.01). Importantly, though, there was no overall effect of corticosterone compared with vehicle injection (P ⬎ 0.05). A small decrease in Cav1.2 subunit expression was observed for corticosterone-injected vs. naive rats (P ⫽ 0.049), but this was not accompanied by significant effects in any hippocampal subfield (P ⬎ 0.05). Thus, corticosterone treatment had no appreciable effect on Cav1.2 mRNA expression in any hippocampal subfield compared with vehicle treatment or no treatment. The ␤4 subunit (Fig. 3) is moderately expressed in all hippocampal subfields. A significant main effect of region (P ⬍ 0.001) and treatment (P ⬍ 0.001) was observed but no interaction effect (F4,68 ⫽ 0.19, P ⫽ 0.94). A single vehicle injection overall increased ␤4 mRNA expression compared with naive (main effect: P ⫽ 0.014), although this did not reach significance in the subregions (naive vs. vehicle CA1: P ⫽ 0.24; CA3: P ⫽ 0.25; DG: P ⫽ 0.07). Injection with a high dose of corticosterone, however, resulted in a significantly increased expression of the ␤4 subunit in all hippocampal subfields when compared with the naive animals (main effect: P ⬍ 0.0001; naive vs. cor-

4620

van Gemert et al.


FIG. 3. Calcium channel subunit ␤4 mRNA expression in the hippocampal subfields CA1, CA3, and DG. Expression was significantly increased in all hippocampal subfields by an injection with corticosterone (CORT) solution when compared with naive animals. Injection with vehicle solution (VEH) had no significant effect. On the right, ␤4 mRNA hybridization signals in the hippocampus are shown for a naive, vehicle-, and corticosterone-injected animal. Asterisk indicates significant difference between the groups (P ⬍ 0.05). Based on n ⫽ 8 animals in the naive and vehicle-treated group and n ⫽ 7 in the corticosterone-injected group. AU, Arbitrary units.

ticosterone: P ⬍ 0.05 in all hippocampal subfields). The difference between animals injected with vehicle solution and those injected with corticosterone did not reach significance (main effect: P ⫽ 0.14). Other auxiliary ␤-subunits were not affected by any of the treatments (see Table 1). Western blot The corticosterone-induced effects on Ca-subunit expression cannot explain the difference in physiological effects between CA1 and DG because the hormone induced comparable expression pattern in the two areas, for both Cav1.2 and ␤4 subunits. We therefore next examined an intermediate level between the transcripts of calcium channel subunits on the one hand and calcium current amplitude on the other hand, i.e. the protein level of the channel subunits. Because changed currents may be the consequence of differences in subcellular localization of the channels, we determined immunoreactivity in various cell fractions. We first focused on the ␤4 subunit because mRNA expression of this subunit as assessed with in situ hybridization was increased in all hippocampal areas after a single injection with corticosterone when compared with naive animals and earlier qPCR studies in CA1 tissue described a consistent up-regulation of the ␤4 subunit (in tissue from naive animas) by corticosterone in both mice (14) and rats (Qin, Y.Q., S. Spijker, A.B. Smit, P. Chameau, and M. Jöels, personal communication). To test the specificity of the antibody, we used PC6 –3 cells, a derivative of PC12 cells in which the ␤4 subunit is not expressed (27, 28). Indeed, we detected no ␤4 protein in these cells (data not shown). Figure 4A shows the effects of 20 min in vitro


FIG. 4. Calcium channel subunit ␤4 protein expression in CA1 area (A) and DG (B). Protein level is expressed as percent change in corticosterone-incubated (cort) compared with vehicle-incubated (veh) slices. Immunosignal values were corrected for loading differences as determined by immunoblotting for GAPDH. P2 indicates pellet of the second spin, which is enriched for heavy membrane fragments. P3 indicates pellet of the third spin, which mainly contains light membrane fragments. Asterisk indicates significant difference from vehicle (P ⬍ 0.05). Below the graphs, typical examples of ␤4 expression are shown for each experimental group. Based on (paired) observations from n ⫽ 11 samples (each sample from a different animal) of CA1 tissue and n ⫽ 9 samples of DG tissue, for both the P2 and P3 fractions.

