Mouse neutrophilic granulocytes express mRNA encoding ... - CiteSeerX

Mouse neutrophilic granulocytes express mRNA encoding the macrophage colony-stimulating factor receptor (CSF-1R) as well as many other macrophage-specific transcripts and can transdifferentiate into macrophages in vitro in response to CSF-1 R. Tedjo Sasmono,*,1 Achim Ehrnsperger,* Stephen L. Cronau,* Timothy Ravasi,*,2 Rangi Kandane,† Michael J. Hickey,† Andrew D. Cook,*,‡ S. Roy Himes,* John A. Hamilton,*,‡ and David A. Hume*,3 *CRC for Chronic Inflammatory Diseases and ARC Special Research Centre for Functional and Applied Genomics, Institute for Molecular Bioscience, The University of Queensland, St. Lucia, Australia; †Centre for Inflammatory Diseases, Department of Medicine, Monash University, Clayton, Victoria, Australia; and ‡Arthritis and Inflammation Research Centre, Department of Medicine, The University of Melbourne, Royal Melbourne Hospital, Victoria, Australia

Abstract: The differentiation of macrophages from their progenitors is controlled by macrophage colony-stimulating factor (CSF-1), which binds to a receptor (CSF-1R) encoded by the c-fms proto-oncogene. We have previously used the promoter region of the CSF-1R gene to direct expression of an enhanced green fluorescent protein (EGFP) reporter gene to resident macrophage populations in transgenic mice. In this paper, we show that the EGFP reporter is also expressed in all granulocytes detected with the Gr-1 antibody, which binds to Ly-6C and Ly-6G or with a Ly-6Gspecific antibody. Transgene expression reflects the presence of CSF-1R mRNA but not CSF-1R protein. The same pattern is observed with the macrophage-specific F4/80 marker. Based on these findings, we performed a comparative array profiling of highly purified granulocytes and macrophages. The patterns of mRNA expression differed predominantly through granulocyte-specific expression of a small subset of transcription factors (Egr1, HoxB7, STAT3), known abundant granulocyte proteins (e.g., S100A8, S100A9, neutrophil elastase), and specific receptors (fMLP, G-CSF). These findings suggested that appropriate stimuli might mediate rapid interconversion of the major myeloid cell types, for example, in inflammation. In keeping with this hypothesis, we showed that purified Ly-6G-positive granulocytes express CSF-1R after overnight culture and can subsequently differentiate to form F4/80-positive macrophages in response to CSF-1. J. Leukoc. Biol. 82: 111–123; 2007. Key Words: EGFP 䡠 knockout 䡠 white blood cells 䡠 myeloid 䡠 transgenic 䡠 transcription 0741-5400/07/0082-111 © Society for Leukocyte Biology

INTRODUCTION Cells of the mononuclear phagocyte system (monocytes and macrophages) and granulocytes share committed progenitor cells in the bone marrow (BM). These precursors respond to lineage-restricted growth factors, macrophage colony-stimulating factor (CSF-1), granulocyte CSF (G-CSF), and granulocytemacrophage CSF (GM-CSF). Granulocytes and macrophages are referred to collectively as myeloid cells and share many gene products and functions associated with pathogen recognition, innate immunity, and phagocytosis. Yet, mature macrophages and granulocytes are also functionally distinct; genes such as myeloperoxidase (MPO), neutrophil elastase, lactoferrin, and the myeloid S100 proteins S100A8 and S100A9 are expressed at high levels in granulocytes [1– 4]. The transcriptional events underlying macrophage and granulocyte lineage divergence and differentiation are unclear. Detailed analysis of the cis-acting elements controlling various granulocyte- and macrophage-restricted promoters does not reveal obvious differences [5– 8]. Common features include binding sites for specificity protein 1 (Sp1; which is expressed at high levels in myeloid cells) [9] and members of the C/EBP, Ets [especially purine rich box-1 (PU.1)], and acute myeloid leukemia 1 (AML1) families [8, 10, 11]. Knockout (KO) of the PU.1 transcription factor causes a loss of macrophages and granu-

1 Current address: Eijkman Institute for Molecular Biology, Jl. Diponegoro 69, Jakarta 10430, Indonesia. 2 Current address: Department of Bioengineering, Jacobs School of Engineering, University of California, San Diego, 9500 Gilman Drive, La Jolla, CA 92093, USA. 3 Correspondence: Institute for Molecular Bioscience, The University of Queensland, St. Lucia QLD 4072, Australia. E-mail: [email protected] Received November 30, 2006; revised January 31, 2007; accepted February 23, 2007. doi: 10.1189/jlb.1206713

Journal of Leukocyte Biology Volume 82, July 2007 111

locytes in mice [12–14]. C/EBP ␣ KO generates some selective granulocyte deficiency, but many macrophage promoters also have C/EBP sites [6, 7, 11]. We have carried out detailed studies of the transcriptional regulation of the CSF-1 receptor gene (CSF-1R), the c-fms proto-oncogene. The CSF-1R locus is activated at an early stage of myeloid progenitor cell differentiation [15], and thereafter, expression of CSF-1R mRNA increases with commitment and differentiation along the macrophage lineage. The CSF-1R promoter is an archetypal myeloid promoter, lacking a TATA box and instead, initiating transcription through purine-rich repeats, which bind PU.1 and other Ets family members [16, 17]. Transcriptional regulation of CSF-1R requires the function of an intronic enhancer element, termed FIRE, which contains multiple binding sites for PU.1/Ets, SP1, C/EBP, and AML1 [15, 18, 19]. We showed that a segment of DNA comprising 3.5 kb promoter, plus the first intron containing the FIRE element, could direct expression of a reporter gene [enhanced green fluorescent protein (EGFP)] to all cells of the mononuclear phagocyte lineage [20]. In the description of the MacGreen mice expressing this transgenic reporter, we examined cells of peripheral blood and BM, in which expression of EGFP correlated with surface CSF-1R detected with antibody staining and expression of macrophage markers. These prior studies did not adequately address expression in granulocytes, which do not have detectable surface CSF-1R. Cells that expressed EGFP but not surface CSF-1R were seen in BM, but it was considered that residual EGFP, which is very stable, might be retained in early myeloid cells because of their derivation from CSF-1R⫹ve cells, which express that gene. Mature granulocytes in blood were lost or damaged in procedures to isolate and examine mononuclear cells. In this report, we re-examine the expression of the EGFP reporter in granulocytes. We find that EGFP is expressed at high levels in all granulocytes of MacGreen mice. The reporter accurately reflects the transcription of the gene, as CSF-1R mRNA is abundant in granulocytes as it is in macrophages, but the protein product is barely detectable. Based on this finding, we carried out transcriptional profiling to compare mouse macrophages and granulocytes and discovered that the two cell types have similar transcriptional profiles and coexpress many genes, which are usually regarded as macrophage markers. The major differences lie in the expression by granulocytes of the markers such as the G-CSFR, Ly6G, S100 proteins, and granulocyte elastase. The results suggest that some granulocytes do, indeed, share transcriptional control with macrophages and that some aspects of granulocyte lineage determination occur at the level of protein translation or stability.

MATERIALS AND METHODS Isolation of polymorphonuclear (PMN) cells Neutrophils were obtained from the peritoneal cavity following i.p. injection of thioglycollate or casein, according to a method described by Metcalf et al. [21]. Typically, 7- to 12-week-old C57BL/6J or MacGreen mice were i.p.-injected with 2 mL sterile and aged 10% (w/v) thioglycollate (Sigma Chemical Co., St. Louis, MO, USA) broth or 0.2% (w/v) casein (Sigma Chemical Co.). At 3– 4 h after injection, mice were killed by CO2 exposure, and peritoneal exudates

