dsAAV8-mediated gene transfer and &beta - Nature

Gene Therapy (2012) 19, 791 - 799 & 2012 Macmillan Publishers Limited All rights reserved 0969-7128/12 www.nature.com/gt

ORIGINAL ARTICLE

dsAAV8-mediated gene transfer and b-cell expression of IL-4 and b-cell growth factors are capable of reversing early-onset diabetes in NOD mice DF Gaddy1, MJ Riedel2, S Bertera3, TJ Kieffer2 and PD Robbins1 Type-I diabetes is a chronic disease mediated by autoimmune destruction of insulin-producing b-cells. Although progress has been made towards improving diabetes-associated pathologies and the quality of life for those living with diabetes, no therapy has been effective at eliminating disease manifestations or reversing disease progression. Here, we examined whether doublestranded adeno-associated virus serotype 8 (dsAAV8)-mediated gene delivery to endogenous b-cells of interleukin (IL)-4 in combination with b-cell growth factors can reverse early-onset diabetes in NOD mice. Our results demonstrate that a single treatment with dsAAV8 vectors expressing IL-4 in combination with glucagon-like peptide-1 or hepatocyte growth factor/NK1 under the regulation of the insulin promoter enhanced b-cell proliferation and survival in vivo, significantly delaying diabetes progression in NOD mice, and reversing disease in B10% of treated NOD mice. These results demonstrate the ability to reverse hyperglycemia in NOD mice with established diabetes by in vivo gene transfer to b-cells of immunomodulatory factors and b-cell growth factors. Gene Therapy (2012) 19, 791 -- 799; doi:10.1038/gt.2011.181; published online 17 November 2011 Keywords: adeno-associated virus; type-I diabetes; glucagon-like peptide-1; hepatocyte growth factor; interleukin-4

INTRODUCTION Autoimmune type-I diabetes (T1D) is an organ-specific disease that is characterized by the destruction of pancreatic islet b-cells by autoreactive T cells. The disease is most prominent among young children with B40 cases per 10 000 children at a peak age of onset at 11 -- 12 years of age. Although insulin treatment can partially ameliorate symptoms of the disease, autoimmunemediated destruction of b-cells eventually leads to complications such as nephropathy, microvascular disease, blindness and atherosclerosis. Preventing progression of T1D in its early stages requires controlling the autoimmune component of T1D at the time of disease onset and protecting or expanding the remaining functional b-cells. Multiple gene transfer approaches have been investigated for the delivery of immunomodulating agents in animal models of T1D. These approaches have relied primarily on approaches to increase the systemic level of therapeutic proteins such as anti-inflammatory cytokines, raising concerns that the increased, sustained systemic levels may have adverse effects. To bypass the need for systemic levels of immunomodulatory proteins to treat T1D, we have developed an approach for conferring long-term, local b-cell-specific expression by systemic gene transfer of self-complementary, double-stranded adeno-associated virus serotype 8 (dsAAV8) containing the murine preproinsulin-II promoter (MIP).1 We have previously demonstrated that AAV gene transfer of interleukin-4 (IL-4) to endogenous b-cells in young, non-diabetic NOD mice prevented the onset of hyperglycemia in these mice and reduced the severity of insulitis.1 However, although local expression of murine IL-4 in islets prevented islet destruction and

blocked autoimmunity in NOD mice when administered before the onset of hyperglycemia, AAV-mediated gene transfer of IL-4 to b-cells of early-onset diabetic NOD mice was unable to reverse hyperglycemia (unpublished results). Although it is clear that modulation of the autoimmune mechanisms responsible for b-cell destruction is necessary, a successful therapy for T1D likely will require promotion of b-cell growth or neogenesis. Multiple b-cell growth factors have been tested for their abilities to induce b-cell proliferation, including glucagon-like peptide-1 (GLP-1) and hepatocyte growth factor (HGF), which exhibit multiple glucoregulatory and anti-diabetic properties. Although protein-based therapies using GLP-1 or HGF are attractive, and GLP-1 peptide therapy is currently used clinically, GLP-1 or HGF gene transfer offers therapeutic advantages. In particular, gene transfer has the potential to overcome the need for repeated daily administrations of peptide therapies. Indeed, we have shown that dsAAV8-mediated administration of GLP-1 provides long-term, high-level GLP-1 expression.2 In addition, in vivo gene transfer offers the possibility of targeted, localized expression, overcoming potential adverse effects associated with systemic therapies. This may be particularly advantageous for HGF gene transfer, as systemic overexpression of HGF is associated with increased risk of some cancers.3 - 5 The safety of HGF may be further enhanced by using the N-terminal NK1 domain of HGF (HGF/NK1), which provides partial activity of full-length HGF, but has not been associated with increased cancer susceptibility.6 - 8 We have recently demonstrated that HGF/NK1 expressed in b-cells after dsAAV8-mediated gene transfer improves pathology in a mouse model of type-II diabetes.9