corticosterone incubation 2–3 h before the collection of hippocampal material on ␤4 protein expression in the CA1 area. In the fraction enriched in heavy membranes and especially plasma membranes (P2), ␤4 protein expression was increased by 46% in corticosterone- compared with vehicle-incubated slices (P ⬍ 0.05). In the fraction enriched in light membranes (P3), a significant 28% (P ⬍ 0.05) increase in ␤4 protein expression was found after incubation with 100 nM corticosterone. In the DG, however, ␤4 expression was not altered by corticosterone (P ⫽ 0.16 and 0.17 for P2 and P3, respectively; Fig. 4B). We next studied corticosterone-induced effects on Cav1.2 protein expression in the CA1 region and DG. Cav1.2 exists in several size forms, running between 180 and 240 kDa, due to proteolytic processing by calpain and also differential splicing (21, 29). In the CA1 area, incubation with 100 nM corticosterone led to a significant increase in total Cav1.2 subunit expression in the P2 (P ⬍ 0.05) and P3 fraction (P ⬍ 0.01) (Fig. 5A). However, in the DG, corticosterone did not affect Cav1.2 protein expression in the P2 (P ⫽ 0.39) or P3 fraction (P ⫽ 0.21).

Discussion Electrophysiology In the rodent CA1 area, corticosterone application has been repeatedly found to slowly increase calcium currents (10 –13), particularly of the L type (14). We here confirmed the slow enhancement of sustained HVA calcium current amplitude by corticosterone in the CA1 area. Remarkably, though, we found no effect of corticosterone on


FIG. 5. Calcium channel subunit Cav1.2 protein expression in CA1 area (A) and DG (B). Protein level is expressed as percent change in corticosterone-incubated (cort) compared with vehicle-incubated (veh) slices. Immunosignals were corrected for loading differences as determined by immunoblotting for Tfr. P2 is enriched for heavy and P3 for light membrane fragments. Asterisk indicates significant difference from vehicle (*, P ⬍ 0.05; **, P ⬍ 0.01). Below the graphs, typical examples of Cav1.2 expression are shown for each experimental group. These were based on (paired) observations from n ⫽ 11 samples (each sample from a different animal) of CA1 tissue and n ⫽ 10 samples of DG tissue for the P2 fraction and n ⫽ 6 and 7, respectively, for the P3 fraction. In the current experiment we used a polyclonal rabbit antibody against Cav1.2 (55).

calcium currents in the DG. This is surprising because dentate granule cells, like CA1 neurons, express high levels of GRs as well as MRs (4, 5, 30). For some reason GR occupation does not result in appreciable effects in DG cells, at least not under normal conditions. Interestingly, DG granule cells are not intrinsically insensitive to high doses of corticosterone because after a 21-d period of unpredictable stress, effects of high corticosterone doses (which activate GRs) can be seen, e.g. on 2-amino-3-hydroxy-5-methyl-4-isoxazol propionic acid receptor mediated responses (31) and calcium current amplitude (18). Transcriptional regulation Many differences between DG and CA1 cells could account for the observed disparity. For instance, the metabolism (32) or cell transport (33–35) of corticosterone may be regulated differently so that effectively less corticosterone is available to occupy GRs in DG cells. It can also not be excluded that different variants of the GR, each with their own transcriptional efficacy (36 –38), are expressed to a different extent in both areas. These explanations all are expected to result in regional differences in transcriptional regulation of GR target genes. We therefore next investigated some of the potential target genes, including the calcium channel ␤4 subunit. We used in situ hybridization because this technique is optimal to determine putative regional differences in gene expression. This approach, however, is (for technical reasons) best combined with in vivo rather than in vitro application of corticosterone, especially when examining long-term consequences of a rise in corticosteroid level.