112

Journal of Leukocyte Biology Volume 82, July 2007

were collected by puncturing the abdomen with 18G needles fitted on 10 mL syringes. Peritoneal lavage was performed three times with 10 mL ice-cold Ca2⫹- and Mg2⫹-free HBSS (Invitrogen, Carlsbad, CA, USA) containing 5 mM EDTA. Typically, 12–17 ⫻ 106 cells were obtained per mouse. To deplete the possible contaminating macrophages, PMN were cultured on FCS-coated tissue-culture dishes in 37°C incubator with 5% CO2 for 2 h. Nonadherent PMN were then harvested from the supernatant. For culturing purposes, peritoneal exudates were purified further using positive selection based on the Ly-6G antigen as described below. Apart from isolation from peritoneal exudates, PMN were also isolated positively or negatively by using the magnetic cell separator (MACS, Miltenyi Biotec, Auburn, CA, USA) from blood and BM. Blood was obtained by cardiac puncture, and erythrocytes were lysed using RBC lysis buffer (155 mM NH4CL, 10 mM KHCO3, and 0.1 mM EDTA). For BM cell isolation, marrow cells were flushed out from the femurs with complete RPMI-1640 media using 27G needles fitted in 10 mL syringes. For positive selection, white blood cells (WBC), marrow cells, and peritoneal exudates were resuspended in PBS-5% BSA-2 mM EDTA and stained with 1:100 dilution R-PE-conjugated Ly-6G antibody (Clone 1A8-BD, PharMingen, San Diego, CA, USA) for 15 min at 4°C. Afterward, cells were washed with PBS-5% BSA-2 mM EDTA, pelleted, and resuspended in PBS-5% BSA-2 mM EDTA. Subsequently, labeled cells were incubated with anti-R-PE MicroBeads (Miltenyi Biotec), applied to LS columns, washed, and eluted exactly following the manufacturer’s instruction. For negative isolation, PMN were obtained from WBC and marrow by depletion of non-PMN cells. This was achieved by labeling the WBC and/or marrow cells with a cocktail of non-PMN-specific antibodies, namely the R-PE-conjugated anti-FMS (CSF-1R; Serotec, Oxford, UK), anti-F4/80 (Serotec), anti-CD19 (Serotec), anti-CD34 (Serotec), anti-CD8, and anti-CD4 (gift from Dr. Ken Shortman’s laboratory at Walter And Eliza Hall Institute of Medical Research, Melbourne, Australia). The labeled cells were then captured with anti-R-PE MicroBeads and processed as described above, except collecting the flowthrough cells instead of magnetic bead-bound cells. For all PMN samples, propidium iodide (Molecular Probes, Eugene, OR, USA) or Diff-Quik (Lab Aids, NSW, Australia) staining was performed to determine the polymorphic forms of the nuclei. Cells were visualized under an Olympus AX70 microscope.

Cell and tissue culture Generation of BM-derived macrophages (BMM) was performed as described previously [20]. Briefly, marrow cells were grown in complete RPMI-1640 media [supplemented with 10% heat-inactivated FCS (JRH, SAFC Biosciences, Australia), 30 U/mL penicillin and 100 ␮g/mL streptomycin (Invitrogen), and 2 mM L-glutamine (Invitrogen)] in the presence of 104 U/mL human recombinant (r)CSF-1 (Chiron Corp., Emeryville, CA, USA) for 7 days. Resident peritoneal macrophages (RPM) were collected for the collection of peritoneal exudate neutrophils as described above, without any stimulation prior to collection, and thioglycollate-elicited PM (TEPM) were isolated 5 days after i.p. injection of aged 10% thioglycollate broth [20]. As negative controls, nonmacrophage/granulocyte cell lines were also included in the experiments. They were NIH3T3 fibroblast, NMU-MG mouse mammary epithelial cancer, and MC-3T3 osteoblast cell lines (obtained from American Type Culture Collection, Manassas, VA, USA).

Total RNA extraction, RT, and real-time PCR analysis Total RNA were extracted from the cells by using Qiagen RNeasy kits according to the manufacturer’s protocols (Qiagen, Valencia, CA, USA). Contaminating genomic DNAs were removed by digestion with an RNase-free DNase I (DNAfree) kit (Ambion, Austin, TX, USA). Total RNAs (1 ␮g) were reverse-transcribed using the Supercript III RT kit (Invitrogen), according to the manufacturer’s protocols. Resulting cDNAs were diluted 1:10 with ddH2O and used as templates in real-time PCR experiments using SYBR Green PCR (Applied Biosystems, Foster City, CA, USA) mix with composition as described by the manufacturer. Primers (2 ␮M) were used for each reaction. Real-time PCR experiments were performed in an ABI Prism 7000 sequence detection system (Applied Biosystems). The sequences of the primers used are described in Table 1.

http://www.jleukbio.org

TABLE 1.

Oligonucleotide Sequences Used as Primers in Real-Time PCR Reactions

Gene:

Forward primer sequence 5⬘–3⬘

Reverse primer sequence 5⬘–3⬘

Ly-6G FMS F4/80 G-CSFR S100A8

TGGACTCTCACAGAAGCAAAG CCAGAGCCCCCACAGATAA CTCTGTGGTCCCACCTTCAT ACAAAGCAGGGACCTCTTCA CCGTCTTCAAGACATCGTTTGA

GCAGAGGTCTTCCTTCCAACA AAGTTGCTGTCTCCACGTTTG GATGGCCAAGGATCTGAAAA ATGGTGTTAAGGTCTTGGGC GTAGAGGGCATGGTGATTTCCT

Northern hybridization Total RNAs (10 –15 ␮g) were electrophoresed on 1% agarose-formaldehyde gel (3.7% formaldehyde, 1⫻ MOPS buffer) and transferred onto nylon membranes (␨-probe, BioRad, Hercules, CA, USA). RNA was cross-linked by baking the membrane at 80°C for 2 h. Northern probes were generated by PCR amplification of genes of interest from cDNA of macrophages or granulocyte samples. We used primers that amplified longer fragments (300 – 600 bp) than the real-time PCR primers to increase specificity. The primer sequences for PCR of Northern probes are described in Table 2. All primers were obtained from Geneworks (Adelaide, South Australia). PCR-generated fragments were purified using QIAex gel extraction kit (Qiagen), performed as recommended by Qiagen. Probes (25 ng) were radiolabeled with ␣32P-deoxy (d)CTP using the Megaprime labeling kit (Amersham Biosciences, Piscataway, NJ, USA) and purified using Nick columns (Amersham Biosciences). After 1 h prehybridization, membranes were hybridized with each of the probes in hybridization buffer (0.5 M Na2HPO4, pH 7.2, 7% SDS) at 65°C overnight. Membranes were then washed three times, 20 min each, with wash buffer (1⫻ SSC, 0.1% SDS) at 42°C and one time at 65°C and exposed to Fuji SuperRX films. For reprobing, membranes were stripped in stripping buffer (50% formamide, 0.1% SDS) for 1–2 h at 68°C, washed with ddH2O several times, and followed with washing in 2⫻ SSC.

Western immunoblotting Whole cell lysates were obtained by lysing the cells in cell lysis buffer (50 mM Tris-HCl, pH 7.4, 1% Nonidet P-40, 0.25% sodium deoxycholate, 150 mM NaCl, 1 mM EGTA, complete mini-protease inhibitor cocktail, Roche, Nutley, NJ, USA). Proteins (20 ␮g) were separated on 12% Bis-Tris SDS-polyacrylamide gel (NuPAGE gel, Invitrogen), blotted into polyvinylidene difluoride (PVDF) membranes (Immobilon-Milipore, Bedford, MA, USA) using a BioRad mini-protean transfer apparatus. Membranes were blocked with 5% skim milk in TBS-Tween 20 for 1 h at room temperature and incubated with 1:2000 dilution of anti-CSF-1R rabbit antiserum (Upstate Biotechnology, Lake Placid, NY, USA) in blocking buffer overnight at 4°C with gentle agitation. After washing, membranes were incubated with 1:4000 dilution of secondary antibody (HRP-linked goat anti-rabbit antibody, Cell Signaling, Beverly, MA, USA) in blocking buffer for 1 h at room temperature. After a few washes in water, HRP activities were detected using ECL Western detection reagents (Amersham Pharmacia, UK), and membranes were exposed to Fuji SuperRX films.

FACS analysis and antibody staining Typically, ⬃106 cells were treated with 2.4G2 mAb to block the Fc␥RII/III for 15 min, followed by staining with 1:25 dilution of working solution of R-PEconjugated anti-FMS antibody (Serotec) or 1:50 dilution of R-PE-conjugated anti-Gr-1 (Ly-6G/C) mAb (Clone RB6-8C5-BD, PharMingen) and anti-Ly-6G

TABLE 2.

antibody (Clone 1A8-BD, PharMingen) in ice-cold PBS containing 0.1% BSA and 0.1% NaN3 (PBA) for 1 h on ice and then washed in cold PBA. For intracellular CSF-1R detection, cells were permeabilized by staining in PBA plus 0.5% saponin. Staining with isotype controls and/or secondary antibodies only was also performed to assess the nonspecific binding of the antibodies of interest. FACS analyses and cell sorting were performed in the FACSCalibur (Becton Dickinson, San Jose, CA, USA) or MoFlo FACS sorter (Cytomation, Fort Collins, CO, USA), and data were analyzed using CellQuest software (Becton Dickinson).