1 Department of Microbiology and Molecular Genetics, University of Pittsburgh School of Medicine, Pittsburgh, PA, USA; 2Laboratory of Molecular and Cellular Medicine, Departments of Cellular and Physiological Sciences and Surgery, Life Sciences Institute, University of British Columbia, Vancouver, BC, Canada and 3Rangos Research Center, Diabetes Research Institute, Children’s Hospital of Pittsburgh of University of Pittsburgh Medical Center, Pittsburgh, PA, USA. Correspondence: Dr PD Robbins, Department of Microbiology and Molecular Genetics, University of Pittsburgh School of Medicine, 437 Bridgeside Point II, 450 Technology Drive, Pittsburgh, PA 15219, USA. E-mail: [email protected] Received 15 February 2011; revised 18 August 2011; accepted 26 August 2011; published online 17 November 2011

Reversal of established diabetes through gene transfer DF Gaddy et al

792

Here, we examined the ability of dsAAV8-mediated delivery of IL-4 in combination with either GLP-1 or HGF/NK1 to endogenous b-cells to reverse early-onset diabetes in NOD mice. We demonstrate that the combination of IL-4 with either GLP-1 or HGF/NK1 significantly delayed or reversed the progression of diabetes. Taken together, these data suggest that combinatorial gene therapy involving immunomodulatory agents and b-cell growth factors has significant therapeutic potential for treatment of T1D.

RESULTS dsAAV-mediated expression of GLP-1 and HGF/NK1 in b-cells induces islet growth Recombinant GLP-1 and HGF are known to promote b-cell proliferation and increase b-cell mass.10,11 To determine whether AAV-mediated expression of GLP-1 and HGF/NK1 is capable of promoting islet proliferation in vivo, islet size was initially analyzed in 4-week-old female Balb/c mice treated with a single intraperitoneal (i.p.) injection of 4 1011 viral genomes (vg) of dsAAVenhanced green fluorescent protein (dsAAV-eGFP), dsAAV-GLP-1 or dsAAV-NK1. At 3 and 8 weeks after treatment, mice were killed, pancreata collected and sections analyzed for insulin expression. Similar to our previous observations, there was significant size

increase among islets infected with dsAAV-GLP-1 and dsAAV-NK1 stained for insulin at 3 and 8 weeks after treatment (Figures 1a and b). Gene transfer of immunomodulatory and b-cell growth factors can reverse early-onset diabetes in NOD mice We have previously shown that dsAAV8-mediated gene transfer of the immunomodulatory cytokine IL-4 to endogenous b-cells of 4-week-old NOD mice prevents the onset of diabetes,1 but has no effect after the onset of hyperglycemia (unpublished data, but see Figure 2). Here, we examine the ability of combined treatment with AAV vectors expressing IL-4 with a b-cell growth factor to reverse established diabetes in NOD mice. Female NOD mice spontaneously develop insulitis at B4 weeks of age, followed by the onset of hyperglycemia between 12 and 18 weeks of age in 80 -- 90% of animals. Therefore, blood glucose levels of female NOD mice were monitored weekly from 10 weeks of age. Hyperglycemia was defined as two consecutive blood glucose readings 4250 mg per 100 ml (14 mmol l1). At the onset of hyperglycemia, mice were treated with dsAAV8 vectors expressing eGFP, GLP-1, HGF/NK1, IL-4 or the indicated combinations (Figure 2). In addition, at the time of infection, mice were treated with a single subcutaneous insulin pellet (LinShin Canada, Toronto, ON, Canada), which temporarily decreased blood glucose

Figure 1. GLP-1 and HGF/NK1 gene transfer enhance islet size in Balb/c mice. (a) Pancreas sections from 3- and 8-week-old Balb/c mice treated with dsAAV-eGFP, dsAAV-GLP-1 or dsAAV-NK1 were stained for insulin, illustrating larger islets in mice that received the GLP-1 or HGF/NK1 viruses compared with the control virus. (b) Quantification of insulin-stained pancreatic sections revealed a significant increase in the areas of islets in 8-week-old mice treated with dsAAV-GLP-1 and dsAAV-NK1 compared with mice receiving dsAAV-eGFP. Magnification ¼ 20, scale bars ¼ 100 mm. Data are presented as the mean±s.e.m. of at least two sections per mouse, n ¼ 3 mice per group. *Po0.05. dsAAV-eGFP, double-stranded adeno-associated virus serotype 8-enhanced green fluorescent protein; GLP-1, glucagon-like peptide-1; HGF, hepatocyte growth factor. Gene Therapy (2012) 791 - 799