4621

Comparing data obtained after in vivo injection of corticosterone vs. application of a pulse of corticosterone in vitro requires careful consideration, in view of the differences in dynamics of glucorticoid exposure. One could, for example, wonder whether such in vivo manipulation of corticosteroid level results in comparable glucocorticoid modulation of calcium currents as seen with in vitro hormone application. This indeed appears to be the case because substantial rises in plasma corticosterone in vivo were found to significantly enhance sustained Ca-current amplitude of CA1 neurons (12), similar to what is seen after a 20-min pulse of (100 nM) corticosterone in vitro (10, 14). Conversely, it is important to know that in vivo (as well as in vitro) (17) application of corticosterone is indeed able to change hippocampal gene expression patterns (39). At early time points, genes (when tested) affected by corticosterone treatment were found to be primary target genes (17). Importantly, gene transcription was also found to be changed when assessed with in situ hybridization methods 1 h after corticosterone injection in the same dose as presently applied (40). Interestingly, in the latter study, transcriptional regulation by corticosterone of genes of interest was in all cases comparable for the CA1 region and DG, which is in line with the current findings. Despite these considerations, we cannot entirely exclude that differences in transcriptional regulation between CA1 and DG could have shown up at other time points. The general expression patterns of the Cav1.2, and ␤-subunits within the hippocampus are in line with previous findings (41– 43). Two control groups for the corticosterone injection were included: a group of naive animals that was left undisturbed in their cages and a group that received a single injection with vehicle solution. Somewhat to our surprise, vehicle injection led to decreased mRNA expression of the Cav1.2 subunit in all hippocampal subfields. Most likely, injection with vehicle solution leads to mild stress and a transient increase in circulating levels of corticosterone (44) and/or other stress-induced factors (e.g. noradrenaline), although corticosterone levels (1 h after injection) were low in nearly all our control animals. Importantly however, expression of Cav1.2 mRNA was generally not altered by corticosterone, regardless of the control group. This observation agrees with earlier findings with qPCR, showing that corticosterone does not consistently elevate Cav1.2 mRNA expression of the CA1 hippocampal area (14). Expression of ␤4 subunits yields quite consistent results. In earlier studies with qPCR in both mice (14) and rats (Qin, Y.Q., S. Spijker, A.B. Smit, P. Chameau, and M. Jöels, personal communication) and in the current investigation using in situ hybridization, corticosterone treat-

4622

van Gemert et al.


ment resulted in a significant up-regulation of ␤4 subunit mRNA expression when compared with the naive situation. Vehicle-injected animals (probably representing a mild stress situation) yielded intermediate expression levels in all hippocampal subfields. Thus, transcriptional regulation by corticosterone of the Ca-channel subunits studied here was very similar for the CA1 area and DG. Therefore, local differences in any process up and until transcription of these subunits (e.g. intracellular availability of corticosterone) cannot easily explain the regional differences in steroid effect on calcium current amplitude. Posttranscriptional modification We next considered the possibility that corticosterone affects the availability of calcium channel subunits at the posttranscriptional level in a region-specific manner. We found that ␤4 and Cav1.2 protein expression were both significantly increased 2–3 h after a 20-min corticosterone incubation (i.e. roughly at the time point at which electrophysiological changes were apparent) in P2 and P3 fractions of the CA1 area. This indicates that the total pool of ␤4 and Cav1.2 proteins is increased in CA1 cells by corticosterone. Importantly, protein expression was not significantly up-regulated in the DG after corticosterone exposure. The ␤4 subunit is involved in gating properties and trafficking of calcium channels to the membrane (16, 26). Although the ␤4 subunit does not preferentially interact with subunits composing the L-type channel in cell lines (45), native L-type channels from CA1 neurons seem to form a complex with ␤4 rather than ␤3 subunits (28). Therefore, increased protein expression of ␤4 subunits in response to corticosterone could enhance calcium currents by promoting trafficking of L-type channels to the plasma membrane. If so, one would expect that more Cav1.2 subunits are found in the P2 but not P3 fraction after corticosterone treatment. However, we found increased corticosterone-induced Cav1.2 protein expression in both fractions, in the CA1 but not DG region. Therefore, we allow the possibility that regulation of the ␤4 subunit is not the only cause of changes in calcium current amplitude. In summary, Ca-channel subunit protein levels showed clear discrepancies between CA1 and DG after corticosteroid treatment. This points to putative regional differences in steroid sensitivity of a gene involved in the translational machinery or in mechanisms regulating mRNA or protein stability. Importantly, this putative factor does display some degree of specificity toward proteins/mRNA species because GAPDH and Tfr levels were unchanged. Interestingly, large differences in mRNA expression patterns do exist between the hippocampal regions under basal con-


