Downregulation of JE and KC Genes by Glucocorticoids Does Not ...

Vol. 12, No. 10

MOLECULAR AND CELLULAR BIOLOGY, OCt. 1992, p. 4612-4621

0270-7306/92/104612-10$02.00/0 Copyright X 1992, American Society for Microbiology

Downregulation of JE and KC Genes by Glucocorticoids Does Not Prevent the Go-*Gl Transition in BALB/3T3 Cells LUCIA E. RAMEH AND MARI C. S. ARMELIN* Instituto de Quimica, Universidade de Saco Paulo, CP. 20780, Sao Paulo SP 01498, Brazil Received 8 April 1991/Returned for modification 28 May 1991/Accepted 24 July 1992

The effects of glucocorticoid hormones on the expression of the growth factor-inducible genes JE, KC, and c-myc were analyzed in parental BALB/3T3 and polyomavirus middle-T antigen-transfected cell lines. Northern (RNA) blot hybridization and run-on transcription analysis showed that (i) glucocorticoid hormones selectively inhibit JE and KC expression at the transcriptional level and (ii) the downregulatory effect of glucocorticoids on JE and KC expression is partial for serum-stimulated and middle T antigen-transformed cells and total for quiescent and exponentially growing cells. Gel mobility assays using AP-1 oligonucleotides showed a positive correlation between glucocorticoid downregulating effect and presence of the AP-1 complex. JE and KC downregulation by means of the AP-1 complex may play a role in the actions of glucocorticoids as anti-inflammatory and antitumor agents. The ability of glucocorticoids to downregulate JE and KC was used to investigate the relevance of these genes to the mitogenic response to serum growth factors. Hydrocortisone did not alter the basal DNA synthesis level displayed by quiescent 3T3 cells, but it potentiated both the mitogenic effect of platelet-derived growth factor and c-myc induction by serum growth factors. Upon serum restimulation, untreated and dexamethasone-treated quiescent 3T3 cultures entered the S phase after an identical time lag (G1). These results suggest that (i) JE and KC are not necessary for the Go->G1->S transition and (ii) c-myc overexpression is likely to be the basis for the potentiating effect of glucocorticoids on serum growth factors.

The cellular response to the peptide growth factors platelet-derived growth factor (PDGF) and fibroblast growth factor or to serum involves immediate transcriptional activation of a set of about 80 genes, among which are the proto-oncogenes c-fos, c-jun, and c-myc and the genes coding for two secreted proteins, namely JE and KC (12, 15). The products of the nuclear proto-oncogenes c-fos, c-jun, and c-myc function as intracellular mediators of the mitogenic response elicited by growth factors (4, 26, 28, 30, 35, 41). Members of the Fos and Jun families form the AP-1 transcriptional complex that is capable of trans regulating promoters that contain the AP-1 consensus element (10, 14). Formation of different complexes by induction offos andjun mRNA expression or posttranslational modification of their respective products (11) can lead to changes in the transcriptional program required for cell cycle progression (23). Phorbol esters such as tetradecanoylphorbol-13-acetate (TPA) are potent tumor promoters that can also cause changes in the transcriptional program by regulating AP-1 activity (1, 32). Among the AP-1 targets are genes involved in the inflammation process, such as those encoding collagenase and stromelysin (25). The c-Myc protein has recently been shown to form a complex with the MAX protein; the resulting heterodimer binds to DNA and is capable of transcriptional regulation (9). JE belongs to a family of cytokines that includes interleukins 2 and 6 (IL-2 and IL-6), a-interferon, macrophage colony-stimulating factor, and T-cell-activating protein 3 (43). KC, also called gro (2) and N51 (12), was found in structural studies to be related to platelet factor 4, IL-8, and other proteins involved in the inflammatory response and to act both as an intracellular mediator of IL-1 and as a negative growth regulator for epithelial cells (2). The JE gene has *

been shown to be induced not only by serum but also by IL-1, -y-interferon, tumor promoters, and poly(I-C) in a cell type-specific manner (15, 38, 40, 43, 53). Sequence analysis of the JE promoter has revealed an AP-1-like sequence that is important for basal JE expression but not for TPA induction (51). Other putative elements, such as the interferon response element, nuclear factor KB, and phorbol ester-activated (PEA3)-binding sites, have also been postulated. No typical serum-responsive element was found in these studies (12, 24, 43). Therefore, regulation of JE expression by extracellular signals is not well defined. Cell transformation by DNA tumor virus oncogenes can also influence JE expression. Polyomavirus middle-T antigen increases the levels of JE mRNA (39), whereas ElA transformation leads to reduced levels of JE transcripts (50). Glucocorticoid hormones potentiate the mitogenic effect of peptide growth factors (3). Glucocorticoids also inhibit proliferation of several cultured cell lines (5, 34). Additional and probably related activities of glucocorticoids are to block the action of the tumor promoter phorbol myristate acetate (7) and to act as potent anti-inflammatory agents (21). Activated glucocorticoid receptors can exert a positive control on gene expression by direct interaction with specific DNA sequences, termed glucocorticoid responsive elements (22, 37, 45). The glucocorticoid receptor also represses transcription of a variety of genes upon hormone binding. The anti-inflammatory and anti-tumor promoter effects of glucocorticoids have been proposed to involve repression of the genes encoding IL-1 (31), tumor necrosis factor (8), and the metalloproteases collagenase and stromelysin (20, 27). The effects of glucocorticoids on gene regulation depend not only on the genetic background but also on the cellular context. Recently, the basis for the negative glucocorticoid action on collagenase and proliferin gene expression was proposed to be protein-protein interference between the