& 2012 Macmillan Publishers Limited


793

Figure 2. Combination therapies of GLP-1/IL-4 and NK1/IL-4 gene transfer prolong normoglycemia in diabetic NOD mice. Diabetic female NOD mice were injected i.p. with 4 1011 vg dsAAV-eGFP (a; n ¼ 4), dsAAV-IL-4 (b; n ¼ 4), dsAAV-GLP-1 (c; n ¼ 4), dsAAV-NK1 (d; n ¼ 4) or combinations of dsAAV-GLP-1 and dsAAV-IL-4 (e; n ¼ 18) or dsAAV-NK1 and dsAAV-IL-4 (f; n ¼ 15). At the time of treatment, mice received a single subcutaneous insulin pellet. Blood glucose levels were monitored weekly until mice returned to hyperglycemia or the experiment was ended at 42 weeks of age. (g) The percentage of diabetes-free animals, defined as having blood glucose levels o280 mg per 100 ml, are plotted against time after treatment. A P-value of o0.005 by log-rank test analysis was used to indicate a statistically significant percentage of normoglycemic animals. (h) Intraperitoneal glucose tolerance tests were performed on 42-week-old NOD mice that remained normoglycemic after combination treatments. The blood glucose clearance rate was similar in both sets of mice and significantly improved compared with diabetic eGFP control mice. These data represent the mean±s.d. of at least two mice in each group. dsAAV, double-stranded adenoassociated virus serotype 8; eGFP, enhanced green fluorescent protein; GLP-1, glucagon-like peptide-1; IL-4, interleukin-4, i.p., intraperitoneal.

to normal levels for approximately 1 -- 2 weeks, allowing maximum viral transgene expression. b-cell-specific expression of transgenes from these vectors has previously been demonstrated, with no observed increase in circulating transgenes.1,2,9 As shown in & 2012 Macmillan Publishers Limited

Figure 2a, 100% of mice treated with the eGFP virus returned to hyperglycemia by 3 weeks after infection. Similarly, mice treated independently with IL-4 (Figure 2b), GLP-1 (Figure 2c) or HGF/NK1 (Figure 2d) all returned to hyperglycemia within 4 weeks. These Gene Therapy (2012) 791 - 799


794

data indicate that treatment with vectors expressing either IL-4 or the two b-cell growth factors was insufficient to reverse early-onset diabetes. In contrast, combination therapies with AAV expressing IL-4 and GLP-1 (GLP-1/IL-4; Figures 2e and g), as well as IL-4 and HGF/NK1 (NK1/IL-4; Figures 2f and g) resulted in statistically significant increases in periods of normoglycemia before treated mice returned to hyperglycemia. The average length of time before mice receiving eGFP or individual therapies returned to hyperglycemia was 2--2.5 weeks after treatment, whereas mice receiving combinatorial therapies remained normoglycemic for an average of 7 weeks. The response was particularly robust after GLP-1/IL-4 therapy, with 13 of 23 mice (57%) exhibiting an extension of disease-free response, relative to mice receiving eGFP or individual therapies, whereas 5 of 17 mice (29%) treated with the NK1/IL-4 combination exhibited extended disease-free responses.

Furthermore, B10% of treated mice remained normoglycemic until the experiment was concluded when mice were 42 weeks of age (24 -- 26 weeks after treatment). Mice at 42 weeks responded well to glucose challenge (Figure 2h), indicating that these mice were cured by combinatorial therapies. Gene transfer of IL-4 with GLP-1 or HGF/NK1 reduces insulitis in diabetic NOD mice Histological analysis of pancreatic tissues from cured mice was performed at 42 weeks of age and compared with early-diabetic eGFP control mice (Figure 3). As shown in Figure 3a, there was more severe mononuclear cell infiltration in and around islets in eGFP control mice. In contrast, cured mice receiving GLP-1 and IL-4 displayed far less mononuclear cell infiltration, with insulitis limited to the periphery of islets (peri-insulitis). Moreover, little or

Figure 3. Immunohistochemical analysis of infiltrating leukocytes in NOD mice. (a) H&E staining was performed on pancreatic sections from NOD mice. Panels represent cured mice treated with the combination of GLP-1/IL-4 viruses (center) and NK1/IL-4 viruses (right), compared with non-age-matched diabetic control mice treated with dsAAV-eGFP (left). Arrows indicate individual islets. (b) Insulitis scores were evaluated as described in the ‘Materials and methods’ section in mice treated with dsAAV-eGFP and the combination therapies, including uncured mice. Mice receiving the combination therapies had significantly higher percentages of islets free of infiltration (insulitis score 0), whereas mice treated with dsAAV-eGFP had significantly higher percentages of severe infiltration (insulitis score 4). (c) b-Cell mass was determined as described in the ‘Materials and methods’ section. *Po0.05. Data represent mean±s.e.m. of 20 -- 40 individual islets from each group, derived from at least 5 mice per group. Magnification ¼ 40, scale bars ¼ 100 mm. dsAAV-eGFP, double-stranded adeno-associated virus serotype 8-enhanced green fluorescent protein; GLP-1, glucagon-like peptide-1; H&E, hematoxylin and eosin. Gene Therapy (2012) 791 - 799