ditions (46, 47), e.g. genes involved in protein synthesis (46). Local differences in levels of transcription factors or cofactors involved in GR-dependent transcriptional regulation of the unknown mediator could also be important (48, 49). Future studies will need to address the nature of the critical factor and the width of its target specificity. Functional relevance After an acute stressor, corticosteroid levels rise, activating primarily GRs (24). This implies that the degree to which brain areas are affected by corticosteroids after stress is determined mostly by the GR distribution. The current study clearly demonstrates that this is not necessarily the case because cells that abundantly express GRs apparently are resistant (i.e. at the functional level) to a high dose of corticosterone, at least under the current conditions. This is in line with other studies showing different effects of stress and/or corticosterone at the network level in the CA1 area vs. DG (50 –52). The functional implication for these specific areas could be that several hours after stress temporary enhancement in neuronal excitability (e.g. caused by catecholamines and/or nongenomic corticosteroid actions) is normalized in the CA1 area (53) but less so in the DG due to attenuated glucocorticoid responses; behavioral functions that critically depend on the DG may therefore use a longer time window to encode relevant information. In general, the implication of the current data set is that the composite effect of stress on the brain is much more complex than surmised solely from the GR distribution.

Acknowledgments Address all correspondence and requests for reprints to: Marian Joe¨ls, Swammerdam Institute for Life Sciences, Center for NeuroScience, University of Amsterdam, Kruislaan 320, 1098 SM Amsterdam, The Netherlands. E-mail: [email protected]. This work was supported by National Institutes of Health Grants R01 NS035563 and R01 AG017502 (to J.W.H.). Disclosure Summary: For this study, N.G.v.G., D.M.M.C., H.K., S.v.d.L., M.Z., O.C.M., J.W.H., and M.J. have nothing to declare.

References 1. Lightman SL, Windle RJ, Ma XM, Harbuz MS, Shanks NM, Julian MD, Wood SA, Kershaw YM, Ingram CD 2002 Hypothalamicpituitary-adrenal function. Arch Physiol Biochem 110:90 –93 2. McEwen BS, Wingfield JC 2003 The concept of allostasis in biology and biomedicine. Horm Behav 43:2–15 3. Reul JM, de Kloet ER 1985 Two receptor systems for corticosterone in rat brain: microdistribution and differential occupation. Endocrinology 117:2505–2511