Corresponding author. 4612

VOL. 12, 1992

JE AND KC EXPRESSION IN CELL CYCLE CONTROL

glucocorticoid receptor and the AP-1 trans-acting complex (17, 27, 33, 46, 52). The net result of this cross talk depends on the nature of the AP-1 components (17). We report here that glucocorticoids specifically repress one class of serum-inducible genes, namely, that of the secreted regulators JE and KC. This effect was observed for both basal and viral oncogene-induced JE expression, situations in which AP-1 activity is thought to direct the JE promoter activity (51). We also show that serum-stimulated JE expression is partially abolished by glucocorticoid treatment. Run-on transcription and gel mobility assays allow us to propose that repression occurs at the transcriptional level and through the AP-1 trans-regulating complex, as described for the collagenase promoter (27). The downregulating effect of glucocorticoid hormones on JE expression allowed us to address the relevance of JE expression for the mitogenic response to serum growth factors. Evidence suggesting that the JE product is not involved in the Go-3G1-*S transition of 3T3 cells is presented. MATERIALS AND METHODS Cells and culture conditions. Early-passage BALB/3T3 cells (clone A31) were obtained from C. Stiles' laboratory (Dana Farber Cancer Institute, Boston, Mass.). The Bi and B39 transfectant lines were obtained by cotransfection of polyomavirus middle-T antigen constructs in which middle-T antigen expression is under the metallothionein (Bi) or the glucocorticoid (B39)-inducible mouse mammary tumor virus promoters and a neomycin resistance marker plasmid (see reference 39 for details). Cells were cultured in 10% fetal calf serum (FCS; Cultilab, Campinas, Sao Paulo, Brazil) and 90% Dulbecco's modified Eagle's medium (DME) containing 1.2 g of sodium bicarbonate, 25 mg of ampicillin, and 100 mg of streptomycin per liter. DNA synthesis assay. Cells were plated in 24-well trays and allowed to reach confluence in 10% FCS-DME. Cultures were then subjected to serum starvation by incubation in 0.5% FCS-DME for 24 h. At time zero, hydrocortisone (100 ng/ml), PDGF (2 U/ml; obtained from Bioprocessing, Durham, U.K.), or FCS (10%) was added. Twelve hours later, [3H]thymidine (0.5 i±Ci/ml; 10-7M) was added, and incorporation into DNA was allowed to proceed for 12 h. Cultures were washed twice in 5% trichloroacetic acid, cells were lysed in 0.5 N NaOH, and samples were counted in a liquid scintillation counter. The kinetics of S-phase entry were determined by adding FCS and [3H]thymidine at time zero and collecting samples after different periods of time. Cultures were processed for autoradiography with Kodak stripping film. RNA extraction and Northern (RNA) blot hybridization. Cells were plated in 150-mm-diameter plates in 10% FCSDME. Exponentially growing cultures or serum-starved (0.5% FCS-DME, 24 h) confluent cultures were treated with hydrocortisone (100 ng/ml), dexamethasone (40 ng/ml), cycloheximide (10 ,ug/ml), and/or serum (10%) for different time intervals before RNA extraction by the isothyocyanate method and purification by centrifugation on a CsCl cushion (13) were performed. Samples (10 ,ug) of total RNA were fractionated in 1% agarose-formaldehyde gels and transferred to nitrocellulose membranes (49). After being baked at 80°C for 2 h, membranes were hybridized to 32P-labeled probes obtained by random primer extension (18) to 1 x 109 to 2 x 109 dpm/,g of DNA. The following DNA fragments were used as probes: (i) a 0.75-kb PstI insert from JE-SP64

4613

(16, 43); (ii) a 0.85-kb insert from SP64-KC (16); and (iii) a 3.8-kb XhoI insert from mouse mammary tumor virus (MMTV)-H3-c-myc (48). The amount of RNA in the samples was controlled by hybridizing them to a glyceraldehyde-3phosphate dehydrogenase (GAPDH) (19) probe. After exposure to XK-1 Kodak X-ray film, densitometric scannings were carried out by using GAPDH or 28S rRNA as internal standards in a Shimadzu CS9000 densitometer. Run-on transcription. Cells were plated in 600-cm2 Nunc square dishes at 5 x 106 to 10 x 106 cells per dish in 10% FCS-DME and allowed to grow to subconfluence. Cultures were serum starved by incubation in 1% FCS-DME for 40 h. Treatment with hydrocortisone (100 ng/ml) and/or cycloheximide (10 ,g/ml) was for 2 or 3 h for serum-starved and exponentially growing cultures, respectively. Nucleus preparation, [32P]UTP incorporation, DNA dot blots, and hybridization were performed by the methods of Ausubel et al. (6). The same number of acid-precipitable Cerenkov counts (2 x 106 cpm) were used for each condition. Densitometric tracings were obtained in a Shimadzu CS9000 densitometer. GAPDH and genomic DNA were used as internal standards. DNA-protein binding assay. Nuclear extracts were prepared as described previously (47). Five micrograms was incubated for 10 min at 0°C in a 30-pl reaction volume containing 20 mM HEPES (N-2-hydroxyethylpiperazine-N'2-ethanesulfonic acid), pH 7.9-100 mM KCl-0.1 mM EDTA-20% glycerol-2% polyvinyl alcohol-1% dithiothreitol. Two nanomoles of radiolabeled oligonucleotide fragment was then added, and the incubation was continued for 30 min at 0°C. DNA-protein complexes were separated by electrophoresis through a 5% polyacrylamide gel (60:1 acrylamide/ bis-acrylamide ratio). The AP1 sequences used were as follows. (i) Consensus APl: 5'GATCOOCGOTGAGTCAC3' GOGOGAOTOAGTGCTAG

(ii) JE-APl:

5'GATCOGGGTGGAGTCAGG03' CCOAOOTOAGTOCGOTAG The AP-2 oligonucleotide was used as a nonspecific competitor in gel mobility shift experiment and is shown below. 5'GATCCTGGGGAGCCTGGGGACTTTCCACACCCTAAC3' CTAGGACCCCTCGGACCCCTGAAAGGTGTGGGATTG These oligonucleotides were purchased from our Biochemistry Department Oligonucleotide Synthesis Facility. RESULTS Glucocorticoid hormones inhibit the serum-induced JE and KC expression. The effects of dexamethasone on JE and KC expression during the Go0-G1 transition were examined by Northern blot hybridization. BALB/3T3 cells (clone A31) were made quiescent by serum starvation, and total RNA was extracted from cultures maintained for different periods after serum, dexamethasone, and/or cycloheximide addition. The results shown in Fig. 1 and Table 1 indicate that the basal mRNA level is low for both JE and KC. Upon serum addition, JE is induced, with maximum mRNA levels being reached after 3 h. The KC probe yielded a weaker signal and significant cross-reactivity with the 4.5-kb (28S) rRNA. Serum induction of KC reached a maximum at 1 h. Dexamethasone caused a dramatic decrease in serum-induced JE mRNA levels (69.0, 70.6, and 72.0% inhibition upon 3, 6, and 9 h of treatment, respectively). The effect of glucocorticoid treatment on serum-induced KC levels was more evident for

4614

RAMEH AND ARMELIN

MOL. CELL. BIOL.