no infiltration was detected in or around islets of cured mice receiving HGF/NK1 and IL-4. Overall, average insulitis scores of all mice receiving the combination of GLP-1 and IL-4 viruses (1.52±0.25) and HGF/NK1 and IL-4 viruses (0.68±0.28), including uncured mice, were significantly lower than those of mice treated with the eGFP control virus (3.13±0.28; Figure 3b). The percentage of total intact islets and those with mild peri-insulitis was 55 and 82% for GLP-1/IL-4 and NK1/IL-4 treatments, respectively, compared with 21% in mice receiving the eGFP control virus. Furthermore, 54% of eGFP virustreated mice displayed severe insulitis (insulitis score 4), whereas only 23% of GLP-1/IL-4-treated mice and 9% of NK1/IL-4-treated mice displayed severe insulitis (Figure 3b). b-cell mass is enhanced after treatment with IL-4 in combination with GLP-1 or HGF/NK1 Recombinant GLP-1 and HGF/NK1 have previously been shown to increase b-cell mass,10,11 and Figure 1 illustrates that the dsAAV8mediated expression of GLP-1 and HGF/NK1 in endogenous b-cells increases overall islet size. To quantify the effects of GLP-1/IL-4 and NK1/IL-4 gene therapies on islet growth in earlyonset diabetic NOD mice, b-cell mass was determined as described in the ‘Materials and methods’ section. As shown in Figure 3c, NOD mice treated with GLP-1/IL-4 and NK1/IL-4 gene therapies exhibited significantly greater b-cell mass than did mice injected with the eGFP control virus. Interestingly, no significant increase in islet number per pancreas was observed in either of the therapeutic groups (data not shown), suggesting that the increased b-cell mass is due to enhanced proliferation of existing b-cells or suppression of b-cell death, as opposed to b-cell neogenesis. Growth factor and IL-4 combination therapies promote b-cell proliferation and prevent b-cell apoptosis The increase in b-cell mass observed in mice receiving GLP-1/IL-4 and NK1/IL-4 gene therapies may be due to increased b-cell proliferation, a reduction in b-cell death or a combination of these factors. We have previously demonstrated that dsAAV-GLP-1 increases b-cell proliferation in streptozotocin-treated mice.2 To address this question in early-onset diabetic NOD mice, pancreatic sections from mice receiving the indicated treatments were examined for expression of Ki67, a proliferation marker. As indicated in Figure 4a, nuclear expression of Ki67 in insulin-positive b-cells increased significantly in mice after injection with both GLP-1/IL-4 and NK1/IL-4 combination therapies. Quantification of Ki67 staining (Figure 4b) revealed an B6-fold increase in the percentage of Ki67 þ /insulin þ b-cells in mice receiving AAV-GLP-1 and AAV-IL-4 viruses (2.03±0.26) or AAV-NK1 and AAV-IL-4 viruses (1.77±0.27) compared with mice receiving eGFP control virus (0.31±0.28). In addition to enhanced b-cell proliferation, GLP-1/IL-4 and NK1/IL-4 gene therapies were equally effective at preventing apoptotic b-cell death in early-onset diabetic NOD mice (Figure 5). An B10-fold increase in the percentage of TUNEL þ (terminal deoxynucleotidyl transferase dUTP nick-end labeling)/insulin þ b-cells was observed in dsAAV-eGFP-injected mice (4.23±0.73) compared with mice receiving GLP-1/IL-4 (0.44±0.18) or NK1/IL-4 (0.53±0.14) gene therapies (Figure 5b). Taken together, data presented in Figures 4 and 5 indicate that a combination of enhanced b-cell proliferation and survival leads directly to the observed increases in islet size and b-cell mass. DISCUSSION An ideal immunomodulating agent for diabetes would specifically halt b-cell destruction without causing systemic immunosuppression or inhibiting b-cell regeneration. At the onset of clinical & 2012 Macmillan Publishers Limited