4. Fuxe K, Wikstro¨m AC, Okret S, Agnati LF, Ha¨rfstrand A, Yu ZY, Granholm L, Zoli M, Vale W, Gustafsson JA 1985 Mapping of glucocorticoid receptor immunoreactive neurons in the rat tel- and diencphalon using a monoclonal antibody against rat liver glucocorticoid receptor. Endocrinology 117:1803–1812 5. Rosenfeld P, Van Eekelen JA, Levine S, De Kloet ER 1988 Ontogeny of the type 2 glucocorticoid receptor in discrete rat brain regions: an immunocytochemical study. Brain Res 470:119 –127 6. Sarabdjitsingh RA, Meijer OC, Schaaf MJ, de Kloet ER 2009 Subregion-specific differences in translocation patterns of mineralocorticoid and glucocorticoid receptors in rat hippocampus. Brain Res 1249:43–53 7. Van Eekelen JA, De Kloet ER 1992 Co-localization of brain corticosteroid receptors in the rat hippocampus. Prog Histochem Cytochem 26:250 –258 8. Kim JJ, Diamond DM 2002 The stressed hippocampus, synaptic plasticity and lost memories. Nat Rev Neurosci 3:453– 462 9. Joe¨ls M, Karst H, Krugers HJ, Lucassen PJ 2007 Chronic stress: implications for neuronal morphology, function and neurogenesis. Front Neuroendocrinol 28:72–96 10. Kerr DS, Campbell LW, Thibault O, Landfield PW 1992 Hippocampal glucocorticoid receptor activation enhances voltage-dependent Ca2⫹ conductances: relevance to brain aging. Proc Natl Acad Sci USA 89:8527– 8531 11. Karst H, Wadman WJ, Joe¨ls M 1994 Corticosteroid receptor-dependent modulation of calcium currents in rat hippocampal CA1 neurons. Brain Res 649:234 –242 12. Joe¨ls M, Velzing E, Nair S, Verkuyl JM, Karst H 2003 Acute stress increases calcium current amplitude in rat hippocampus: temporal changes in physiology and gene expression. Eur J Neurosci 18:1315– 1324 13. Karst H, Karten YJ, Reichardt HM, de Kloet ER, Schu¨tz G, Joe¨ls M 2000 Corticosteroid actions in hippocampus require DNA binding of glucocorticoid receptor homodimers. Nat Neurosci 3:977–978 14. Chameau P, Qin Y, Spijker S, Smit G, Joe¨ls M 2007 Glucocorticoids specifically enhance L-type calcium current amplitude and affect calcium channel subunit expression in the mouse hippocampus. J Neurophysiol 97:5–14 15. Catterall WA, Striessnig J, Snutch TP, Perez-Reyes E 2003 International union of pharmacology. XL. Compendium of voltage-gated ion channels: calcium channels. Pharmacol Rev 55:579 –581 16. Birnbaumer L, Qin N, Olcese R, Tareilus E, Platano D, Costantin J, Stefani E 1998 Structures and functions of calcium channel ␤ subunits. J Bioenerg Biomem 30:357–375 17. Qin Y, Karst H, Joe¨ls M 2004 Chronic unpredictable stress alters gene expression in rat single dentate granule cells. J Neurochem 89:364 –374 18. van Gemert NG, Joe¨ls M 2006 Effect of chronic stress and mifepristone treatment on voltage-dependent Ca2⫹ currents in rat hippocampal dentate gyrus. J Neuroendocrinol 18:732–741 19. Karst H, Joe¨ls M 2007 Brief RU 38486 treatment normalizes the effects of chronic stress on calcium currents in rat hippocampal CA1 neurons. Neuropsychopharmacology 32:1830 –1839 20. Williams ME, Feldman DH, McCue AF, Brenner R, Velicelebi G, Ellis SB, Harpold MM 1992 Structure and functional expression of ␣1, ␣2, and ␤ subunits of a novel human neuronal calcium channel subtype. Neuron 8:71– 84 21. Hell JW, Westenbroek RE, Warner C, Ahlijanian MK, Prystay W, Gilbert MM, Snutch TP, Catterall WA 1993 Identification and differential subcellular localization of the neuronal class C and class D L-type calcium channel ␣1 subunits. J Cell Biol 123:949 –962 22. Sinnegger-Brauns MJ, Hetzenauer A, Huber IG, Renstro¨m E, Wietzorrek G, Berjukov S, Cavalli M, Walter D, Koschak A, Waldschu¨tz R, Hering S, Bova S, Rorsman P, Pongs O, Singewald N, Striessnig JJ 2004 Isoform-specific regulation of mood behavior and pancreatic ␤ cell and cardiovascular function by L-type Ca 2⫹ channels. J Clin Invest 113:1430 –1439 23. Moosmang S, Haider N, Klugbauer N, Adelsberger H, Langwieser


24.