TIME(h) o S

-

1 3 6

9

++

+

+

1 3 6 9 12 0 1.5 3 4.5 6 1.5 3 4.5 6 +1-++-

+++

++

+

++

+

+

+ +

_+ +++

Dex

++ + + + + + _4-

Chx 4.5-

+

4..X

1.8 -

#0* "

.

-JE

A TIME(h)o S

-

1 3 6 9

0 1 36 9 12 0

1.534.56 0 1.534.56

++++

-

+ + ++ +

+ + + + _ + + + +

Dex

++ + +

Chx

. , ++.+, .+

_-

4.5-

#

_

sZ._

12-

Bt.

*t

"KC

B FIG. 1. Time course of JE and KC induction by serum in the absence or presence of dexamethasone (Dex) and/or cycloheximide (Chx). Total RNA from quiescent BALB/3T3 (clone A31) treated with 10% fetal calf serum (S), dexamethasone (40 ng/ml), and/or cycloheximide (10 ,g/ml) was analyzed by Northern blot hybridization using 32P-labeled probes to JE (A) or KC (B). Cycloheximide was always added 0.5 h before serum and/or dexamethasone. Positions of 4.5- and 1.8-kb rRNAs are indicated.

the early time points (80.6 and 55% inhibition for 1 and 3 h of treatment, respectively). As expected from previous reports (16), cycloheximide treatment caused superinduction of JE and KC (Fig. 1 and Table 1). In the presence of this protein synthesis inhibitor, the effect of glucocorticoids was suppressed, indicating the involvement of a labile cellular factor(s) in this downregulating phenomenon. Glucocorticoids abolish the basal steady-state levels of JE transcripts. JE expression in quiescent and exponentially growing cells was also analyzed by Northern hybridization (Fig. 2). Serum-starved, quiescent BALB/3T3 cells display low levels of JE expression. The faint band, corresponding to the 0.8-kb JE message, completely disappears upon 3 h of hydrocortisone treatment (78% inhibition). Exponentially growing cells display high JE mRNA levels that are completely down-regulated upon 3 h of hydrocortisone treatment. The same treatment causes partial inhibition of the serum-induced JE levels. In contrast to the downregulating

effect on JE expression, the same glucocorticoid treatment increases the level of c-myc induction by serum and has no effect on GAPDH expression (Fig. 2). Therefore, we conclude that glucocorticoids specifically inhibit JE expression in quiescent and exponentially growing BALB/3T3 cells while potentiating the action of serum growth factors at the c-myc level. Glucocorticoids inhibit the polyomavirus middle-T antigeninduced JE and KC expression. We have previously shown that polyomavirus middle-T antigen-transformed cells display high basal levels of JE and KC mRNAs (39, 39a). The effect of glucocorticoid treatment was analyzed in transfectant cell lines B39 and Bi, in which the middle-T antigen gene is under the glucocorticoid-inducible mouse mammary tumor virus promoter (B39) or the metallothionein promoter (Bi). Middle-T antigen expression in B39 cells is inducible by glucocorticoid treatment (with maximum mRNA levels

TABLE 1. Relative levels of KC and JE mRNA upon treatment of quiescent A31 cells with serum, dexamethasone, and/or cycloheximidea Addition(s) (h of treatment)b

S (1) S (3) S (6) S (9) Dex (4.5) S + Dex (1) S + Dex (3) S + Dex (6) S + Dex (9) S + Dex (12) Chx (3) S + Chx (1) S + Chx (3) S + Chx (4.5) S + Chx (6) Dex (3) S+Chx+Dex(1) S + Chx + Dex (3) S + Chx + Dex (4.5) S + Chx + Dex (6.0)

_"


VOL. 12, 1992

Relative level of: JE mRNA

KC mRNA

1 3.5

1 9.3 7.1 7;7 7.6 1.5 1.8 3.2 6.8 6.3 2.0 2.2 26.7 37.7 43.7 49.8 2.2 27.0 32.0 44.6 44.2

14.2 8.5 6.4 3.4 4.4 2.5 1.8 0.6 1.4 9.3 26.5 26.9 28.8 8.9 13.2 35.7 25.7

a Densitometric analysis of data presented in Fig. 1. b S, serum; Dex, dexamethasone; Chx, cycloheximide.

reached upon 3 h of treatment) and is high and constitutive in B1 cells (39). Figure 3 shows that a dramatic reduction in JE and KC mRNA levels occurs upon hydrocortisone treatment of quiescent (Fig. 3A) or exponentially growing (Fig. 3B) B39 cells. The same results were obtained with the independently isolated Bi cells (Fig. 3C). A slight increase in JE and KC expression occurs at 4.5 h of hydrocortisone treatment and is probably due to middle-T antigen induction (Fig. 3A). In order to verify whether this downregulating effect of glucocorticoids on middle-T antigen-induced JE and KC expression is protein synthesis dependent, B39 cells were treated with hydrocortisone in the presence of cycloheximide. The results, shown in Fig. 3D, indicate that in contrast to the situation in serum-stimulated quiescent BALB/3T3 cells (Fig. 1), the downregulatory effect of glucocorticoids on JE and KC in middle-T-transformed cells is not sensitive to cycloheximide treatment. These results suggest that the putative factor(s) responsible for mediating JE and KC inhibition by glucocorticoids is constitutively expressed in transformed cells but not in normal cells. Downregulation of JE and KC by glucocorticoids is transcriptionally regulated. Nuclear run-on transcription assays were used to investigate the mechanisms of JE and KC downregulation by glucocorticoid hormones. Parental A31 and B39 transfectant cells were plated in 10% FCS-DME and allowed to grow to subconfluence. The medium was then changed to 1% FCS-DME for 40 h. Cultures were treated with hydrocortisone (100 ng/ml) and/or cycloheximide (10 ,ug/ml) and/or serum (10%) for 3 h. The results (Fig. 4 and Table 2) show that (i) serum increases the JE nuclear run-on signal in both A31 and B39 cells (2.7- and 3.4-fold, respectively) but fails to cause significant induction of KC; (ii) hydrocortisone markedly reduces the serum-induced levels of JE and KC in both A31 and B39 cells (82 and 71% inhibition of JE and 45 and 50% inhibition of KC in A31 and