Intravital microscopy To assess trafficking of EGFP⫹ve leukocytes in MacGreen mice, the microvasculature of the cremaster muscle was examined exactly as described previously [22]. Briefly, mice were anaesthetized using a cocktail of ketamine and xylazine, and the cremaster muscle was exteriorized onto an optically clearviewing pedestal. The cremasteric microcirculation was visualized using an intravital microscope (Axioplan 2 Imaging, Carl Zeiss, Australia) with a ⫻20 objective lens (LD Achroplan 20⫻/0.40 NA, Carl Zeiss) and a ⫻10 eyepiece. Cremasteric postcapillary venules (25– 40 ␮m in diameter) were examined, as these are the sites within the microvasculature that normally support leukocyte-endothelial cell interactions. To detect EGFP⫹ve leukocytes within the vasculature, the tissue was examined via epifluorescence (excitation, 450 – 490 nm; emission, 515 nm). Images were visualized using a SIT video camera (Dage-MTI VE-1000, Sci Tech, Victoria, Australia) and recorded on videotape for subsequent playback analysis. To detect all interacting leukocytes (EGFP-ve and ⫹ve), preparations were also examined using bright-field transillumination.

Microarray labeling, hybridizing, scanning, and analysis Briefly, cDNA generated from 15 ␮g total RNA, isolated from wild-type (C57BL/6J) BMM and granulocytes (Ly-6G⫹ve cells isolated using MACS method), were labeled directly with dUTP-conjugated Cy3 (BMM) or Cy5 (granulocytes) and the respective dye swap and hybridized at 65°C overnight onto mouse Compugen 20K set microarrays. Slides were washed for 5 min in 2⫻ SSC/0.2% SDS buffer and then spun dry and scanned on a ScanArray 5000 confocal laser scanner. Molecularware (Digital Genome, California Institute of Technology, Pasadena, CA, USA) was used to process the images, and data were corrected for local background and confidence status flagged for empty spots, signal:noise ratio, spot compression:ventilation ratio, and spot morphology. Data were imported into GeneSpring 6.1 (Silicon Genetics, Agilent Technologies, Inc., Santa Clara, CA, USA) for clustering and comparative analysis.

Sequences of Primers Used to Amplify Northern Probes

Gene:

Forward primer sequence 5⬘–3⬘

Reverse primer sequence 5⬘–3⬘

Ly-6G FMS F4/80 HPRT

GCTCAGGGGCTGGAGTGCTAC ACCCTGCACTGAAGGACAGT TTTTCAGATCCTTGGCCATC GTTGGATACAGGCCAGACTTTG

GAGAAAGGTCTGCAGAACGAC GTCCACAGCGTTGAGACTGA ACACTGGGGCACTTTTGTTC GAGGGTAGGCTGGCCTATAGGC

HPRT, Hypoxanthine guanine phosphoribosyl transferase.

Sasmono et al. Granulocyte expression of the CSF-1 receptor

113

Data handling and annotation of clusters The ratio of the experimental signal:the control signal for each spot was calculated; intensity-dependent normalization was also applied: Where the ratio was reduced to the residual of the Lowess fit of the intensity versus ratio curve [23], the intrinsic dye bias has been attenuated using a dye-swap normalization. The dataset was restricted to those spots passing confidence status on the control channel of every hybridization across each genotype. Differentially expressed genes were identified as those elements that were induced or repressed more than twofold from the unstimulated condition. This set was clustered using the unsupervised, hierarchical clustering tool in GeneSpring威, where similarity was measured by Pearson correlation; the separation ratio was 0.5, and the minimum distance was 0.001. Temporally conserved profiles were identified by principle component analysis of the coexpressed subset. Clusters of coexpressed genes were annotated using SOURCE (http:// genome-www5.stanford.edu/cgi-bin/SMD/source//sourceBatchSearch)-assisted extraction of Gene Ontologies from UniGene (http://www.ncbi.nlm.nih.gov/ entrez/query.fcgi?db⫽unigene).

RESULTS The use of Fms-EGFP as a macrophage marker In our previous report, we described the use of the Fms-EGFP marker to detect resident tissue macrophages. In all tissues, Fms-EGFP marks a population of cells with stellate morphology, characteristics, and location, consistent with their identity as macrophages. We have extended these findings and uploaded a large set of images on our website at www.macrophages.com (see Visual Resources/Transgenic Animals). Except in lymphoid tissues, where F4/80 immunoreactivity is suppressed on subsets of macrophages, the pattern of expression of FmsEGFP is similar to that of the F4/80 cell surface marker detected by immunocytochemistry (the website also contains a database of F4/80 images). To determine if expression of the Fms-EGFP marker allowed detection of EGFP⫹ve leukocytes within the microvasculature in living animals, we examined the cremasteric microvasculature of naı¨ve MacGreen mice using fluorescence intravital microscopy (Fig. 1). Numerous EGFP⫹ve cells were visible within the vasculature, in the mainstream of blood flow and interacting (rolling and adhering) with the endothelial surface. Quantitation of the total number of rolling cells (determined by bright-field illumination), as well as the number of EGFP⫹ve cells undergoing rolling interactions with the endothelial surface, indicated that within 30 min of tissue exteriorization, essentially all of the interacting cells were EGFP⫹ve (data not shown). Given that previous studies have demonstrated that a substantial proportion of rolling leukocytes in the unstimulated murine cremaster muscle is neutrophils [24], these observations raised the possibility that EGFP expression was also occurring in circulating neutrophils in MacGreen mice. It was also noteworthy that fluorescent examination of the cremaster muscle revealed large numbers of extravascular EGFP⫹ve cells of spindle/stellate morphology, many flanking blood vessels (Fig. 1). The apposition of F4/80⫹ve stellate cells with the microvasculature has been documented thoroughly in earlier studies and is evident in many of the images in the F4/80 database. However, these cells do not figure prominently in current views of the control of endothelial function and permeability. 114


Fig. 1. Detection of EGFP⫹ve cells in the functional microvasculature using intravital microscopy. Low-power fluorescence intravital microscopy image of the cremaster muscle displaying the multiple extravascular EGFP⫹ve cells surrounding a postcapillary venule (V) in the center of the image (A). Highpower fluorescence intravital microscopy image showing EGFP⫹ve leukocytes (arrows) interacting with the endothelium of a postcapillary venule. Transillumination reveals the structure of the vessel and surrounding tissue (B). High-power fluorescence intravital microscopy image showing EGFP⫹ve leukocytes (arrows) interacting with the endothelium of a postcapillary venule and extravascular stellate morphology cells present in the extravascular tissue (arrowheads; C).

Expression of EGFP in the Gr-1⫹ve cells of the MacGreen mice The expression of the Gr-1 surface marker is used commonly to identify granulocytes, but subsets of monocytes and macrophages also express this antigen. This expression correlates with that of chemokine and adhesion receptors associated with a propensity to enter inflammatory sites. The inflammatory http://www.jleukbio.org

subset was characterized as Gr-1⫹veCX3CR1lowCCR2⫹veCD62 ligand (CD62L)⫹ve, and monocytes destined to replenish the resident tissue macrophage pool were devoid of Gr-1, CCR2, and CD62L but were high in CX3CR expression [25]. The Gr-1 mAb RB6-8C5 actually binds to an epitope, which is shared by two related proteins, the Ly-6G and Ly-6C antigens [26], and the Ly-6C antigen is also recognized by a mAb known as ER-MP20, which has been recognized as a macrophage subset marker [27, 28]. To confirm the expression of Fms-EGFP in circulating granulocytes, we required a surface marker, which was not expressed on monocytes and to this end, investigated the reactivity of antibodies specific to the Ly-6C and Ly-6G proteins. As shown in Figure 2A, two subpopulations of BM EGFP⫹ve cells expressed the Gr-1 marker (R1hi and R2lo). This pattern of expression was also observed in total WBC samples (Fig. 2B), consistent with the data observed by others [25, 29, 30]. When the samples were stained with anti-Ly-6G antibody (Clone 1A8, rather than the “common” Gr-1 antibody Clone RB6-8C5), the R2lo subpopulations were absent. There is a recent study that described the absence of cross-reactivity between murine Ly-6C and Ly-6G antibodies [31]; however, different cell types and antibody clones were used. Our results indicate that the Gr-1 antibody indeed recognized Ly-6G and Ly-6C, and the Ly-6G-specific antibody detects distinctly only the granulocytes and not the presumably Ly-6C-expressing monocytes and provided definitive colocalization of EGFP and a granulocyte-restricted marker in these animals. Most laboratories that have described the expression of the granulocyte marker Gr-1 in macrophages have used the Clone RB6-8C5 antibody [25, 29, 30, 32–34] and not the 1A8 clone. Although the Gr-1hi cells are known mostly to be PMN, the Gr-1lo