25.

26.

27.

28.

29.

30.

31.

32. 33.

34.

35.

36.

37.

38. 39.

40.

41.

42.

43.

4623

N, Mu¨ller J, Stiess M, Marais E, Schulla V, Lacinova L, Goebbels S, Nave KA, Storm DR, Hofmann F, Kleppisch T 2005 Role of hippocampal Cav1.2 Ca2⫹ channels in NMDA receptor-independent synaptic plasticity and spatial memory. J Neurosci 25:9883–9892 Reul JM, van den Bosch FR, de Kloet ER 1987 Relative occupation of type-I and type-II corticosteroid receptors in rat brain following stress and dexamethasone treatment: functional implications. J Endocrinol 115:459 – 467 Maggio N, Segal M 2007 Striking variations in corticosteroid modulation of long-term potentiation along the septotemporal axis of the hippocampus. J Neurosci 27:5757–5765 Arikkath J, Campbell KP 2003 Auxiliary subunits: essential components of the voltage-gated calcium channel complex. Curr Opin Neurobiol 13:298 –307 Liu H, Felix R, Gurnett CA, De Waard M, Witcher DR, Campbell KP 1996 Expression and subunit interaction of voltage-dependent Ca2⫹⫹ channels in PC12 cells. J Neurosci 16:7557–7565 Schjo¨tt JM, Hsu SC, Plummer MR 2003 The neuronal b4 subunit increases the unitary conductance of L-type voltage-gated calcium channels in PC12 cells. J Biol Chem 278:33936 –33942 Hell JW, Westenbroek RE, Breeze LJ, Wang KK, Chavkin C, Catterall WA 1996 N-methyl-D-aspartate receptor-induced proteolytic conversion of postsynaptic class C L-type calcium channels in hippocampal neurons. Proc Natl Acad Sci USA 93:3362– 3367 Van Eekelen JA, Jiang W, De Kloet ER, Bohn MC 1988 Distribution of the mineralocorticoid and the glucocorticoid receptor mRNAs in the rat hippocampus. J Neurosci Res 21:88 –94 Karst H, Joe¨ls M 2003 Effect of chronic stress on synaptic currents in rat hippocampal dentate gyrus neurons. J Neurophysiol 89:625– 633 Holmes MC, Seckl JR 2006 The role of 11␤-hydroxysteroid dehydrogenases in the brain. Mol Cell Endocrinol 248:9 –14 Karssen AM, Meijer OC, van der Sandt IC, Lucassen PJ, de Lange EC, de Boer AG, de Kloet ER 2001 Multidrug resistance P-glycoprotein hampers the access of cortisol but not of corticosterone to mouse and human brain. Endocrinology 142:2686 –2694 Uhr M, Holsboer F, Mu¨ller MB 2002 Penetration of endogenous steroid hormones corticosterone, cortisol, aldosterone and progesterone into the brain is enhanced in mice deficient for both mdr1a and mdr1b P-glycoproteins. J Neuroendocrinol 14:753–759 Kwan P, Sills GJ, Butler E, Gant TW, Brodie MJ 2003 Differential expression of multidrug resistance genes in naive rat brain. Neurosci Lett 339:33–36 Oakley RH, Jewell CM, Yudt MR, Bofetiado DM, Cidlowski JA 1999 The dominant negative activity of the human glucocorticoid receptor b isoform—specificity and mechanisms of action. J Biol Chem 274:27857–27866 Lu NZ, Cidlowski JA 2005 Translational regulatory mechanisms generate N-terminal glucocorticoid receptor isoforms with unique transcriptional target genes. Mol Cell 18:331–342 Lu NZ, Cidlowski JA 2006 Glucocorticoid receptor isoforms generate transcription specificity. Trends Cell Biol 16:301–307 Datson NA, van der Perk J, de Kloet ER, Vreugdenhil E 2001 Identification of corticosteroid-responsive genes in rat hippocampus using serial analysis of gene expression. Eur J Neurosci 14:679 – 689 Morsink MC, Van Gemert NG, Steenbergen PJ, Joe¨ls M, De Kloet ER, Datson NA 2007 Rapid glucocorticoid effects on the expression of hippocampal neurotransmission-related genes. Brain Res 1150: 14 –20 Tanaka O, Sakagami H, Kondo H 1995 Localization of mRNAs of voltage-dependent Ca2⫹-channels: four subtypes of ␣1- and ␤-subunits in developing and mature rat brain. Mol Brain Res 30:1–16 Ludwig A, Flockerzi V, Hofmann F 1997 Regional expression and cellular localization of the ␣1 and ␤ subunit of high voltage-activated calcium channels in rat brain. J Neurosci 17:1339 –1349 Herman JP, Chen KC, Booze R, Landfield PW 1998 Up-regulation