diabetes, there is still significant residual b-cell mass, and early intervention with an effective immunotherapy during this period has the potential to restore tolerance and allow endogenous cells to regenerate islets.12 Systemic delivery of TH2 cytokines, including IL-4 and IL-10, prevents the onset of diabetes in multiple animal models,13 - 16 but is unable to reverse established diabetes. Similarly, we have previously demonstrated that AAVmediated gene transfer of IL-4 to b-cells in vivo in NOD mice could prevent the onset of diabetes,1 but could not reverse established disease. Thus, we examined whether gene transfer of IL-4, in combination with b-cell growth factors, GLP-1 and HGF/NK1 to expand the residual islet mass, is sufficient to reverse established diabetes in NOD mice. Glucagon-like peptide-1 is an incretin hormone secreted by intestinal L-cells in response to meal ingestion. It has various glucoregulatory actions, including glucose-dependent enhancement of insulin secretion, stimulation of insulin synthesis, inhibition of glucagon secretion and enhancement of b-cell mass by promoting b-cell proliferation and neogenesis while inhibiting b-cell apoptosis.3 - 9 Moreover, we have recently demonstrated that a dsAAV8 vector providing b-cell-specific expression of GLP-1 prevents chemically induced diabetes after multiple low-dose streptozotocin treatments in a mouse model of T1D.2 Similarly, HGF is a mesenchyme-derived, multifunctional growth factor that has a critical role in cell survival, proliferation, migration and differentiation.17,18 Transgenic mice overexpressing HGF in b-cells exhibit increased b-cell proliferation, function and survival.11 HGF has previously been delivered to islets through gene transfer, reducing b-cell death, reducing the minimal islet mass required for successful transplant and improving overall transplant outcome.12, 13 Moreover, we have recently demonstrated that both dsAAV-GLP-1 and dsAAV-NK1 are capable of prolonging normoglycemia in the db/db mouse model of type-II diabetes.9 Our results demonstrate that dsAAV8 gene transfer of the growth factors, GLP-1 and HGF/NK1, with the immunomodulatory cytokine IL-4, significantly improves pathology of early diabetic NOD mice. A single i.p. injection, resulting in b-cell-specific expression of these factors, significantly increases b-cell proliferation and survival, leading to larger islets and enhanced b-cell mass. When combined with the immunomodulatory effects of IL4, these effects significantly prolonged normoglycemia and reduced the frequency of hyperglycemia and insulitis. Moreover, these vectors successfully reversed established diabetes in B10% of treated animals, suggesting that dsAAV8 gene transfer of both immunomodulatory factors and certain b-cell growth factors has the potential to cure established diabetes. Experiments comparing the levels of CD4 þ /Foxp3 þ regulatory T cells revealed no significant difference between cured and diabetic mice (data not shown), suggesting that this may not be the mechanism by which these therapies function to reverse T1D. Although we were unable to reverse T1D in the majority of treated NOD mice with early-onset T1D, there is the potential to increase the therapeutic efficiency of this approach. Although the dose of 4 1011vg per mouse used in these studies was sufficient to transduce a percentage of b-cells in the islets, it might be possible to increase transduction using higher doses of virus or alternative routes of delivery. Indeed, we previously demonstrated that retrograde pancreatic intraductal delivery, similar to the commonly used clinical technique of endoscopic retrograde cholangiopancreatography, provides enhanced transduction of b-cells within islets.19 Therefore, this approach, although more complicated in a mouse model, may be superior and more clinically relevant than the more commonly used i.p. injection. Moreover, it is possible that immunomodulatory genes other than IL-4 might be more effective in blocking autoimmunity at this later stage of disease. However, taken together, the data presented here demonstrate that the combination of AAV vectors expressing both immunomodulatory factors and b-cell growth factors are Gene Therapy (2012) 791 - 799

795


796

Figure 4. Gene transfer of IL-4 with either GLP-1 or HGF/NK1 increases b-cell proliferation in early-onset diabetic NOD mice. (a) Pancreatic sections from NOD mice infected with dsAAV-eGFP or the combinations of dsAAV-GLP-1 and dsAAV-IL-4 or dsAAV-NK1 and dsAAV-IL-4 were stained for insulin (red) and the proliferation marker, Ki67 (green). Arrowheads indicate cells that are double positive for insulin and Ki67. Magnification ¼ 40, scale bars ¼ 100 mm. (b) Quantification of Ki67-positive b-cells, expressed as the mean±s.e.m. of Ki67-positive, insulinpositive cells in 20 -- 40 individual islets from each group, derived from at least 5 mice per group. *Po0.0009. dsAAV-eGFP, double-stranded adeno-associated virus serotype 8-enhanced green fluorescent protein; GLP-1, glucagon-like peptide-1; HGF, hepatocyte growth factor; IL-4, interleukin-4.