subpopulation has been described to contain monocyte-type ring cells [30, 32]. The Ly-6 antigens described above were almost totally absent in resident, noninflammatory macrophages [27]. Figure 2C illustrates the FACS profiles of RPM of the MacGreen mice. Only few cells were detected using Gr-1 or the Ly-6G-specific antibody. Taken together, the results clearly support the expression of CSF-1R/EGFP transgene in granulocytes and the specificity of Ly-6G antibody for the detection of the PMN cells.

Determination of CSF-1R expression in granulocytes by flow cytometry The detection of CSF-1R/EGFP transgene in mature granulocytes prompted us to carry out experiments to re-examine whether the CSF-1R protein is expressed in this cell population. McKinstry et al. [35] detected the CSF-1R in 77% of the PMN in the BM using radiolabeled ligand but with only approximately 80 receptors present per labeled cell. At the time of that study, no anti-CSF-1R antibody was available. To examine whether there is CSF-1R expression in the granulocytes, immunostaining with anti-CSF1-R antibody was performed on freshly isolated neutrophils. In this experiment, we isolated the inflammatory neutrophils from the peritoneal cavity upon injection with thioglycollate or casein (see Materials and Methods). To obtain pure populations of granulocytes, we depleted the possible contaminating monocytes/macrophages by adherence, as one of the characteristics of macrophages that distinguish them from PMN and other leukocytes is their ability to adhere to glass or plastic substrates [29, 36]. As shown in Figure 3A, ⬃97% of cells isolated by this method

Fig. 2. EGFP expression in Gr-1-positive cells in the MacGreen mice. BM cells were harvested from MacGreen mice and stained with PE-conjugated granulocyte markers Gr-1 and Ly-6G. EGFP-positive cells, which were Gr-1high/Ly-6Ghigh (R1) or Gr-1moderate/Ly-6Gnegative (R2), were purified by FACS. The nuclear morphology of the sorted cells was analyzed by Diff-Quik staining of cytospun cells. Data are representative of three experiments (A). Total WBC (B) and RPM cells (C) were collected from MacGreen mice as described in Materials and Methods, immunostained with PE-conjugated Gr-1 and Ly-6G antibodies, and subjected to flow cytometry. Data are representative of three independent experiments.


115

Fig. 3. Detection of CSF-1R in peritoneal neutrophils and RPM cells. Thioglycollate-elicited peritoneal neutrophils and RPM cells were harvested from C57Bl/6 mice as described in Materials and Methods. Cells were stained with PE-conjugated Ly-6G antibody and subjected to FACS analysis. M2 regions show the percentage of positively stained cells (A). To examine the morphology of the nucleus, the peritoneal exudate neutrophils were cytospun and stained with propidium iodide, and the nuclei were visualized under a fluorescent microscope (B). To detect the CSF-1R in the peritoneal neutrophils and RPM cells, isolated cells were stained with PE-conjugated anti-FMS before or after cell permeabilization for surface and/or internal CSF-1R proteins and subjected to flow cytometry (C). Similar results were obtained in at least three independent experiments.

expressed the Ly-6G marker, suggesting that they are indeed an almost pure population of granulocytes. On the contrary, only a small proportion of RPM cells expressed this granulocyte marker (Fig. 3A). We could not detect any Ly-6G⫹ve cells in mature BMM or in TEPM (data not shown). Propidium iodide staining of the peritoneal exudate cells following 4 h elicitation with thioglycollate showed that the large majority of them had polymorphic nuclei (Fig. 3B). When these cells were stained with anti-CSF-1R antibody, only 4% of them were positive for the surface CSF-1R. Permeabilization of the cells, which allows the detection of intracellular antigens, increased the number of CSF1-R⫹ve cells to 12% (Fig. 3C). These data suggested that surface CSF-1R is not expressed at detectable levels in the large majority of peritoneal exudate granulocytes.

CSF-1R mRNA in PMN cells The limited expression of CSF-1R in granulocytes raised the question as to why most of MacGreen mice granulocytes express the CSF-1R/EGFP transgene. We therefore examined whether CSF-1R mRNA is present in granulocytes. To obtain a pure population of granulocytes, we isolated the PMN from the peritoneal exudate as well as from the total WBC by the adherence method described above. In addition, given the specificity of Ly-6G against granulocytes and its lack of reactivity for macrophages (Fig. 3), we isolated the PMN using a magnetic cells sorter (MACS) using a PE-conjugated, antiLy-6G antibody (see Materials and Methods). Total RNAs were prepared from the samples, and real-time PCR analyses were conducted to detect the CSF-1R message. As shown in the histograms in Figure 4A, CSF-1R mRNA was abundant in all PMN samples. No CSF-1R message could be detected in 116


NIH3T3 fibroblasts (Fig. 4A), embryonic fibroblasts, and the MOPC31C B cell line (data not shown), which are negative controls. BMM, which require CSF-1 for survival, gave the highest CSF-1R expression of the cells tested, but the separate granulocyte preparations and TEPM were identical (Fig. 4A). As a positive control and by way of comparison, the G-CSFR message was also amplified, as well as the Ly-6G gene for the granulocyte population. As expected, G-CSFR and Ly-6G mRNAs were highly expressed in all PMN samples but were undetectable in the macrophage samples and fibroblast controls (Fig. 4, B and C, respectively). Another granulocyteexpressed gene, which was used as a control, was S100A8. This protein is constitutively expressed in neutrophils but inducible in inflammatory macrophages [3, 4]. Real-time PCR data showed a high expression in all PMN samples and the absence from macrophages (Fig. 4D). The above data validate the high-granulocyte content of the samples. As for the CSF-1R, the macrophage marker F4/80 and other members of the EGF-TM7 family are detected at low levels in granulocytes [37–39]. Having observed the lack of correlation between mRNA and protein for CSF-1R, we examined whether F4/80 mRNA could be detected in PMN samples. As shown in Figure 4E, F4/80 mRNA was also abundant in the granulocytes, comparable with the BMM and TEPM.

Northern detection of CSF-1R mRNA in PMN We considered the formal possibility that the real-time PCR might detect a partial CSF-1R transcript or a cross-reactive one in neutrophils. Therefore, we examined the expression of CSF-1R transcripts in granulocytes by Northern blot analysis. Representative results are shown in Figure 5A. A band of the http://www.jleukbio.org

Fig. 4. Real-time PCR analysis of c-fms and other genes in PMN and macrophages. Total RNA (1 ␮g) isolated from peritoneal neutrophils/PMN cells (Pert-PMN), nonadherent total WBC (Non-adh WBC), Ly-6G-positive cells (Ly-6G pos cells), Ly-6G-negative cells (Ly-6G neg cells), BMM, and TEPM were reverse-transcribed, and real-time PCR was performed on the cDNAs for CSF-1R c-fms (A), G-CSFR (B), Ly-6G (C), S100A8 (D), and F4/80 (E; see Materials and Methods). cDNA from NIH3T3 fibroblasts (NIH3T3) and untranscribed RNA from BMM (BMM no RT) were used as negative controls. PCR amplifications were done in triplicate. Data are representative of at least three independent experiments.

expected size was detected, and in keeping with the real-time PCR data, the expression level of CSF-1R mRNA was lower than that for the macrophage samples (BMM, RPM, or TEPM). The intensity of the CSF-1R band in PMN samples was approximately half that of the BMM in three separate preparations, as determined by densitometry analysis (data not shown). Given that densitometry is only semiquantitative, this result is compatible with the quantitative RT-PCR (qRT-PCR) findings. Furthermore, the Northern data also confirmed the presence of full-length mRNA for F4/80 in PMN samples; the detected mRNAs were of identical size and comparable abundance in the various granulocyte and macrophage populations (Fig. 5A).