Quiescent

Exponen ti ally Serum Growing Stimu l ted

a-

Serum

Hydrocortisoxne

A

r

-

3

6

4615

-

3

3

3

3

h

-

3

6

h

AL,&

&..AW40 WWI"W 61 w WWW

A6AAw&

-

JE

-

GAPDH

- MYC - GAPDH

.;

FIG. 2. Effects of hydrocortisone on basal and serum-stimulated JE and c-myc mRNA levels. Quiescent or exponentially growing BALB/3T`3 cells were treated with hydrocortisone (100 ng/ml) alone or hydrocortisone plus serum (10%). Total RNA was extracted and analyzed by Northern blot hybridization. The GADPH probe was used as an internal control. The same filter used to probe for JE was reprobed with GAPDH and c-myc.

B39 cells, respectively); (iii) the protein synthesis inhibitor cycloheximide increases the transcription rate of JE and KC, especially when combined with serum; and (iv) hydrocortisone inhibits JE expression in B39 cells in the presence of cycloheximide but has no effect in A31 cells in the presence of cycloheximide. Comparison between the densitometric tracings for JE in Northern blots (Fig. 1 and Table 1) and run-on assays (Fig. 4 and Table 2) yielded 69 and 71% inhibition of the seruminduced levels with hydrocortisone (3 h treatment), respectively. This indicates that the downregulating effect of glucocorticoids is exerted mostly at the transcriptional level. The influence of cycloheximide on the effects of glucocorticoids observed in A31 and B39 cells leads us to conclude that the downregulating effect of glucocorticoids is dependent upon cellular factors which are absent from serumstarved A31 cells but which are constitutively expressed in B39 cells. It is important to note that the downregulating effect of hydrocortisone also occurs in exponentially growing B39 cells both in the absence and in the presence of

cycloheximide (results not shown). JE and KC downregulation by glucocorticoids is likely to be mediated by the AP-1 complex. The AP-1 complex is known to mediate glucocorticoid repression of the collagenase gene (27). AP-1 is present in very low levels in quiescent BALB/ 3T3 cells but is readily induced, through a protein synthesisdependent pathway, upon serum restimulation. An AP-1-like sequence, differing from the consensus sequence by 1 bp, was reported to be important for the expression of basal JE levels (51). Therefore, we set out to investigate whether the

4616

RAMEH AND ARMELIN

MOL. CELL. BIOL.

FIG. 3. Effects of hydrocortisone (Hy) and cycloheximide (Chx)

A Hy

on middle-T antigen-induced JE and KC expression. Serum-starved

(A, C, and D) and exponentially growing (B) B39 cells (A, B, and D) and Bi cells (C) were treated with hydrocortisone (100 ng/ml) or hydrocortisone plus cycloheximide (10 ,ug/ml) for the indicated times. Total RNA was extracted and analyzed by Northern blot hybridization using 32P-labeled probes to JE, KC, and GAPDH (used as an internal standard).

1.5 3.0 4.5 6.0 h

-

JE

....

-GAPDH

.........

.,,flj:j.

:,lN

p. 'I

",

-KC

B -

1.5 4.5 h

1.5 4.5 Hy

-KC

-JE

AP-1 complex could be mediating the inhibitory effects of glucocorticoids on JE expression. The levels of AP-1 activity were evaluated by the ability of nuclear extracts to shift the mobility of AP-1 consensus (Fig. 5A and B) and JE-AP-1 (Fig. 5C) oligonucleotides. The results show the following. (i) Middle-T antigen-transformed cells and serum-stimulated BALB/3T3 cells display high AP-1-binding activity, in contrast to quiescent 3T3 cells. Competition by excess cold AP-1 consensus oligonucleotide and the inability of nonspecific (AP-2) oligonucleotide to compete with AP-1 confirm the nature of the AP-1 complex that is causing the mobility shift. (ii) Glucocorticoid treatment has no effect on the AP-1 (or JE-AP-1)-binding activity present in nuclear extracts. The activated glucocorticoid receptor has also been shown to inhibit collagenase expression without altering the AP-1 binding to the TPA-responsive element (TRE) sequence (27). (iii) Cycloheximide treatment prevents the appearance of the serum-induced AP-1-binding activity in BALB/3T3 cells (Fig. 5B) but has no effect on B39 constitutive levels of AP-1 (not shown). Therefore, the presence of AP-1 activity correlates with the ability of glucocorticoids to inhibit JE expression in the presence of cycloheximide. JE expression does not affect BALB/3T3 cells' transition from the Go state to the G1 phase of the cell cycle. The downregulatory effect of glucocorticoids on JE and KC was used to evaluate the relevance of these genes to cell cycle entry and growth. Figure 6 shows that hydrocortisone treatment does not affect the basal DNA synthesis level displayed by quiescent 3T3 and B39 cells but that it has a synergistic effect when added to cultures treated with PDGF. Synergism between glucocorticoid hormones and FGF has previously been described (3). In Fig. 7, the densitometric scanning of data presented in Fig. 1 is plotted with the kinetics of [3H]thymidine uptake into DNA in quiescent cells that were restimulated to enter the cell cycle by serum addition in the presence or absence

GA P D H

TABLE 2. Relative levels of JE and KC transcripts in A31 and B39 cellsa

C -

+ Hy

4.5 4.5 2.0 Chx - 4.5 2.0 Hy

Relative transcript levels in:

Addition(s)"

Hy

-JE

-JE :S

~ ~

-

f

.

D

S S + Hy Chx Chx + Hy S + Chx S + Hy + Chx

B39 cells

A31 cells KC

JE

KC

JE

1 1.5 1.1 0.5 2.6 2.9 5.2 5.0

1 1.3 2.7 0.5 2.6 3.8 4.6 4.3

1 1.4 1.2 0.6 0.9 0.7 1.0 0.3

1 2.8 3.4 1.0 3.8 1.5 5.2

a Densitometric analysis of data presented in Fig. 4. bHy, hydrocortisone; S, serum; Chx, cycloheximide.