4624

44.

45.

46.

47.

48.

49.

van Gemert et al.


of ␣1D Ca2⫹ channel subunit mRNA expression in the hippocampus of aged F344 rats. Neurobiol Aging 19:581–587 Karten YJ, Nair SM, van Essen L, Sibug R, Joe¨ls M 1999 Long-term exposure to high corticosterone levels attenuates serotonin responses in rat hippocampal CA1 neurons. Proc Natl Acad Sci USA 96:13456 –13461 Walker D, Bichet D, Campbell KP, De Waard M 1998 A b4 isoformspecific interaction site in the carboxyl-terminal region of the voltagedependent Ca2⫹ channel a1A subunit. J Biol Chem 273:2361–2367 Datson NA, Meijer L, Steenbergen PJ, Morsink MC, van der Laan S, Meijer OC, de Kloet ER 2004 Expression profiling in laser-microdissected hippocampal subregions in rat brain reveals large subregionspecific differences in expression. Eur J Neurosci 20:2541–2554 Lein ES, Zhao X, Gage FH 2004 Defining a molecular atlas of the hippocampus using DNA microarrays and high-throughput in situ hybridization. J Neurosci 24:3879 –3889 Meijer OC, van der Laan S, Lachize S, Steenbergen PJ, de Kloet ER 2006 Steroid receptor coregulator diversity: what can it mean for the stressed brain? Neuroscience 138:891– 899 O’Malley BW 2007 Coregulators: from whence came these “master genes”. Mol Endocrinol 21:1009 –1013


50. Gerges NZ, Stringer JL, Alkadhi KA 2001 Combination of hypothyroidism and stress abolishes early LTP in the CA1 but not dentate gyrus of hippocampus of adult rats. Brain Res 922:250 –260 51. Yamada K, McEwen BS, Pavlides C 2003 Site and time dependent effects of acute stress on hippocampal long-term potentiation in freely behaving rats. Exp Brain Res 152:52–59 52. Kavushansky A, Vouimba RM, Cohen H, Richter-Levin G 2006 Activity and plasticity in the CA1, the dentate gyrus, and the amygdala following controllable vs. uncontrollable water stress. Hippocampus 16:35– 42 53. Joe¨ls M, Pu Z, Wiegert O, Oitzl MS, Krugers HJ 2006 Learning under stress: how does it work? Trends Cogn Sci 10:152–158 54. Liebmann L, Karst H, Sidiropoulou K, van Gemert N, Meijer OC, Poirazi P, Joe¨ls M 2008 Differential effects of corticosterone on the slow afterhyperpolarization in the basolateral amygdala and CA1 region: possible role of calcium channel subunits. J Neurophysiol 99:958 –968 55. Davare MA, Horne MC, Hell JW 2000 Protein phosphatase 2A is associated with class C L-type calcium channels (Cav1.2) and antagonizes channel phosphorylation by cAMP-dependent protein kinase. J Biol Chem 275:39710 –39717