Dynamic binding of Replication Protein A is

Supplemental material for Chen et al 2016, “Dynamic binding of Replication Protein A is required for DNA repair” Ran Chen, Shyamal Subramanyam, Adrian H. Elcock, Maria Spies, and Marc S. Wold

Supplemental materials and methods Partially duplex DNA structures and oligonucleotide sequences. RFL (replication fork like) DNA was annealed from four different oligonucleotides and contained both Cy3 and Cy5 dyes. Lagging strand: Oligo-G 5’CGTACTGCAATCTTGAACCG(T)20/Cy3/GGAATTAAGCTCTAAGCCATCC 3’, Oligo-H 5’ /Cy5/CGGTTCAAGATTGCAGTACG 3’; Leading strand: Oligo-I 5’ GCGTGATAGCATCCATGAGC 3’, Oligo-J 5’ GGATGGCTTAGAGCTTAATTCCGCTCATGGATGCTATCACGC 3’. Gap DNA was based on RFL and was made by annealing the lagging strand’s two oligonucleotides (Oligo-G and Oligo-H) with Oligo-JB 5’ GGATGGCTTAGAGCTTAATTCC 3’. Flap structures were also based on RFL. 5’ Flap was made by annealing Oligo-G, Oligo-JB and Oligo HO 5’ GCTCATGGATGCTATCACGCCGGTTCAAGATTGCAGTACG 3’. 3’ Flap was made by annealing Oligo-G, Oligo-H and Oligo-J. 20 nt Bubble DNA was annealed from: Oligo-BB 5’Cy3 CCCTAGATACCAGTAAGCCTAAGGCCGGATCTCGGGCCATCCATGTACGC 3’, OligoBT 5’GCGTACATGGATGGCTTAGAGCTTAATTCCGAATCTACTGGTATCTAGGG/Cy3/ 3’ For each DNA, 2 µM of the indicated oligonucleotides were mixed in annealing buffer (30 mM Tris-HCl (pH 7.5), 150 mM NaCl, and 0.5 M EDTA), denatured at 95 °C for five minutes and then slowly cooled to the room temperature for 2 hours. The annealed structures were characterized on gels to confirm integrity (Supplemental Figure 2) and stored at 4 °C. Fitting parameters to determine kinetic binding constants. The measured “on times” and “off times” from all RPA molecules were combined and binned to plot as a histogram and fit to single-exponential or double exponential equation in GraphPad Prism 6.0 software to obtain respective rate constants. The extracted “off times” were binned with the bin size of 3 sec and “on times” were binned with the bin size of 0.5 sec. To decide the optimal bin size, we initially utilized the web application for bin-width optimization (Ver.2.0) from Toyoizumi lab. After binning several data sets from RPA binding to dT35, we evaluated the quality of the fit, how the bin size affected the binding parameters and the amount of “noise” in the histograms. Based on these criteria, we were able to determine the optimal bin size for “on times” and “off times” and applied them for all our data to keep the fitting of the histograms consistent.

1

Once histograms were obtained, they were fit to one or two phase exponential decay equations. This enabled us to retrieve the rate constants and fraction of each term. In order to determine the best fit for the data, fits to one-phase decay or two-phase decay were compared by sum-ofsquares F-test (Prism). This method selects the simpler model unless the P-value for the more complex model is less than 0.05. Also, if one model was ambiguous (e.g. fitting does not return a unique set of parameters), the other model was chosen without formal comparison. In all cases where the double exponential provided a better fit, the p value was