The samples were also probed for Ly-6G mRNA expression, and as expected, a high level of expression could be detected in PMN (Fig. 5A). In all of macrophage samples analyzed, no Ly-6G message could be detected, confirming the real-time PCR data and confirming that macrophages do not express Ly-6G. These data together demonstrate that full-length CSF-1R mRNA is expressed in neutrophils at levels comparable with macrophages and that its detection cannot be a result of macrophage contamination of the neutrophil preparations. Hence, the expression of the CSF-1R-EGFP transgene accurately reflects the transcription of the corresponding mRNA in granulocytes, and by extension, granulocytes


117

express all the transcription factors necessary to transcribe this gene.

CSF-1R protein could not be detected in granulocytes The FACS profiles of granulocytes suggest that the CSF-1R mRNA, which we detected, is not reflected at the protein level on the surface or within the cells (Fig. 3). To confirm this, we prepared the whole cell lysates from the same samples used in Northern experiments. Western analyses of these extracts failed to detect any CSF-1R in any PMN samples (Fig. 5B), whereas the antibody readily detected the protein in all macrophage samples (Fig. 5B).

Shared expression of myeloid genes in macrophages and granulocytes

Fig. 5. Northern hybridization and Western immunoblotting detection of c-fms in macrophages and granulocytes. Total RNA (10 –15 ␮g), isolated from BMM and Ly-6G-positive granulocytes, was electrophoresed, blotted on membrane, and hybridized with radiolabeled c-Fms, Ly-6G, and F4/80 probes as described in Materials and Methods Total RNAs from NIH3T3 fibroblasts, the NMU-MG mammary epithelial cancer cells, and the MC-3T3 osteoblast cell line were also included as negative controls. HPRT was used as the RNAloading control (A). Whole cell lysates were prepared from BMM, RPM, TEPM, Ly-6G-positive cells from the inflamed peritoneal cavity and isolated by MACS, Ly-6G-negative cells (the flow-through cells from MACS experiments), and PMN isolated by MACS from BM. Proteins (20 ␮g) were separated on SDS-PAGE and blotted into PVDF membrane. Levels of CSF-1R (c-Fms) protein were determined by incubation of the membrane with a rabbit antiCSF-1R antibody as described in Materials and Methods. Total Akt protein detection was used as a loading control (B).

118


The data obtained with CSF-1R and F4/80 suggest that the mature phenotype of neutrophils is more closely related to macrophages at the transcript level than at the protein level. Recently, Theilgaard-Monch et al. [40] published cDNA microarray profiling data of human granulocytes supporting expression of CSF-1R mRNA in BM PMN. Examination of public domain microarray data (symatlas.gnf.org; www.lsbm.org) also indicates that CSF-1R and many other macrophage-expressed genes are detected at similar levels in purified, CD14-positive monocytes, CD33-positive myeloid cells, and unfractionated BM leukocytes (which are predominantly granulocytes). To assess the generality implied by coexpression of CSF-1R and F4/80 mRNA in mouse cells, we carried out cDNA microarray experiments comparing the expression profiles of two highly enriched populations of these cells: the Ly-6G-isolated granulocytes versus BMM cultivated in CSF-1. Our intention was to look at the expression of known myeloid-specific/myeloidexpressed genes and by such a structured comparison, to identify those transcripts that truly distinguish the two cell lineages. One potential outcome would be to identify a gene, which unlike CSF-1R or F4/80, might have a promoter that could be used to generate a truly macrophage-specific transgene. We selected known myeloid-specific genes and grouped them into several categories based on likely roles in differentiation and control of myeloid cell function, i.e., pattern recognition receptors (PRR)/membrane proteins, myeloid-specific enzymes, transcription factors, cytokines/chemokines and other factors, and tyrosine kinases. Figure 6 depicts the expression profiles of genes within the above categories. The overall picture is that the expression profiles are similar. It is surprising that in this comparison, the detection of CSF-1R in the macrophages was substantially higher than in the granulocytes, along with CD14 and scavenger receptor B (Fig. 6A). This is not consistent with the more qRT-PCR or Northern blot data. It may be that the probe used on arrays selectively detects 3⬘ untranslated region variants, which are known to exist in the CSF-1R gene. Whatever the explanation, each of these transcripts is still readily detected in the neutrophils. In keeping with the expression of CSF-1R and F4/80 mRNA, the granulocytes and macrophages expressed comparable levels of transcripts encoding a range of PPR (MSR-1 and -2, sialoadhesin, macrosialin, Marco, mannose receptor, and Mpeg-1). All of http://www.jleukbio.org

Fig. 6. Microarray profiling of myeloid-restricted gene expression in macrophages and granulocytes. The histograms show the comparison of gene expression levels between macrophages (black bars) and granulocytes (gray bars). Genes were grouped into five categories, namely the PRR/membrane proteins (A), myeloid-specific enzymes (B), transcription factors (C), cytokines/chemokines and other factors (D), and Src Family tyrosine kinases (E). The mRNA levels are expressed as normalized relative intensity ratio (Cy3/Cy5) as described in Materials and Methods. The complete dataset for genes other than described above can be viewed at www.macrophages.com. Flt-3, Fetal liver tyrosine kinase 3; MSR-1, macrophage scavenger receptor-1; COX-1, cyclooxygenase-1; iNOS, inducible NO synthase; MMP-2, matrix metalloproteinase 2; TRAP, TNF-related activation protein; uPA, urokinase-type plasminogen activator; Egr-1, early growth response factor-1.

these have been considered previously to be macrophagerestricted based on the patterns of binding by mAb. The pattern was validated internally by coexpression of many genes known or inferred to be shared, such as some chemokine receptors, the cell adhesion molecules, and the GM-CSFR (Fig. 6A). The populations differed most markedly in that there was a small set of known granulocyte surface marker genes, i.e., the formyl peptide receptor, the neutrophil chemokine receptor

CCR1, and the surface marker Ly-6G, which were indeed expressed solely in the granulocyte mRNA samples but were undetectable in the macrophages. Figure 6B compares the expression in the two populations of a number of myeloid-associated enzymes. The components of the phagocyte oxidase (p47phox, p67phox, p91phox) as well as MPO were expressed at similar levels, although in our experience, BMM are actually very poor at producing oxygen-free


119

radicals [41]. The mRNAs encoding granule proteins such as lactotransferrin and lysozyme were also expressed at similar levels. As with the surface proteins above, the major distinction between the two mRNA samples was the granulocyte-restricted expression of a subset of genes known to be associated with granulocyte differentiation. These include neutrophil elastase and cathepsin G. It is interesting that whereas the two populations expressed similar levels of COX-2, which in macrophages, is strongly inducible by TLR agonists [42], only the granulocytes express COX-1, which has been shown previously to be induced specifically in association with granulocyte differentiation [43]. Amongst other granulocyte-specific transcripts, we detected restricted expression of ␣-1-antitrypsin and the S100 calcium-binding protein family members, as well as constitutive expression of certain cytokines, IL-6, IL-12a, and IL-15 (Fig. 6C). The microarray data confirmed the abundant expression of S100A8 and S100A9 in granulocytes [3, 44]. The granulocyte-specific expression of a small subset of genes against a background of genes shared with macrophages (myeloid-restricted) suggests that there are transcription factors or signaling molecules/pathways, which are unique to the granulocyte cells. Figure 6D compares the expression of a number of relevant transcription factors, including those that have previously been implicated from our own and other studies in the regulation of the c-fms/CSF-1R gene. The only marked differences between the two populations of mRNA were the absence of detectable Egr-1, HoxB7, and STAT3 in macrophages compared with the moderate expression in granulocytes (Fig. 6D). The PU.1 and the two C/EBP proteins, C/EBP ␣ and C/EBP ␤, showed lower apparent abundance in the macrophages. There were few differences in any candidate signaling molecules between the mRNA populations. The Src family tyrosine kinase has been implicated in the development and function of various hematopoietic lineages. Members of this family are expressed uniquely at high levels in the myeloid cells [45]. We selected some members of this family and compared the expression levels in macrophage and granulocyte lineages. Overall, no major differences in expression level were observed, except that one member, c-Fyn, was expressed highly in macrophages (Fig. 6E). The microarray data provided a useful collection of genes expressed in granulocytes and macrophages. To our knowledge, our data are the first to present comparative array profiles of genes expressed in highly purified mouse macrophage and granulocyte lineages. Comprehensive data about the expression of other genes can be viewed and downloaded on our website at www.macrophages.com.