1.3

~W.A .*

VOL. 12, 1992


DISCUSSION

G

3T3

D3 H

p._*

KC JE

,2

A

pUC

*SH

.~~~~

*

*~~~~~

S+H

w w SS

H~~~+C

N

3T5

H+C

sC

*0*S+H+C

*

G p D H

B

KC JE

H * * *

* *;w .....

4617

+ ~~~S+H

CH

transcription assays using isolated nuclei from (A) and B39 (B) cells. Effects of hydrocorti-sone (H [100 ng/ml]) serum (S [10%]) and/or cycloheximide (C [10 PSg/ml]) treatment for 3 h are shown. We used 5 pg of denatured DNA from pUC19, SP64-JE, SP64-KC, and GAPDH per dot and 0.5 ,ug of genomic BALB/3T3 DNA per dot. FIG. 4. Run-on serum-starved A31

of dexamethasone. The results indicate that even when JE expression is almost totally abolished by glucocorticoid treatment (black bars), cell cycle reentry is unaffected. The lag between serum addition and S-phase entry, displayed by both hydrocortisone-treated and -untreated cultures, is identical. Consistent with this, no effect of hydrocortisone was observed on growth of BALB/3T3 cells in serum or plasma (not shown). Thus, identical saturation densities (105 cells per cm2) and doubling times (23 h) were found for control (untreated) and hydrocortisone-treated cultures in 10% serum. Therefore, no correlation was found between JE expression and growth potential.

We report here that (i) glucocorticoid hormones selectively inhibit the early response genes JE and KC but not c-myc; (ii) glucocorticoids also abolish the high and constitutive expression of JE and KC in polyomavirus middle-T antigen-transformed cells; (iii) the dependence on protein synthesis of the JE and KC downregulation by glucocorticoids is inversely correlated with the level of AP-1 transcriptional complex present in the cell; (iv) downregulation of JE and KC is at least partially due to transcriptional repression of these genes by glucocorticoids; (v) downregulation of JE and KC does not prevent cells from exiting the Go state and entering the cell cycle; and (vi) potentiation of growth factors' mitogenic response by glucocorticoids correlates with increased c-myc levels. Three models have been invoked to explain the mechanism of this downregulating effect of glucocorticoids on gene expression. The first is direct binding of hormone-activated glucocorticoid receptor to specific DNA sequences present in the target gene promoter. These so called "negative glucocorticoid-responsive elements" have been described for the prolactin gene (44). More recently, glucocorticoids have been proposed to interfere with AP-1-directed gene expression through protein-protein interactions between glucocorticoid receptor and the AP-1 complex (17, 27, 33, 46, 52). A third model suggests that downregulation of gene expression by glucocorticoids occurs as a consequence of hormone-induced transcriptional activation of a specific and labile repressor (29). Kawahara et al. (29) have described a negative effect of glucocorticoids on serum-induced JE transcription but not on the basal JE expression displayed by quiescent normal 3T3 cells. These authors favor the existence of an intermediate repressor mediating this downregulatory effect of glucocorticoids. However, the results presented here demonstrate that serum-induced and transformation-induced JE and KC expression are partially abolished by glucocorticoid treatment, whereas the basal JE expression in normal cells is completely inhibited (Fig. 1 through 3). This negative effect of glucocorticoids on JE and KC expression is dependent on de novo protein synthesis in quiescent normal cells but not in serum-starved middle-T antigen-transformed cells (Fig. 1, 3, and 4). The AP-1 element, present in the upstream region of the JE promoter, was demonstrated to be important for basal JE expression (51). Activation of the AP-1 complex is a key step in the cellular response to serum growth factors, tumor promoters, and inflammatory agents that also induce JE and KC. We used gel mobility assays and AP-1 oligonucleotides to probe into the role played by the AP-1 complex in the downregulation of JE and KC by glucocorticoids. The results show the following. (i) Quiescent 3T3 cells display low levels of both AP-1 (Fig. 5) and JE transcripts (Fig. 1 and 2). (ii) Serum restimulation leads to increased AP-1 activity (Fig. SB) and JE mRNA levels (Fig. 1 and 2), the former being protein synthesis dependent and the latter being protein synthesis independent. (iii) Serum-starved middle-T antigen-transformed cell lines B39 and B1 display both high AP-1 activity and high JE basal levels. (iv) Cycloheximide treatment of quiescent normal 3T3 cells prevents the seruminduced AP-1 synthesis (Fig. SB) but does not affect the high AP-1 levels of B39 cells (not shown) and also abolishes the negative effect of glucocorticoids on JE expression (Fig. 1 and 4A). (v) When high AP-1 activity is present (as in

4618

RAMEH AND ARMELIN

MOL. CELL. BIOL. I*

I

A

B

C

1 2 3 4 5 6 7 89101112 1 234 56 78

.

, *'

0

,

-AP-l1

-AP-1

_

1 23 45

_

-AP-1

i

a *____________________________

_

FIG. 5. Gel mobility shift using nuclear extracts from serum-starved parental A31 and middle-T antigen-transfectant cell lines B39 and Bi. (A) Nuclear extracts from A31 (lanes 1 to 3), B39 (lanes 4 and 5), and Bi (lanes 6 and 7) cultures that were left untreated (lanes 1, 4, and 6) or were treated with serum (lane 2) or dexamethasone (lanes 5 and 7) or both (lane 3). Lane 8 contains probe only, without nuclear extract. Consensus AP-1 sequence was used as the probe. (B) nuclear extracts from A31 (lanes 1 to 8) and B39 (lanes 10 to 12) cultures that were left untreated (lanes 1 and 10) or were treated with serum for 1.5 (lane 2) and 3 (lanes 3, 7, and 8) h or with cycloheximide for 3 (lane 4) or cycloheximide plus serum for 1.5 (lane 5) and 3 (lane 6) h or with hydrocortisone for 3 h (lanes 11 and 12). Consensus AP-1 oligonucleotide was used as a probe (lanes 1 to 12) in the absence of competitor (lanes 1 to 6 and 9 to 11) or in the presence of excess cold nonspecific AP-2 oligonucleotide (lane 8) or specific AP-1 oligonucleotide (lanes 7 and 12). (C) The same nuclear extracts that were used in panel A from B39 (lanes 1 and 2) and Bi (lanes 3 and 4) cultures that were left untreated (lanes 1 and 3) or were treated with dexamethasone (lanes 2 and 4). Lane 5 contains probe only. The JE-AP-1 oligonucleotide was used as a probe. Arrows indicate probe migration.