capable of reversing established diabetes, and have potential as novel therapies for T1D. It is important to note that in this study, we chose to use the NK1 fragment of HGF as it provides several advantages over full-length HGF, in addition to its small size. Systemic HGF overexpression in transgenic mice can result in neoplasms of the liver, mammary gland, skeletal muscle and melanocytes,20,21 but several studies have suggested that HGF/NK1 may be antagonistic to HGF-mediated tumorigenesis and HGF/NK1 has been studied as a potential cancer therapy.22,23 Other studies have suggested that HGF/NK1 is a partial agonist, capable of inducing 450% Gene Therapy (2012) 791 - 799

mitogenic activity of full-length HGF.6 - 8 The partial agonist activity of HGF/NK1 may have a role in improving its safety profile compared with full-length HGF. Indeed, although transgenic mice that systemically overexpress HGF/NK1 developed complications similar to those seen in full-length HGF transgenic mice, including increased susceptibility to some cancers, the HGF/NK1 phenotypes were significantly less severe than those seen in full-length HGF transgenic mice.7 Moreover, transgenic mice overexpressing HGF specifically in b-cells have not been associated with increased risk of tumorigenesis (AF Stewart, personal communication), suggesting that & 2012 Macmillan Publishers Limited


797

Figure 5. Combination therapies of IL-4 with either GLP-1 or HGF/NK1 promote b-cell survival in early-onset diabetic NOD mice. (a) Pancreatic sections from NOD mice infected with dsAAV-eGFP or the GLP-1/IL-4 and NK1/IL-4 combination therapies were stained for insulin (red) and subjected to TUNEL staining (green). Arrowheads indicate cells that are double positive for insulin and TUNEL. Magnification ¼ 40, scale bars ¼ 100 mm. (b) Quantification of TUNEL-positive b-cells, expressed as the mean±s.e.m. of TUNEL-positive, insulin-positive cells in 20 -- 40 individual islets from each treatment group, derived from at least 5 mice per group. *Po0.0002. dsAAV-eGFP, double-stranded adenoassociated virus serotype 8-enhanced green fluorescent protein; GLP-1, glucagon-like peptide-1; HGF, hepatocyte growth factor; IL-4, interleukin-4; TUNEL, terminal deoxynucleotidyl transferase dUTP nick-end labeling.

localized expression of HGF and HGF/NK1 may further enhance their safety.

MATERIALS AND METHODS Plasmids and viruses The plAdeno5 adenovirus helper plasmid, the AAV8 helper plasmid expressing the AAV8 cap and AAV2 rev genes, and the double-stranded AAV8 plasmid expressing eGFP flanked by inverted terminal repeats under control of the CMV promoter were gifts of Dr Hiroyuki Nakai of the & 2012 Macmillan Publishers Limited

University of Pittsburgh. cDNA for full-length murine HGF was a gift from Dr Andrew Stewart of the University of Pittsburgh. The NK1 fragment of HGF was obtained by PCR using primers 50 -CATCAGACCGGTGGATCCAGCC ATGATGTGGGGGACCAAACTTCT (sense) and 50 -GCGGCCGCGGATCCCTATT ACAACTTGTATGTCAAAATTACTTTGTGTATCC (anti-sense), which introduced AgeI and NotI sites (underlined), respectively. The original dsAAV-CMVeGFP expression plasmid was subsequently modified to express our transgenes of interest under the control of the MIP. The CMV promoter was excised using restriction enzymes MluI and KpnI. Subsequently, pAAV-MIPGLP-1 was generated by excising eGFP with restriction enzymes AgeI and XbaI, as described previously,2 and pAAV-MIP-HGF/NK1 was generated by Gene Therapy (2012) 791 - 799


798 excising eGFP with AgeI and NotI. Recombinant double-stranded AAV8 (dsAAV8) vectors were generated according to the triple transfection protocol as described previously,24 purified by double CsCl gradient centrifugation and viral genomes were quantitated by dot blot analysis. Construction of dsAAV-MIP-IL-4 has been described previously.1 For the remainder of this manuscript, these vectors will be referred to as dsAAVeGFP, dsAAV-GLP-1, dsAAV-NK1 and dsAAV-IL-4, respectively.

ACKNOWLEDGEMENTS This study was supported by a program grant from the Juvenile Diabetes Research Foundation (JDRF) to PDR, and DFG was supported by a fellowship from the JDRF. MJR was supported by the Michael Smith Foundation for Health Research (MSFHR), the Canadian Diabetes Association, the Stem Cell Network and the JDRF. TJK is a MSFHR senior scholar. We thank Maliha Zahid (University of Pittsburgh) for assistance with statistical analysis and Joan Nash (University of Pittsburgh) for assistance with microscopy analysis.