Expression of CSF-1R in cultured granulocytes and in vitro conversion into macrophage-like cells The surface expression of the CSF-1R in macrophages is regulated by multiple signals including CSF-1 itself, TLR ligands, and phorbol esters [18]. We considered the possibility that CSF-1 mRNA might be expressed in granulocytes starved of such stimuli. Accordingly, isolated peritoneal granulocytes were cultured overnight and stained for surface CSF-1R. After such cultivation, 17% of nonadherent cells in the culture 120


clearly stained for Ly-6G and CSF-1R, based on an arbitrary gate (Fig. 7A). In fact, the entire Ly-6G-positive population showed greater immunoreactivity with anti-CSF-1R antibody indicated by a right shift in the fluorescence profile after overnight cultivation in medium. The specificity of the staining and functionality of the receptor were shown by a shift in immunoreactivity in the entire population caused by addition of the ligand CSF-1 (Fig. 7A, right panel). Based on this observation, we stimulated purified neutrophils with CSF-1 and cultured those cells over a time-period of 7 days. Figure 7B shows that cells grown under these conditions had a macrophage-like morphology within 3 days, compared with the nonstimulated control. Within these cultures, there was some evidence of phagocytosis of residual dying neutrophils (not shown). Identical results were obtained using Ly-6G-purified cells or adherence-depleted neutrophils as the starting population. Overnight culture also led to induction of macrophage marker F4/80 on a subset of the purified granulocytes. In the presence of CSF-1, F4/80 was induced further in parallel with a down-regulation of the granulocyte marker Ly-6G on the same cells, strongly indicating that there is a direct precursor/ product relationship between the neutrophils and macrophages (Fig. 7C). The long-term survival and phenotypical transformation of neutrophils into macrophage-like cells seem to be dependent on the presence of CSF-1; other stimuli tested (fMLP, GM-CSF, LPS, or PMA) were without effect (data not shown).

DISCUSSION In the first part of this work, we have shown that the CSF-1REGFP transgene is expressed in granulocytes (PMN) and presented evidence, which is an accurate reflection of the transcription of the gene. The discovery that CSF-1R mRNA and the CSF-1R-EGFP transgene are expressed in PMN validates our conclusion that the promoter and first intron of the gene contain all of the elements required for appropriate expression. In a sense, the expression in neutrophils could be predicted from the promoter elements present in the promoter and first intron, namely PU.1, C/EBP, AML1, and Sp1, all of which we have confirmed as expressed in neutrophils as well as in macrophages. One might otherwise ask what elements in the CSF-1R gene preclude the expression in granulocytes. The promoter of the mouse F4/80 gene contains a similar set of functional elements, especially the PU.1 and C/EBP sites [46], and we show that F4/80 mRNA is also expressed in neutrophils. In the case of F4/80, a similarity in the presence of regulatory, purine-rich sequences in the F4/80 and neutrophil elastase gene promoters has been observed [46]. One of the core aims of our studies of the CSF-1R promoter was the expectation that we would be able to generate tissue-specific gene targeting (through expression of Cre-recombinase) or overexpression, specifically excluding granulocytes. Others have used the lysozyme promoter [47, 48] and more recently, have speculated about the use of the F4/80 promoter [46] for this purpose. Like CSF-1R, both of these are expressed clearly at the mRNA level in neutrophils, along with numerous other genes previously considered to be macrophage-specific based http://www.jleukbio.org

Fig. 7. Detection of granulocyte and macrophage markers on cultured neutrophils. Thioglycollate-elicited peritoneal neutrophils and RPM cells, harvested as described before, were used directly (Day 0) or after the indicated time-points (Days 1, 3, 7) in the presence or absence of CSF-1. To identify CSF-1R-expressing neutrophils, total peritoneal cells were stained with anti-Ly6G-PE and anti-CSF-1R-FITC antibodies and subjected to FACS analysis. Percentages indicate the Ly-6G/CSF-1R double-positive population. In the right panel (day 1 plus CSF-1), rCSF-1 (104 U/ml) was added to the overnight-cultured neutrophils 1 h prior to harvest for immunostaining and flow cytometry. Note that the CSF-1 diminished anti-CSF-1R selectively but not Ly-6G immunoreactivity (A). For long-term culture, cells were further purified by Ly-6G MACS separation. Images produced by light microscopy were taken 3 days after isolation and culture of purified peritoneal neutrophils ⫾ CSF-1 (B), and cells, which were grown in CSF-1, were stained with anti Ly-6G PE and anti F4/80 FITC antibodies. Cells were analyzed by FACS, and results are shown as dot-plots and also as a histogram overview to focus on F4/80 expression at the indicated time-points (C). Data are representative of at least three experiments.

on protein detection using mAb. From a technical viewpoint, our data suggest that it may not be possible to generate macrophage-specific genetic manipulations without also affecting gene expression in the closely related granulocyte cells. By contrast, granulocyte-specific transgenes might well be achievable using the promoters of a number of the genes identified herein. Granulocytes and macrophages differentiate from a common, committed progenitor cell. The comparison of the transcriptional profiles of the granulocytes and macrophages suggests that macrophages are the default myeloid cell, and granulocytes arise through selective induction of a small number of additional, granulocyte-specific genes to the transcriptome, which is shared with macrophages. The comparative profiling of transcription factors highlights three candidate regulators of

lineage divergence, and indeed those factors, Egr1, HOXB7, and STAT3 (which is implicated in G-CSF signaling), have all been shown to be necessary and/or sufficient for granulocyte differentiation in a number of cell line models [49 –51]. In addition, the combined overexpression of C/EBP ␣ and ␤ in granulocytes may underlie the role of these factors in granulocyte transcriptional control, as evidenced by the effect of KOs in mice [11, 52–54]. The expression of so many macrophage-associated mRNAs in neutrophils raises the issue of whether there could be circumstances in which they are translated into protein. Neutrophils are considered to be end-stage cells, which undergo rapid apoptosis following recruitment to inflammatory sites and are subsequently engulfed by macrophages. They have a comparatively simple proteome, highlighted by a small number of


121

abundant proteins, especially the S100 proteins S100A8 and S100A9 [55]. It is therefore rather surprising that they have such a complex transcriptome. However, there is evidence that with appropriate stimulation, for example, with IFN-␥ and GM-CSF, mature human neutrophils can “transdifferentiate” and acquire characteristics of so-called dendritic cells (another cell type, which is closely related to macrophages and expresses the CSF-1R-EGFP transgene; reviewed in ref. [56]). More recently, Araki et al. [57] described culture conditions in which human postmitotic neutrophils could be induced to differentiate into macrophages and express functional CSF-1R. Our data in Figure 7 show that the CSF-1R can be expressed by mouse neutrophils cultivated in vitro and that they can respond to CSF-1 with differentiation into mature macrophages. One view of inflammation is that the initial wave of neutrophil migration into a lesion is followed by their death and removal by a second wave of migration by monocyte-macrophages. Our data suggest that at least in some circumstances, conversion of a subset of the neutrophils into longer-lived phagocytic macrophages in response to CSF-1 could make a significant contribution to resolution and repair in inflammatory sites. The fact that neutrophils translate only a subset of available mRNAs has been known for many years [58]. The induction of CSF-1R and F4/80 protein after overnight cultivation of neutrophils could be a result of activated translation of the preexisting mRNAs. Recent evidence suggests that translation control is, indeed, a major mechanism permitting an alteration in phenotype in neutrophils. Lindemann et al. [59] reported that neutrophils respond to the platelet-activating factor with activated translation of a wide range of proteins including the IL-6 receptor ␣ chain. Activated translation was dependent on the mammalian target of rapamycin and the downstream effectors ribosomal S6 kinase and eIF4E-binding protein 1. Similarly, Pouliot et al. [60] reported on the activated translation of 5-lipoxygenase and Scherzer et al. [61] on translation of the signaling molecule Gi␣2 in neutrophils responding to distinct signals. In summary, our studies of the MacGreen mice have led us to extend the evidence for the close transcriptional relationship between the two major myeloid cell types. Although we have used certain markers to separate the cell types arbitrarily, each population is likely to be heterogeneous at the single cell level [62], and the clear dichotomy is probably illusory. Hence, we suggest that granulocytes recruited to inflammatory sites have the potential to make much greater contributions to the inflammatory process through activated expression of protein products traditionally attributed to macrophages.