120 R E L 100 A T V 80 E

$

T

M U

60 -

L A T

40 -

0 N

20 v

..

basal

Hy

PDGF

...II

PDGF Hy

serum

FIG. 6. Effects of hydrocortisone treatment on PDGF-induced DNA synthesis stimulation. Quiescent A31 (hatched bars) and B39 (black bars) cells were treated with hydrocortisone (Hy [100 ng/ml]) and/or PDGF (2 U/ml) as indicated, and [3H]thymidine incorporation into DNA was determined by using a Beckmann Liquid Scintillation Counter. Counts were normalized by using serum as a reference. Total counts incorporated into serum-treated A31 and B39 cultures were 89,270 ± 4,120 and 71,870 ± 300, respectively.

middle-T-transformed cells [Fig. 5]), a clear inhibitory effect of glucocorticoids on JE repression is observed even in the presence of cycloheximide. Therefore, a positive correlation exists between JE repression by glucocorticoids and the presence of AP-1 activity. These observations led us to exclude the possibilities that glucocorticoids inhibit JE and KC transcription by means of a negative glucocorticoid-responsive element or by induction of an intermediate repressor. Instead, these data point to the AP-1-mediated repression model, which was first proposed to explain the effects of glucocorticoids on TPAinduced collagenase expression in HeLa cells (27). No dependence on protein synthesis was observed in this case, probably because high AP-1 activity is already present in HeLa cells. Analysis of the kinetics of JE induction by serum (Fig. 1 and 2) shows that JE mRNA is still high 6 h after serum stimulation, even though the half-life for the JE message is 70 min. Considering that the JE promoter has a functional AP-1 sequence, it is reasonable to propose that the kinetics of JE induction by serum has two components. These would be a primary component that reflects the effect of serum on the JE promoter, via a putative serum response factor, which occurs even in the presence of cycloheximide, and a secondary component that results from the concomitant serum induction of fos and jun that leads to transcriptional


VOL. 12, 1992

4619

z 0 U1)

ox

U)

wo x

x

m m

LU

I-

> w

a z C 0

I-i

wU

TIME (h) FIG. 7. Effect of JE downregulation on cell cycle reentry. Quiescent A31 cells were serum stimulated in the presence or absence of hydrocortisone, and the lag (G1) before S-phase entry was monitored by [3H]thymidine uptake into DNA. The percentage of labeled nuclei determined by autoradiography was plotted along with the densitometry analysis of JE expression data from Fig. 1 obtained in the absence (open bars) and in the presence (black bars) of dexamethasone.

activation of JE from its AP-1 element. This secondary effect of serum is protein synthesis dependent and explains the fact that JE mRNA levels remain high for longer periods of time. According to this model, only the primary (translationindependent) component would be contributing to the kinetics of JE induction by serum in the presence of hydrocortisone (black bars in Fig. 7). This component is superinduced by cycloheximide, explaining the lack of effect of hydrocortisone on JE expression when protein synthesis is inhibited (Fig. 1). The downregulatory effect of glucocorticoids on JE expression would therefore interfere exclusively with the second, AP-1-dependent component. It is interesting that the adenovirus EIA protein also represses JE basal expression (50) as well as collagenase and stromelysin gene expression (36). The mechanism involved in these effects of ElA has been proven to be the same as that described for the glucocorticoid receptor, namely, one working via AP-1 (36). It is of interest to determine whether JE expression in ElA-transformed cells can be further inhibited by glucocorticoids. Mitogenic and inflammatory agents such as PDGF, TPA, IL-1, and -y-interferon stimulate JE and KC expression (15, 38, 40, 43). As secreted proteins, JE and KC are not likely to play a role in the cellular response to these growth factors. Here, we directly address this question. We present evidence indicating that although JE and KC levels are dramatically reduced by glucocorticoid treatment, no effect is observed on serum, PDGF, or middle-T antigen stimulation of DNA synthesis or on the growth of 3T3 cells (Fig. 6 and 7). These results allow us to suggest that JE and KC are not essential components of the intracellular pathway which is triggered by growth factors and which leads to DNA synthesis and mitosis, but these gene products may be important signalling molecules that integrate the responses of different cell types. Downregulation of the genes encoding IL-1, tumor necrosis factor, and the metalloproteases collagenase and stromelysin have been proposed to be involved in the anti-inflammatory and antitumor effects of glucocorticoids (8, 20, 27, 31). Downregulation of JE and KC is also likely to be involved in the anti-inflammatory effects of glucocorticoids. However, the role of these genes in the antitumor