Animal studies Female Balb/c and NOD mice were obtained from Jackson Laboratories (Bar Harbor, ME, USA). All experiments were approved by the University of Pittsburgh Animal Care and Use Committee. Mice were maintained on a standard 12-h light/dark cycle and received a standard diet. Infections were carried out at a dose of 4 1011 vg per mouse. Mice receiving combination therapies received 4 1011 vg of each virus. Viruses were administered by i.p. injection in a total volume of 800 ml sterile saline solution supplemented with 5% sorbitol. Blood glucose monitoring was carried out at indicated time points on restrained, unanesthetized animals through tail vein bleeds.

I.p. glucose tolerance tests Intraperitoneal glucose tolerance tests were performed in NOD mice that survived to 42 weeks of age. Before the test, animals were fasted for 6 h followed by an i.p. administration of glucose (2 mg g1 body weight). Blood glucose levels were determined from tail vein blood samples at 0, 15, 30, 60 and 120 min after glucose administration.

Microscopy Pancreata were isolated from mice after CO2 asphyxiation, fixed in 10% buffered formalin overnight at 4 1C, then embedded in paraffin wax and sectioned at a thickness of 5 mm. Immunofluorescence staining was performed after antigen retrieval in 0.1 M citrate buffer (pH 6.0) for 10 min at 95 1C using antibodies for insulin (guinea pig polyclonal; Abcam, Cambridge, MA, USA), Ki67 (rabbit polyclonal; Abcam), Cy3-conjugated donkey-anti-guinea pig (Jackson ImmunoResearch, West Grove, PA, USA) and Alexa-488-conjugated goat-anti-rabbit (Invitrogen, Carlsbad, CA, USA). TUNEL staining was carried out using the DeadEnd Fluorometric TUNEL System (Promega, Madison, WI, USA) according to the manufacturer’s protocol. The relative b-cell area was determined by measuring the areas of insulin-stained islets using MetaMorph software (Molecular Devices, Sunnyvale, CA, USA). b-cell mass was determined using the following formula: b-cell mass (mg) ¼ area of insulin-stained islets/total pancreatic area total pancreas weight. Histological analysis of infiltrating mononuclear cells was performed by routine hematoxylin and eosin staining. Islets were assigned insulitis scores by investigators who were blinded to the treatment groups, and 20 - 40 islets were examined for each group. Intra-islet insulitis was scored according to the following classification scheme: 0 ¼ no lymphocytic infiltration; 1 ¼ peri-insulitis; 2 ¼ intrainsulitis affecting less than one-third of the islet area; 3 ¼ insulitis comprising one-third to two-thirds of the islet; 4 ¼ insulitis comprising more than two-thirds of the islet. The histology score index was calculated by dividing the sum of all individual islet scores by the total number of islets evaluated.1

Statistical analysis Statistical analysis was performed using the Stata 8.2 (STATA, College Station, TX, USA) software package, and the data collected were expressed as mean±s.e.m, unless otherwise noted. For most analyses, P-values were determined using Student’s t-test. The percentage of nondiabetic mice was calculated by Kaplan - Meier survival analysis. A P-value of o0.05, arrived at using analysis of variance and log rank test, was considered to indicate statistically significant difference.

CONFLICT OF INTEREST Dr Kieffer is a founder of Engene Inc., which is developing non-viral gene delivery methods to the gut for treatment of T1D. Dr Robbins is a member of the SAB for Engene.