ACKNOWLEDGMENTS This work was supported in part by the National Health and Medical Research Council of Australia and in part by a grantin-aid from Amgen Corp. to D. A. H. We thank to Xiang Lu for help in microarray data management. The authors declare that they have no competing financial interests. 122


REFERENCES 1. Hampton, M. B., Kettle, A. J., Winterbourn, C. C. (1998) Inside the neutrophil phagosome: oxidants, myeloperoxidase, and bacterial killing. Blood 92, 3007–3017. 2. Fouret, P., du Bois, R. M., Bernaudin, J. F., Takahashi, H., Ferrans, V. J., Crystal, R. G. (1989) Expression of the neutrophil elastase gene during human bone marrow cell differentiation. J. Exp. Med. 169, 833– 845. 3. Passey, R. J., Xu, K., Hume, D. A., Geczy, C. L. (1999) S100A8: emerging functions and regulation. J. Leukoc. Biol. 66, 549 –556. 4. Xu, K., Geczy, C. L. (2000) IFN-␥ and TNF regulate macrophage expression of the chemotactic S100 protein S100A8. J. Immunol. 164, 4916 – 4923. 5. Rosmarin, A. G., Yang, Z., Resendes, K. K. (2005) Transcriptional regulation in myelopoiesis: hematopoietic fate choice, myeloid differentiation, and leukemogenesis. Exp. Hematol. 33, 131–143. 6. Lenny, N., Westendorf, J. J., Hiebert, S. W. (1997) Transcriptional regulation during myelopoiesis. Mol. Biol. Rep. 24, 157–168. 7. Tenen, D. G., Hromas, R., Licht, J. D., Zhang, D. E. (1997) Transcription factors, normal myeloid development, and leukemia. Blood 90, 489 –519. 8. Friedman, A. D. (2002) Transcriptional regulation of granulocyte and monocyte development. Oncogene 21, 3377–3390. 9. Resendes, K. K., Rosmarin, A. G. (2004) Sp1 control of gene expression in myeloid cells. Crit. Rev. Eukaryot. Gene Expr. 14, 171–181. 10. Clarke, S., Gordon, S. (1998) Myeloid-specific gene expression. J. Leukoc. Biol. 63, 153–168. 11. Zhang, D. E., Hetherington, C. J., Meyers, S., Rhoades, K. L., Larson, C. J., Chen, H. M., Hibert, S. W., Tenen, D. G. (1996) CCAAT enhancerbinding protein (C/EBP) and AML1 (CBF ␣2) synergistically activate the macrophage colony-stimulating factor receptor promoter. Mol. Cell. Biol. 16, 1231–1240. 12. Scott, E. W., Simon, M. C., Anastasi, J., Singh, H. (1994) Requirement of transcription factor PU.1 in the development of multiple hematopoietic lineages. Science 265, 1573–1577. 13. McKercher, S. R., Torbett, B. E., Anderson, K. L., Henkel, G. W., Vestal, D. J., Baribault, H., Klemsz, M., Feeney, A. J., Wu, G. E., Paige, C. J., Maki, R. A. (1996) Targeted disruption of the PU.1 gene results in multiple hematopoietic abnormalities. EMBO J. 15, 5647–5658. 14. Anderson, K. L., Smith, K. A., Conners, K., McKercher, S. R., Maki, R. A., Torbett, B. E. (1998) Myeloid development is selectively disrupted in PU.1 null mice. Blood 91, 3702–3710. 15. Tagoh, H., Himes, R., Clarke, D., Leenen, P. J., Riggs, A. D., Hume, D., Bonifer, C. (2002) Transcription factor complex formation and chromatin fine structure alterations at the murine c-fms (CSF-1 receptor) locus during maturation of myeloid precursor cells. Genes Dev. 16, 1721–1737. 16. Rehli, M., Lichanska, A., Cassady, A. I., Ostrowski, M. C., Hume, D. A. (1999) TFEC is a macrophage-restricted member of the microphthalmiaTFE subfamily of basic helix-loop-helix leucine zipper transcription factors. J. Immunol. 162, 1559 –1565. 17. Hume, D. A., Himes, S. R. (2003) Transcription factors that regulate macrophage development and function. In The Macrophage as Therapeutic Target (S. Gordon, ed.), New York, NY, USA, Springer Berlin, 11– 40. 18. Himes, S. R., Tagoh, H., Goonetilleke, N., Sasmono, T., Oceandy, D., Clark, R., Bonifer, C., Hume, D. A. (2001) A highly conserved c-fms gene intronic element controls macrophage-specific and regulated expression. J. Leukoc. Biol. 70, 812– 820. 19. Hume, D. A., Ross, I. L., Himes, S. R., Sasmono, R. T., Wells, C. A., Ravasi, T. (2002) The mononuclear phagocyte system revisited. J. Leukoc. Biol. 72, 621– 627. 20. Sasmono, R. T., Oceandy, D., Pollard, J. W., Tong, W., Pavli, P., Wainwright, B. J., Ostrowski, M. J., Himes, S. R., Hume, D. A. (2003) A macrophage colony-stimulating factor receptor-green fluorescent protein transgene is expressed throughout the mononuclear phagocyte system of the mouse. Blood 101, 1155–1163. 21. Metcalf, D., Robb, L., Dunn, A. R., Mifsud, S., Di Rago, L. (1996) Role of granulocyte-macrophage colony-stimulating factor and granulocyte colony-stimulating factor in the development of an acute neutrophil inflammatory response in mice. Blood 88, 3755–3764. 22. Norman, M. U., Van De Velde, N. C., Timoshanko, J. R., Issekutz, A., Hickey, M. J. (2003) Overlapping roles of endothelial selectins and vascular cell adhesion molecule-1 in immune complex-induced leukocyte recruitment in the cremasteric microvasculature. Am. J. Pathol. 163, 1491–1503. 23. Smyth, G. K., Yang, Y. H., Speed, T. (2002) Statistical issues in cDNA microarray data analysis. In Functional Genomics: Methods and Protocols (M. J. Brownstein, A. B. Khordursky, eds.), Totowa, NJ, USA, Humana.