effects of glucocorticoids has yet to be clarified. It has recently been shown that overexpression of JE suppresses tumor formation induced by malignant cells (42), suggesting that the JE gene product may not be involved in the antitumor effects of glucocorticoids. Glucocorticoid hormones have been shown to potentiate the action of growth factors like FGF (3) and PDGF (Fig. 6), but the molecular basis for this phenomenon is not known. The results presented here indicate that dexamethasone treatment has no effect on basal c-myc levels in quiescent 3T3 cells but dramatically increases the serum-induced c-myc levels (Fig. 2). High c-myc levels are strongly correlated with cell proliferating potential (4). We believe that the potentiating effect of glucocorticoids on competence growth factors may be due to higher steady-state levels of c-myc transcripts. Whether this is the result of c-myc gene induction or c-myc RNA stabilization remains to be clarified. It would be interesting to examine the c-myc mRNA levels in cell lines that respond to glucocorticoids with a decreased proliferating potential.

ACKNOWLEDGMENTS We are deeply grateful to Hugo A. Armelin for enlightening discussions and critical reading of the manuscript, Hernan Chaimovich for helpful comments and manuscript review, Charles D. Stiles and Brent Cochran for the JE and KC plasmids, Ulla Hansen for materials and facilities, and Ivarne Tersariol for the densitometric tracings. This work was supported by FAPESP, CNPq, FBB, TWAS, and ICGEB-UNIDO. L.E.R. was a FAPESP graduate fellow. REFERENCES 1. Angel, P., M. Imagawa, R. Chiu, B. Stein, R. J. Imbra, H. J. Rahmsdorf, C. Jonat, P. Herrlich, and M. Karin. 1987. Phorbol ester-inducible genes contain a common cis element recognized by a TPA-modulated trans-acting factor. Cell 49:729-739. 2. Anisowicz, A., D. Zajchowski, G. Stenman, and R. Sager. 1988. Functional diversity of gro gene expression in human fibroblasts and mammary epithelial cells. Proc. Natl. Acad. Sci. USA 85:9645-9649. 3. Armelin, H. A. 1973. Pituitary extracts and steroid hormones in the control of 3T3 cell growth. Proc. Natl. Acad. Sci. USA

4620

RAMEH AND ARMELIN

70:2702-2706. 4. Armelin, H. A., M. C. S. Armelin, K. Kelly, T. Stewart, P. Leder, B. H. Cochran, and C. D. Stiles. 1984. Functional role for c-myc in mitogenic response to platelet-derived growth factor. Nature (London) 310:655-660. 5. Armelin, M. C. S., and H. A. Armelin. 1983. Glucocorticoid hormone modulation of both cell surface and cytoskeleton related to growth control of rat glioma cells. J. Cell Biol. 97:459-465. 6. Ausubel, F. M., R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl. 1989. Current protocols in molecular biology. John Wiley & Sons, New York. 7. Belman, S., and W. Troll. 1972. The inhibition of croton-oil promoted mouse skin tumorigenesis by steroid hormones. Cancer Res. 32:450-454. 8. Beutler, B., N. Krochin, I. W. Milsark, C. Luedke, and A. Cerami. 1986. Control of cachectin (tumor necrosis factor) synthesis: mechanisms of endotoxin resistance. Science 232: 978-980. 9. Blackwod, E. M., and R. Eisenman. 1991. Max: a helix-loophelix-zipper protein that forms a sequence-specific DNA-binding complex with myc. Science 251:1211-1217. 10. Bohmann, D., T. J. Bos, A. Admon, T. Nishimura, P. K. Vogt, and R. Tjian. 1987. Human proto-oncogene c-jun encodes a DNA-binding protein with structural and functional properties of transcription factor AP-1. Science 238:1386-1392. 11. Boyle, W. J., T. Smeal, L. H. K. Defize, P. Angel, J. R. Woodgett, M. Karin, and T. Hunter. 1991. Activation of protein kinase C decreases phosphorylation of c-jun at sites that negatively regulate its DNA-binding activity. Cell 64:573-594. 12. Bravo, R. 1990. Growth factor inducible genes in fibroblasts, p. 324-343. In A. Habenicht (ed.), Growth factors, differentiation factors and cytokines. Springer-Verlag KG, Berlin. 13. Chirgwin, J., A. Aeyble, R. McDonald, and W. Rutter. 1979. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 8:5294-5299. 14. Chiu, R., W. J. Boyle, J. Meek, T. Smeal, T. Hunter, and M. Karin. 1988. The c-fos protein interacts with c-jun/AP-1 to stimulate transcription of AP-1 responsive genes. Cell 54:541552. 15. Cochran, B. H., A. C. Reffel, and C. D. Stiles. 1983. Molecular cloning of sequences regulated by platelet-derived growth factor. Cell 33:939-947. 16. Cochran, B. H., J. Townes, and T. E. Hayes. 1988. Transcriptional regulation of competence genes in Balb/c-3T3 cells, p. 225-241. In Cellular factors in development and differentiation: embryos, teratocarcinomas, and differentiated tissues. Allan R. Liss, Inc., New York. 17. Diamond, M. I., J. N. Miner, S. K. Yoshinaga, and K. Yamamoto. 1990. Transcription factor interactions: selectors of positive or negative regulation from a single DNA element. Science 249:1266-1272. 18. Feinberg, A., and B. Vogelstein. 1984. A technique for radiolabelling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 137:266-267. (Addendum). 19. Fort, P., L. Marty, M. Piechaczyk, C. Dani, P. Jeanteur, and J. M. Blanchard. 1985. Various rat adult tissues express only one major mRNA species from the glyceraldehyde-3-phosphate dehydrogenase multigenic family. Nucleic Acids Res. 13:14311442. 20. Frish, S. M., and H. E. Ruley. 1987. Transcription from the stromelysin promoter is induced by interleukin-1 and repressed by dexamethasone. J. Biol. Chem. 34:16300-16304. 21. Garcia-Leme, J. 1989. Hormones and inflammation. CRC Press, Inc., Boca Raton, Florida. 22. Geisse, S., C. Scheidereit, H. M. Wostphal, N. E. Hynes, B. Groner, and M. Beato. 1982. Glucocorticoid receptors recognize DNA sequences in and around murine mammary tumor virus DNA. EMBO J. 1:1613-1619. 23. Gutman, A., and B. WasylyL 1991. Nuclear target for transcription regulation by oncogenes. Trends Genet. 7:49-99. 24. Hall, D. J., J. A. Alberta, and C. D. Stiles. 1989. Labile repressors are involved in the transcriptional control of PDGF-