Gene Therapy (2012) 791 - 799

REFERENCES 1 Rehman KK, Trucco M, Wang Z, Xiao X, Robbins PD. AAV8-mediated gene transfer of interleukin-4 to endogenous beta-cells prevents the onset of diabetes in NOD mice. Mol Ther 2008; 16: 1409 - 1416. 2 Riedel MJ, Gaddy DF, Asadi A, Robbins PD, Kieffer TJ. DsAAV8-mediated expression of glucagon-like peptide-1 in pancreatic beta-cells ameliorates streptozotocin-induced diabetes. Gene Therapy 2010; 17: 171 - 180. 3 Di Renzo MF, Poulsom R, Olivero M, Comoglio PM, Lemoine NR. Expression of the Met/hepatocyte growth factor receptor in human pancreatic cancer. Cancer Res 1995; 55: 1129 - 1138. 4 Natali PG, Nicotra MR, Di Renzo MF, Prat M, Bigotti A, Cavaliere R et al. Expression of the c-Met/HGF receptor in human melanocytic neoplasms: demonstration of the relationship to malignant melanoma tumour progression. Br J Cancer 1993; 68: 746 - 750. 5 Tuck AB, Park M, Sterns EE, Boag A, Elliott BE. Coexpression of hepatocyte growth factor and receptor (Met) in human breast carcinoma. Am J Pathol 1996; 148: 225 - 232. 6 Cioce V, Csaky KG, Chan AM, Bottaro DP, Taylor WG, Jensen R et al. Hepatocyte growth factor (HGF)/NK1 is a naturally occurring HGF/scatter factor variant with partial agonist/antagonist activity. J Biol Chem 1996; 271: 13110 - 13115. 7 Jakubczak JL, LaRochelle WJ, Merlino G. NK1, a natural splice variant of hepatocyte growth factor/scatter factor, is a partial agonist in vivo. Mol Cell Biol 1998; 18: 1275 - 1283. 8 Pediaditakis P, Monga SP, Mars WM, Michalopoulos GK. Differential mitogenic effects of single chain hepatocyte growth factor (HGF)/scatter factor and HGF/NK1 following cleavage by factor Xa. J Biol Chem 2002; 277: 14109 - 14115. 9 Gaddy DF, Riedel MJ, Pejawar-Gaddy S, Kieffer TJ, Robbins PD. In vivo expression of HGF/NK1 and GLP1 from dsAAV vectors enhances pancreatic beta cell proliferation and improves pathology in the db/db mouse model of diabetes. Diabetes 2010; 59: 3108 - 3116. 10 De Leoń DD, Deng S, Madani R, Ahima RS, Drucker DJ, Stoffers DA. Role of endogenous glucagon-like peptide-1 in islet regeneration after partial pancreatectomy. Diabetes 2003; 52: 365 - 371. 11 Garcia-Ocanã A, Takane KK, Syed MA, Philbrick WM, Vasavada RC, Stewart AF. Hepatocyte growth factor overexpression in the islet of transgenic mice increases beta cell proliferation, enhances islet mass, and induces mild hypoglycemia. J Biol Chem 2000; 275: 1226 - 1232. 12 Pasquali L, Giannoukakis N, Trucco M. Induction of immune tolerance to facilitate beta cell regeneration in type 1 diabetes. Adv Drug Deliv Rev 2008; 60: 106 - 113. 13 Cameron MJ, Arreaza GA, Zucker P, Chensue SW, Strieter RM, Chakrabarti S et al. IL-4 prevents insulitis and insulin-dependent diabetes mellitus in nonobese diabetic mice by potentiation of regulatory T helper-2 cell function. J Immunol 1997; 159: 4686 - 4692. 14 Lee M, Koh JJ, Han SO, Ko KS, Ki SW. Prevention of autoimmune insulitis by delivery of interleukin-4 plasmid using a soluble and biodegradable polymeric carrier. Pharm Res 2002; 19: 246 - 249. 15 Wood SC, Rao TD, Frey AB. Multidose streptozotocin induction of diabetes in BALB/cBy mice induces a T cell proliferation defect in thymocytes which is reversible by interleukin-4. Cell Immunol 1999; 192: 1 - 12. 16 Zipris D, Karnieli E. A single treatment with IL-4 via retrovirally transduced lymphocytes partially protects against diabetes in BioBreeding (BB) rats. JOP 2002; 3: 76 - 82. 17 Liu Y. Hepatocyte growth factor and the kidney. Curr Opin Nephrol Hypertens 2002; 11: 23 - 30. 18 Zarnegar R, Michalopoulos GK. The many faces of hepatocyte growth factor: from hepatopoiesis to hematopoiesis. J Cell Biol 1995; 129: 1177 - 1180. 19 Wang Z, Zhu T, Rehman KK, Bertera S, Zhang J, Chen C et al. Widespread and stable pancreatic gene transfer by adeno-associated virus vectors via different routes. Diabetes 2006; 55: 875 - 884. 20 Dai C, Li Y, Yang J, Liu Y. Hepatocyte growth factor preserves beta cell mass and mitigates hyperglycemia in streptozotocin-induced diabetic mice. J Biol Chem 2003; 278: 27080 - 27087.



799 21 Gahr S, Merger M, Bollheimer LC, Hammerschmied CG, Scholmerich J, Hugl SR. Hepatocyte growth factor stimulates proliferation of pancreatic beta-cells particularly in the presence of subphysiological glucose concentrations. J Mol Endocrinol 2002; 28: 99 - 110. 22 Lokker NA, Godowski PJ. Generation and characterization of a competitive antagonist of human hepatocyte growth factor, HGF/NK1. J Biol Chem 1993; 268: 17145 - 17150.


23 Youles M, Holmes O, Petoukhov MV, Nessen MA, Stivala S, Svergun DI et al. Engineering the NK1 fragment of hepatocyte growth factor/scatter factor as a MET receptor antagonist. J Mol Biol 2008; 377: 616 - 622. 24 Xiao X, Li J, Samulski RJ. Production of high-titer recombinant adenoassociated virus vectors in the absence of helper adenovirus. J Virol 1998; 72: 2224 - 2232.

Gene Therapy (2012) 791 - 799