http://www.jleukbio.org

24. Jung, U., Bullard, D. C., Tedder, T. F., Ley, K. (1996) Velocity differences between L- and P-selectin-dependent neutrophil rolling in venules of mouse cremaster muscle in vivo. Am. J. Physiol. 271, H2740 –H2747. 25. Geissmann, F., Jung, S., Littman, D. R. (2003) Blood monocytes consist of two principal subsets with distinct migratory properties. Immunity 19, 71– 82. 26. Fleming, T. J., Fleming, M. L., Malek, T. R. (1993) Selective expression of Ly-6G on myeloid lineage cells in mouse bone marrow. RB6 – 8C5 mAb to granulocyte-differentiation antigen (Gr-1) detects members of the Ly-6 family. J. Immunol. 151, 2399 –2408. 27. Chan, J., Leenen, P. J., Bertoncello, I., Nishikawa, S. I., Hamilton, J. A. (1998) Macrophage lineage cells in inflammation: characterization by colony-stimulating factor-1 (CSF-1) receptor (c-Fms), ER-MP58, and ERMP20 (Ly-6C) expression. Blood 92, 1423–1431. 28. Leenen, P. J., Melis, M., Slieker, W. A., Van Ewijk, W. (1990) Murine macrophage precursor characterization. II. Monoclonal antibodies against macrophage precursor antigens. Eur. J. Immunol. 20, 27–34. 29. Biermann, E., Neth, R., Grosch-Worner, I., Hausmann, E., Heinish, B., Hellwege, H. H., Kotke, A., Skrandies, G., Winkler, K. (1979) Morphologic characteristics of human blood cells in semi-solid marrow cultures. Haematol. Blood Transfus. 23, 211–215. 30. Lagasse, E., Weissman, I. L. (1996) Flow cytometric identification of murine neutrophils and monocytes. J. Immunol. Methods 197, 139 –150. 31. Nagendra, S., Schlueter, A. J. (2004) Absence of cross-reactivity between murine Ly-6C and Ly-6G. Cytometry A 58, 195–200. 32. Biermann, H., Pietz, B., Dreier, R., Schmid, K. W., Sorg, C., Sunderkotter, C. (1999) Murine leukocytes with ring-shaped nuclei include granulocytes, monocytes, and their precursors. J. Leukoc. Biol. 65, 217–231. 33. Mordue, D. G., Sibley, L. D. (2003) A novel population of Gr-1⫹-activated macrophages induced during acute toxoplasmosis. J. Leukoc. Biol. 74, 1015–1025. 34. Bliss, S. K., Butcher, B. A., Denkers, E. Y. (2000) Rapid recruitment of neutrophils containing prestored IL-12 during microbial infection. J. Immunol. 165, 4515– 4521. 35. McKinstry, W. J., Li, C. L., Rasko, J. E., Nicola, N. A., Johnson, G. R., Metcalf, D. (1997) Cytokine receptor expression on hematopoietic stem and progenitor cells. Blood 89, 65–71. 36. Goud, T. J., Schotte, C., van Furth, R. (1975) Identification and characterization of the monoblast in mononuclear phagocyte colonies grown in vitro. J. Exp. Med. 142, 1180 –1199. 37. Lin, H. H., Stacey, M., Hamann, J., Gordon, S., McKnight, A. J. (2000) Human EMR2, a novel EGF-TM7 molecule on chromosome 19p13.1, is closely related to CD97. Genomics 67, 188 –200. 38. McKnight, A. J., Gordon, S. (1998) The EGF-TM7 family: unusual structures at the leukocyte surface. J. Leukoc. Biol. 63, 271–280. 39. Stacey, M., Chang, G. W., Sanos, S. L., Chittenden, L. R., Stubbs, L., Gordon, S., Lin, H. H. (2002) EMR4, a novel epidermal growth factor (EGF)-TM7 molecule up-regulated in activated mouse macrophages, binds to a putative cellular ligand on B lymphoma cell line A20. J. Biol. Chem. 277, 29283–29293. 40. Theilgaard-Monch, K., Jacobsen, L. C., Borup, R., Rasmussen, T., Bjerregaard, M. D., Nielsen, F. C., Cowland, J. B., Borregaard, N. (2005) The transcriptional program of terminal granulocytic differentiation. Blood 105, 1785–1796. 41. Phillips, W. A., Hamilton, J. A. (1990) Colony stimulating factor-1 is a negative regulator of the macrophage respiratory burst. J. Cell. Physiol. 144, 190 –196. 42. Hwang, D. (2001) Modulation of the expression of cyclooxygenase-2 by fatty acids mediated through Toll-like receptor 4-derived signaling pathways. FASEB J. 15, 2556 –2564. 43. Rocca, B., Morosetti, R., Habib, A., Maggiano, N., Zassadowski, F., Ciabattoni, G., Chomienne, C., Papp, B., Ranelletti, F. O. (2004) Cyclooxygenase-1, but not -2, is upregulated in NB4 leukemic cells and human primary promyelocytic blasts during differentiation. Leukemia 18, 1373– 1379. 44. Hsu, K., Passey, R. J., Endoh, Y., Rahimi, F., Youssef, P., Yen, T., Geczy, C. L. (2005) Regulation of S100A8 by glucocorticoids. J. Immunol. 174, 2318 –2326.

45. Thomas, S. M., Brugge, J. S. (1997) Cellular functions regulated by Src family kinases. Annu. Rev. Cell Dev. Biol. 13, 513– 609. 46. O’Reilly, D., Addley, M., Quinn, C., MacFarlane, A. J., Gordon, S., McKnight, A. J., Greaves, D. R. (2004) Functional analysis of the murine Emr1 promoter identifies a novel purine-rich regulatory motif required for high-level gene expression in macrophages. Genomics 84, 1030 –1040. 47. Clarke, S., Greaves, D. R., Chung, L. P., Tree, P., Gordon, S. (1996) The human lysozyme promoter directs reporter gene expression to activated myelomonocytic cells in transgenic mice. Proc. Natl. Acad. Sci. USA 93, 1434 –1438. 48. Faust, N., Varas, F., Kelly, L. M., Heck, S., Graf, T. (2000) Insertion of enhanced green fluorescent protein into the lysozyme gene creates mice with green fluorescent granulocytes and macrophages. Blood 96, 719 – 726. 49. Care, A., Valtieri, M., Mattia, G., Meccia, E., Masella, B., Luchetti, L., Felicetti, F., Colombo, M. P., Peschle, C. (1999) Enforced expression of HOXB7 promotes hematopoietic stem cell proliferation and myeloidrestricted progenitor differentiation. Oncogene 18, 1993–2001. 50. Hevehan, D. L., Miller, W. M., Papoutsakis, E. T. (2002) Differential expression and phosphorylation of distinct STAT3 proteins during granulocytic differentiation. Blood 99, 1627–1637. 51. McLemore, M. L., Grewal, S., Liu, F., Archambault, A., Poursine-Laurent, J., Haug, J., Link, D. C. (2001) STAT-3 activation is required for normal G-CSF-dependent proliferation and granulocytic differentiation. Immunity 14, 193–204. 52. Zhang, P., Iwasaki-Arai, J., Iwasaki, H., Fenyus, M. L., Dayaram, T., Owens, B. M., Levantini, E., Huettner, C. S., Lekstrom-Himes, J. A., Akashi, K., Tenen, D. G. (2004) Enhancement of hematopoietic stem cell repopulating capacity and self-renewal in the absence of the transcription factor C/EBP ␣. Immunity 21, 853– 863. 53. Wang, N. D., Finegold, M. J., Bradley, A., Ou, C. N., Abdelsayed, S. V., Wilde, M. D., Taylor, L. R., Wilson, D. R., Darlington, G. J. (1995) Impaired energy homeostasis in C/EBP ␣ knockout mice. Science 269, 1108 –1112. 54. Screpanti, I., Romani, L., Musiani, P., Modesti, A., Fattori, E., Lazzaro, D., Sellito, C., Scarpa, S., Bellavia, D., Lattanzio, G., Bistoni, F., Frati, L., Cortese, R., Gulino, A., Ciliberto, G., Constantini, F., Poli, V. (1995) Lymphoproliferative disorder and imbalanced T-helper response in C/EBP ␤-deficient mice. EMBO J. 14, 1932–1941. 55. Hobbs, J. A., May, R., Tanousis, K., McNeill, E., Mathies, M., Gebhardt, C., Henderson, R., Robinson, M. J., Hogg, N. (2003) Myeloid cell function in MRP-14 (S100A9) null mice. Mol. Cell. Biol. 23, 2564 –2576. 56. Ellis, T. N., Beaman, B. L. (2004) Interferon-␥ activation of polymorphonuclear neutrophil function. Immunology 112, 2–12. 57. Araki, H., Katayama, N., Yamashita, Y., Mano, H., Fujieda, A., Usui, E., Mitani, H., Ohishi, K., Nishii, K., Masuya, M., Manami, N., Nobori, T., Shiku, H. (2004) Reprogramming of human postmitotic neutrophils into macrophages by growth factors. Blood 103, 2973–2980. 58. Jack, R. M., Fearon, D. T. (1988) Selective synthesis of mRNA and proteins by human peripheral blood neutrophils. J. Immunol. 140, 4286 – 4293. 59. Lindemann, S. W., Yost, C. C., Denis, M. M., McIntyre, T. M., Weyrich, A. S., Zimmerman, G. A. (2004) Neutrophils alter the inflammatory milieu by signal-dependent translation of constitutive messenger RNAs. Proc. Natl. Acad. Sci. USA 101, 7076 –7081. 60. Pouliot, M., McDonald, P. P., Khamzina, L., Borgeat, P., McColl, S. R. (1994) Granulocyte-macrophage colony-stimulating factor enhances 5-lipoxygenase levels in human polymorphonuclear leukocytes. J. Immunol. 152, 851– 858. 61. Scherzer, J. A., Lin, Y., McLeish, K. R., Klein, J. B. (1997) TNF translationally modulates the expression of G1 protein ␣(i2) subunits in human polymorphonuclear leukocytes. J. Immunol. 158, 913–918. 62. Hume, D. A. (2000) Probability in transcriptional regulation and its implications for leukocyte differentiation and inducible gene expression. Blood 96, 2323–2328.


123