MOL. CELL. BIOL.

responsive genes. Oncogene Res. 4:177-184. 25. Herrlich, P., and H. Ponta. 1989. Nuclear oncogenes convert extracellular stimuli into changes in the genetic program. Trends Genet. 5:112-116. 26. Holt, J. T., T. Y. Gopal, A. D. Roulton, and A. Nienhuis. 1986. Inducible production of c-fos antigene RNA inhibits 3T3 cell proliferation. Proc. Natl. Acad. Sci. USA 83:4794-4798. 27. Jonat, C., H. J. Rahmsdorf, K. K. Park, A. C. B. Cato, S. Gebel, H. Ponta, and P. Herrlich. 1990. Anti-tumor promotion and anti-inflammation: down modulation of AP-1 (fos/jun) activity by glucocorticoid hormone. Cell 62:1189-1204. 28. Kaczmarek, L., J. K. Hyland, R. Watt, M. Rosenberg, and R. Baserga. 1985. Microinjected c-myc as a competence factor. Science 228:1313-1315. 29. Kawahara, R. S., Z. W. Deng, and T. F. Deuel. 1991. Glucocorticoids inhibit the transcriptional induction of JE, a plateletderived growth factor-inducible gene. J. Biol. Chem. 266:1326113266. 30. Kovary, K., and R. Bravo. 1991. Expression of different jun and fos proteins during the GO-to-G1 transition in mouse fibroblasts: in vitro and in vivo associations. Mol. Cell. Biol. 11:2451-2459. 31. Lee, S. W., A. P. Tsou, H. Chan, J. Thomas, K. Petrie, E. M. Eugui, and A. C. Allison. 1988. Glucocorticoids selectively inhibit the transcription of the interleukin 1-beta gene and decrease the stability of interleukin 1-beta mRNA. Proc. Natl. Acad. Sci. USA 85:1204-1208. 32. Lee, W., P. Mitchell, and R. Tijan. 1987. Purified transcription factor AP1 interacts with TPA-inducible enhancer elements. Cell 49:741-752. 33. Lucibello, F. C., E. P. Slater, K. U. Jooss, M. Beato, and R. Muller. 1990. Mutual transrepression of fos and the glucocorticoid receptor: involvement of a functional domain in fos which is absent in fos B. EMBO J. 9:2827-2834. 34. Matin, A., K.-L. Cheng, T.-C. Suen, and M. C. Hung. 1990. Effects of glucocorticoids on oncogene transformed NIH 3T3 cells. Oncogene 5:111-116. 35. Nishikura, K., and J. Murray. 1987. Antisense RNA of protooncogene c-fos blocks renewed growth of quiescent 3T3 cells. Mol. Cell. Biol. 7:639-649. 36. Offringa, R., S. Gebel, H. van Dam, M. Timmers, A. Smits, R. Zwart, B. Stein, J. L. Bos, A. van der Eb, and P. Herrlich. 1990. A novel function of the transforming domain of Ela: repression of AP-1 activity. Cell 62:527-538. 37. Pfahl, M. 1982. Specific binding of the glucocorticoid-receptor complex to the mouse mammary tumor proviral promoter region. Cell 31:475-482. 38. Prpic, V., Y. Sheau-Fung, F. Figueiredo, P. Hollenbach, G. Gawdi, B. Herman, R. J. Uhing, and D. 0. Adams. 1989. Role of Na+/H+ exchange by interferon gamma in enhanced expression of JE and I-A beta genes. Science 244:469-471. 39. Rameh, L. E., and M. C. S. Armelin. 1991. T antigens' role in polyomavirus transformation: c-myc but not c-fos or c-jun is a target for middle T. Oncogene 6:1049-1056. 39a.Rameh, L. E., and M. C. S. Armelin. Unpublished data. 40. Ran, W., M. Dean, R. A. Levine, C. Hankle, and J. Campisi. 1986. Induction of c-fos and c-myc mRNA by epidermal growth factor or calcium ionophore is cAMP dependent. Proc. Natl. Acad. Sci. USA 83:8216-8220. 41. Riabowol, K., R Vosatka, E. Ziff, N. Lamb, and J. Feramisco. 1988. Microinjection of fos-specific antibodies blocks DNA synthesis in fibroblast cells. Mol. Cell. Biol. 8:1670-1676. 42. Rollings, B. J., and M. E. Sunday. 1991. Suppression of tumor formation in vivo by expression of the JE gene in malignant cells. Mol. Cell. Biol. 11:3125-3130. 43. Rollings, B. J., E. Morrison, and C. D. Stiles. 1988. Cloning and expression of JE, a gene inducible by platelet-derived growth factor and whose product has cytokine-like properties. Proc. Natl. Acad. Sci. USA 85:3738-3742. 44. Sakai, D. D., D. Helms, J. Carlstedt-Duke, J. Gustafsson, F. M. Roitman, and K. R. Yamamoto. 1988. Hormone-mediated repression: a negative glucocorticoid response element from the bovine prolactin gene. Genes Dev. 2:1144. 45. Scheidereit, C., S. Geisse, H. M. Wostphal, and M. Brato. 1983.

VOL. 12, 1992

46.

47.

48. 49.


The glucocorticoid receptor binds to defined nucleotide sequences near the promoter of mouse mammary tumor virus. Nature (London) 304:749-752. Schule, R., P. Rangarajan, S. Kliewer, L. J. Ransone, J. Bolado, N. Yang, I. M. Verma, and R. M. Evans. 1990. Functional antagonism between oncoprotein c-jun and the glucocorticoid receptor. Cell 62:1217-1226. Shapiro, D. J., P. A. Sharp, W. W. Wahly, and M. J. Keller. 1988. A high-efficiency HeLa cell nuclear transcription extract. DNA 7:47-55. Stewart, T., P. K. Pattengale, and P. Leder. 1984. Spontaneous mammary adenocarcinoma in transgenic mice that carry and express MTV/myc fusion genes. Cell 38:627-637. Thomas, P. S. 1980. Hybridization of denatured RNA and small DNA fragments transferred to nitrocellulose. Proc. Natl. Acad. Sci. USA 77:5201-5205.

4621

50. Timmers, H. T. M., H. Dam, J. P. GUsbertus, J. L. Bos, and A. J. Van der Eb. 1989. Adenovirus ElA represses transcription of cellular JE gene. J. Virol. 63:1470-1473. 51. Timmers, H. T. M., G. J. Pronk, J. L. Bos, and A. J. Van der Eb. 1990. Analysis of the rat JE gene promoter identifies an AP-1 binding site essential for basal expression but not for TPA induction. Nucleic Acids Res. 18:23-34. 52. Yang-Yen, H. F., J. C. Chambard, Y. L. Sun, T. Smeal, T. J. Schmidt, J. Droulin, and M. Karin. 1990. Transcriptional interference between c-jun and the glucocorticoid receptor: mutual inhibition of DNA binding due to direct protein-protein interaction. Cell 92:1205-1215. 53. Zullo, J. N., B. H. Cochran, A. S. Herang, and C. D. Stiles. 1985. Platelet-derived growth factor and double-stranded ribonucleic acids stimulate expression of the same genes in 3T3 cells. Cell 43:793-800.